Next Article in Journal
An openBIM Approach to IoT Integration with Incomplete As-Built Data
Previous Article in Journal
Microgravity-Induced Cell-to-Cell Junctional Contacts Are Counteracted by Antioxidant Compounds in TCam-2 Seminoma Cells
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

High-Yielding Lovastatin Producer Aspergillus terreus Shows Increased Resistance to Inhibitors of Polyamine Biosynthesis

by
Alexander A. Zhgun
1,*,
Gulgina K. Nuraeva
2 and
Ivan A. Volkov
2
1
Research Center of Biotechnology, Russian Academy of Sciences, 119071 Moscow, Russia
2
Moscow Institute of Physics and Technology, National Research University, 141700 Dolgoprudny, Russia
*
Author to whom correspondence should be addressed.
Appl. Sci. 2020, 10(22), 8290; https://doi.org/10.3390/app10228290
Submission received: 20 October 2020 / Revised: 13 November 2020 / Accepted: 20 November 2020 / Published: 23 November 2020
(This article belongs to the Section Applied Biosciences and Bioengineering)

Abstract

The biosynthesis of pharmaceutically significant secondary metabolites in filamentous fungi is a multistep process that depends on a wide range of various factors, one of which is the intracellular content of polyamines. We have previously shown that in Aspergillus terreus lovastatin high-yielding strain (HY) exogenous introduction of polyamines during fermentation can lead to an increase in the production of lovastatin by 20–45%. However, the molecular mechanisms of this phenomenon have not been elucidated. In this regard, we carried out an inhibitory analysis at the key stage of polyamine biosynthesis, the conversion of L-ornithine to putrescine by the enzyme ornithine decarboxylase (ODC). A. terreus HY strain showed upregulation of genes for biosynthesis of polyamines, 3–10-fold, and increased resistance compared to the original wild-type strain upon inhibition of ODC on synthetic medium with 5 mM α-difluoromethylornithine (DFMO), by 20–25%, and 5 mM 1-aminooxy-3-aminopropane (APA), by 40–45%. The data obtained indicate changes in the metabolism of polyamines in A. terreus HY strain. The observed phenomenon may have a universal character among fungal producers of secondary metabolites improved by classical methods, since previously the increased resistance to ODC inhibitors was also shown for Acremonium chrysogenum, a high-yielding producer of cephalosporin C.

1. Introduction

Filamentous fungus Aspergillus terreus is the main industrial producer of cholesterol-lowering drug lovastatin (LOV) and simvastatin obtained on its basis [1]. These drugs are competitive inhibitors of hydroxymethylglutaryl-CoA reductase (HMG-CoA; EC 1.1.1.88), which catalyzes the rate-limiting step of the isoprenoid biosynthesis pathway associated with the production of cholesterol in humans and ergosterol in fungi [2]. In nature, LOV is produced by fungi from various taxonomic groups, for example, Ascomycetes, Aspergillus, Doratomyces, Gymnoascus, Hypomyces, Monascus, Paecilomyces, Penicillium, Phoma, Trichderma or basidiomycetes Lenzites, Omphalotus, Phanerochaete, Pleurotus, Trametes and many others [3,4,5]. Since, in fungi, this secondary metabolite (SM) inhibits the biosynthesis of ergosterol, which is necessary for building the cytoplasmic membrane, the fungal LOV producers should be resistant themselves to it [6,7]. This is realized by placing into the LOV biosynthetic gene cluster (BGC, lov genes) not only genes for biosynthesis but also for LOV resistance [7,8]. Since lov genes for biosynthesis are linked to genes for LOV resistance, the horizontal transfer of lov BGC to one or another representative of fungi kingdom gives them the ability to not only attack competitors with LOV weapons, but also to defend themselves from exogenous LOV [8]. This may explain such a wide distribution of lov BGC in fungi [3].
The most important industrial LOV-producing strains are derived from A. terreus [1]. In the current study, we investigated A. terreus lovastatin high-yielding (HY) strain obtained after classical strain improvement (CSI) program after multi-round mutagenesis and screening [9]. In A. terreus HY strain, the LOV production is increased 200–300-fold compared to the original A. terreus wild-type (WT) strain [9,10]; lov genes and laeA gene (for global regulator of a fungal secondary metabolism) are upregulated [10,11]; the number of lov BGC copies does not increase [12]. The A. terreus HY strain also demonstrates a significant decrease in viability, expressed in a decrease in the growth rate on agar and liquid nutrient media, a partial reduction in the formation of conidia and the size of mycelium [10,12]. This may be due to the fact that CSI programs operate with random mutations and, during strain improvement, concomitant changes can be accumulated that negatively affect strain viability [13,14,15]. As a result, in the process of multi-round mutagenesis, a stage begins when the next mutagenic effect no longer leads to a further increase in the production of the target SM [16]. This final stage usually occurs after 20–50 rounds of mutagenesis, and determines the technological limit of the method, in relation to a particular strain [9,16,17,18].
Previously, it was shown that exogenously introduced polyamines (PAs), such as 1,3-diaminopropane (DAP) or spermidine (Spd), are able to increase the production of target SM in strains that have reached their technological limit [19,20]. In our previous work, we showed that the addition of PAs to complete agar medium leads to an increase in the viability of A. terreus HY, which is expressed in an increase in the number of germinating colonies [12]. Furthermore, the addition of 5 mM Spd during the fermentation of A. terreus HY increased the LOV yield by 20–45% and was accompanied by upregulation of the lov genes and laeA; however, the molecular mechanisms involved in this process have not been studied [12]. Recently, Acremonium chrysogenum cephalosporin C (CPC) high-yielding strain showed an increase in the content of PAs during the fermentation process, about 5-fold [21]. The improved strain A. chrysogenum strain also demonstrated the increased resistance to inhibitors of ornithine decarboxylase (ODC; EC 4.1.1.17), an enzyme of the key stage of PAs biosynthesis [21]. The question of whether this effect is unique or reflects universal trend arising from CSI of filamentous fungi has recently been discussed [16].
In this regard, the aim of our work was to perform the comparative inhibitory assay of ODC, the key and rate-limiting enzyme of PAs biosynthesis in filamentous fungi, for A. terreus WT and HY strains, amid the expression analysis of genes for lovastatin and polyamines biosynthesis.

2. Materials and Methods

2.1. Materials

1-aminooxy-3-aminopropane (APA) was a kind gift from Prof. A.R. Khomutov (Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia) and was synthesized as described previously [22]. Spermidine (Spd) was obtained from MP Biomedicals. α-difluoromethylornithine (DFMO, eflornithine, ornidyl) was obtained from Merck.

2.2. Microorganism Strains Used in the Work

The A. terreus strains used: WT (ATCC 20542, wild type) and HY (No. 43–16, highly active producer of LOV, obtained on the basis of the ATCC 20542 strain by UV mutagenesis [9]) were kindly provided by Dr. V.G. Dzhavakhiya, the head of the Department of Molecular Biology of the All-Russian Scientific Research Institute of Phytopathology (Moscow region, Bolshie Vyazemy, Russia).

2.3. Cultivation of A. terreus Strains

The filamentous fungi were cultivated on agarized ATA medium (100 g/L glucose, 20 g/L soy flour, 5 g/L malt extract, 5 g/L meat peptone, 5 g/L NaCl, 0.5 g/L KH2PO4, 0.5 g/L MgSO4 × 7H2O, 20 g/L agar, pH 6.0–6.2) or agarized Czapek-Dox (CDA) medium (30 g/L sucrose, 2 g/L NaNO3, 1 g/L K2HPO4, 0.5 g/L MgSO4 × 7 H2O, 0.5 g/L KCl, 0.01 g/L FeSO4 × 7 H2O, 20 g/L agar, pH 7.0–7.4). CDA medium was supplemented with DFMO, in the concentration range 0.1–5 mM, or APA, in the concentration range 0.1–5 mM, or Spd, in the amount of 0.5 mM, or used without additions (control). To the CDA medium also 1 or 5 mM DFMO and 0.5 mM Spd were added together; or 1 or 5 mM APA and 0.5 mM Spd were added together.

2.4. Quantification of Fungal Growth Inhibition

To determine the effect of ODC inhibitors, as well as the specificity of this inhibition on the growth of A. terreus strains, the drop and dilution method was used, as described earlier [12,23], with some modifications. Cells were harvested from ATA slants and diluted in 0.9% NaCl solution to OD600 = 0.3 (base concentration), serial 10-fold dilutions were made in 0.9% NaCl, and 3 μL were inoculated onto Petri dishes with CDA medium without additives or with the addition of compounds (ODC inhibitors, or Spd, or together ODC inhibitors and Spd). The inoculated Petri dishes were incubated for 18 days at 26 °C; measurements were performed every 3 days after inoculation. The inhibitory effects of the compounds were evaluated by ratio of colony growth on CDA medium supplemented with APA, DFMO, Spd, APA + Spd or DFMO + Spd to the growth in the control (CDA medium without any additions), as described previously [21,24]. The formula: growth inhibition % = [(Dc – Dt)/Dc] × 100, where Dc indicates the colony diameter in control set, and Dt indicates the colony diameter in treatment set was used to determine the percent of fungal growth inhibition. The data recorded were measured in triplicate and repeated at least twice.

2.5. Preparation of Total RNA and cDNA Synthesis

Cells were harvested from ATA slant and diluted in 0.9% NaCl solution to OD600 = 0.01–0.05, inoculated onto Petri dishes with CDA medium, incubated for 15 days at 26 °C, then collected for RNA isolation. The total RNA preparation and cDNA synthesis were carried out as described previously [25,26].

2.6. qPCR Analysis

qPCR reactions were performed with previously designed pairs of primers for the expression analysis of genes for the metabolism of PAs (odc, samdc, spds, and oaz) and LOV biosynthesis (lovA, lovB, lovC, lovD, lovE, lovF, and lovG) (Table 1) [10,12]. Reactions and processing of the results were carried out in accordance with the protocol [26]. To normalize the data of mRNA expression levels, we used we used two reference genes, actin and the ubiquitin-conjugating enzyme E2 6 (Ube2 6; EC 2.3.2.23). Pairs of primers for these housekeeping genes were previously selected [10].

3. Results

3.1. Inhibitory Analysis of A. terreus Cell Growth by DFMO and APA

The analysis of ODC inhibition in A. terreus WT and HY strains was carried out on CDA synthetic medium, which did not contain PAs. The inhibition was assessed quantitatively by comparing the colony growth. ODC is the first and rate-limiting enzyme of PAs de novo synthesis in filamentous fungi; in this regard, inhibition of this enzyme on a synthetic medium without PAs can lead to a significant or complete loss of growth of fungal cells [16,21]. Inhibitory analysis was performed using DFMO, an irreversible suicide inhibitor of ODC, recently studied versus ODC from A. terreus [27], and APA, isosteric hydroxylamine-containing analogue of Put, showing more potent ODC inhibition than DFMO in some filamentous fungi [21,28]. Aliquots of fungal cells were inoculated onto CDA medium supplemented with compounds or without them (control) (Figure 1).
The inhibitors were added in the concentration range 0.1–5 mM. To determine the specificity of inhibition on PAs biosynthetic pathway by removing the effect of growth inhibition, CDA/DFMO media or CDA/APA media were also supplmented with 0.5 mM Spd. To evaluate the effect of inhibition and removal of inhibition with Spd, fungal strains were also cultured on CDA media without additives and with the addition of only 0.5 mM Spd. The cultivation was carried out for 21 days at 26 °C. The inhibitory effect was determined quantitatively as the percentage of colony growth inhibition on CDA medium with the additions compared to the control medium (Figure 2 and Table S1).
The maximum growth inhibition was observed at the early stages of cultivation for both strains and with the addition of both inhibitors (Figure 2). Further, by the 18th day, there was a gradual overcoming of the toxic effect, expressed in a decrease of growth inhibition. This happened in all cases, except for the effect of 5 mM APA on A. terreus WT, leading to the complete death of this strain, 100% inhibition (Figure 1 and Figure 2d). At the same time, A. terreus HY exhibited increased resistance and showed growth on CDA medium with the addition of 5 mM APA (Figure 1 and Figure 2d). Such increased resistance of the high-yielding LOV producer was shown against both studied ODC inhibitors (Figure 1). After 15 days of cultivation, A. terreus HY was more resistant to 5 mM DFMO, by 20–25%, and to 5 mM APA, by 40–45% (Figure 1 and Figure 2b,d). Removal of the toxic effect of inhibitors when Spd was added together was approximately the same for both strains. The addition of Spd, together with DFMO or APA, led not only to the recovery (or partial recovery) of colony size, but also to the recovery of initial strain phenotype, colony color and morphology, for both strains (Figure 1). The lethal effect of 5 mM APA for the A. terreus WT strain was removed by supplementation of 0.5 mM Spd; the A. terreus WT strain growth on CDA/5 mM APA/0.5 mM Spd media after 15 days was approximately 50% of the control (Figure 1 and Figure 2d).

3.2. Expression Levels of PAs Metabolism Genes and lovB in A. terreus WT and HY Strains

In order to explain the reasons of increased resistance of the high-yielding LOV producer to ODC inhibitors, we studied the expression levels of the most important PAs biosynthesis genes, such as odc, samdc (encodes S-adenosylmethionine decarboxylase, AdoMetDC; EC 4.1.1.50) and spds (encodes spermidine synthase, SpdS; EC 2.5.1.16). We also determined the expression level of the oaz gene (encodes the antizyme of ornithine decarboxylase, OAZ), a negative regulator of ODC lifespan in the fungi cell. To determine the biosynthetic status of the strains with regard to LOV production during cultivation on CDA medium, the expression levels of lovA (encodes cytochrome P450, dihydromonacolin L monooxygenase LovA; EC 1.14.14.124), lovB (encodes lovastatin nonaketide synthase LovB; EC 2.3.1.161), lovC (encodes trans-acting enoyl reductase LovC; EC 2.3.1.161), lovD (encodes 2-methylbutyryl/monacolin J transesterase LovD; EC 2.3.1.238), lovE (encodes GAL4-like transcription factor, LOV pathway-specific positive regulator LovE), lovF (encodes lovastatin diketide synthase LovF; EC 2.3.1.244), and lovG (encodes thioesterase LovG; EC 2.3.1.244) were also measured.. LovB is the so-called central enzyme of LOV biosynthesis, catalyzes the first 35 consecutive reactions for the polymerization and modification of 9 molecules of manoyl-CoA with the formation of dihydromonacalin L [29]. It turned out that during the cultivation on solid synthetic medium (CDA) in A. terreus HY strain lovB is upregulated, about 10-fold (Figure 3). Previously, we demonstrated that, under conditions of deep fermentation on the defined media, lovB is upregulated 30–35-fold as compared to A. terreus WT [11]. It is known that at different nutrient media the expression of lov genes in A. terreus can be regulated differently [30,31]. Thereby detection of lovB upregulation during the cultivation of A. terreus HY under not optimal (for LOV biosynthesis) conditions is rather important. We also found the upregulation of other studied lov genes in A. terreus HY strain on CDA medium. lovA was upregulated about 20-fold, lovC was upregulated about 1.5-fold, lovD was upregulated 10–15-fold, lovE was upregulated 7–9-fold, lovF was upregulated 5–6-fold, and lovG was upregulated about 6–8-fold (Figure 3). The upregulation of these lov genes on CDA medium was, as in the case of lovB, weaker compared to previously shown the increase in mRNA expression during the fermentation on the defined media, where lovA was upregulated more than 150-fold, lovC was upregulated 2–3-fold, lovD was upregulated 20–30-fold, lovE was upregulated 10–15-fold, lovF was upregulated 12–18-fold, and lovG was upregulated about 10–15-fold [11].
From the results obtained, it is seen that in the context of lovB upregulation, the A. terreus HY strain has also an increased expression of genes for key enzymes of PAs biosynthesis (Figure 3). In LOV high-yielding strain odc is upregulated, by 3–3.5-fold, samdc is upregulated, by 7–10-fold, spds is upregulated, by 3–4-fold (Figure 3 and Figure 4). On the contrary, oaz is downregulated, by 4–6-fold (Figure 3 and Figure 4). The combined effect of upregulation of odc and, at the same time, downregulation of oaz, can lead to an additional increase in the content of ODC in A. terreus HY cells (Figure 4). This can lead to increased resistance of the HY strain to ODC inhibitors. After 15 days, the addition of 5 mM APA inhibits the WT strain by 100%, the HY strain inhibits by 62%; the addition of 5 mM DFMO inhibits the WT strain by 49% and inhibits the HY strain by 25% (Figure 2 and Figure 4).

4. Discussion

In our experiments, we found an increase in the resistance of A. terreus HY strain to inhibitors of ODC, a key enzyme of PAs biosynthesis (Figure 2). It is known that in the cells of various organisms a strict control of homeostasis for PAs content take place [32]. For this, there are both pathways of biosynthesis and catabolism of PAs, which have been studied, to a large extent, in mammals and a number of model organisms [33,34,35]. In filamentous fungi, some stages of PAs metabolism and its regulation are still not fully understood [36]. Previously, there was a misconception that filamentous fungi lack spermine [37]. Then, for numerous representatives of filamentous fungi, the presence of spermine was shown [38,39]. Our recent work on studying the composition of PAs in A. chrysogenum the presence of spermine as one of the main components of the PAs pool was also shown [21]. On the other hand, the pathways of putrescine biosynthesis have not yet been finally established in filamentous fungi [40]. In bacteria and higher plants, this diamine can be synthesized either directly from L-ornithine by the ODC enzyme, or through several successive steps, which are preceded by decarboxylation of L-arginine by the arginine decarboxylase enzyme (ADC; EC 4.1.1.19). From the other side, mammals have only an ODC-dependent pathway for putrescine biosynthesis. In a number of fungi, DFMO, a suicidal inhibitor of ODC, completely suppresses cell growth [41,42]. At the same time, there are studies demonstrating increased sensitivity for some fungi to DFMA (α-difluoromethylarginine), a suicidal ADC inhibitor [43,44]. Since the ADC enzyme has not yet been found in fungi, it is assumed that the DFMA inhibition effect may result from the conversion of this compound to DFMO by the enzyme arginase (EC 3.5.3.1) [40,45]. In a recent work, the enzymatic properties of ODC from A. terreus were described [27]. It was shown that this enzyme, in addition to catalytic activity against L-ornithine, has residual catalytic activity against L-arginine [27]. In current work, the addition of 5 mM APA led to 100% inhibition of the growth of the WT strain (Figure 1 and Figure 4). In addition, arginine-decarboxylating activity has been shown for fungi of the genus Aspergillus, leading to the formation of agmatine [46]. Therefore, 100% inhibition of A. terreus WT cell growth by 5 mM APA means that in A. terreus only ODC-dependent putrescine biosynthesis is functioning, or 5 mM APA nonspecifically inhibits fungal ADC, as demonstrated for high concentrations of APA versus ADC from E. coli [21]. From the other side, A. terreus HY strain exhibited increased resistance to ODC inhibitors (Figure 2). In particular, when 5 mM APA completely suppressed the growth of A. terreus WT strain, the growth inhibition of A. terreus HY was only 62%; when 5 mM DFMO inhibited A. terreus WT by 49%, inhibition of A. terreus HY was 25% (Figure 4).
The disruption of PAs regulation may trigger a number of pathological processes, leading, for example, to the depletion of the pool of S-adenosylmethionine (SAMe) used for the biosynthesis of PAs (Figure 4) [47,48]. In order to minimize deviations from the baseline PAs content, key biosynthetic enzymes such as ODC, SamDC and SpdS are tightly controlled at the levels of transcription, translation, and cell lifespan [32,49]. In this regard, the shift in PAs cell content is accompanied with several mutational events, corresponding to changes in at different levels of the regulation. Previously, we found an increased content of PAs in A. chrysogenum high-yielding producer of cephalosporin C (CPC) [21]. This strain also showed increased resistance to ODC inhibitors [21]. Possibly, the concentration of 5 mM ODC inhibitors was sufficient for complete depletion of PAs pool in A. chrysogenum WT strain and was insufficient to deplete the PAs pool in the A. chrysogenum HY strain. In the current study, we showed for A. terreus HY strain the increased resistance to DFMO and APA inhibitors of ODC, as well as odc upregulation and oaz downregulation.
The shift in PAs content in filamentous fungi strains obtained as a result of CSI programs, has recently been proposed [16,21]. As a result of multi-round random mutagenesis and screening, useful mutations are selected, leading to an increase in the yield of the target SM [16]. Along with this, a genetic load accumulates which represents side mutations and is expressed in a general decrease of strains fitness and a reduction in other vital processes [10,17,50]. In response to mutagenic effects, the cell activates its protective resources; PAs are also known to be able to protect cells from free radical damage through direct interaction with reactive oxygen species [51,52]. Recently, it was shown that PAs can promote homologous recombination during DNA repair complexed with RAD51, stimulating the formation of RAD51-ssDNA nucleofilaments [53]. Thus, an increase in the PAs content could be a side effect during multi-round mutagenesis, which made it possible to obtain a viable strain after the next exposure [16,21]. At the same time, the metabolism of PAs can intersect with SM biosynthesis at the level of consumption of common substrates, for example, SAMe [32]. The SAMe coenzyme is used both for transmethylation reactions during LOV biosynthesis and for aminopropylation during PAs biosynthesis (Figure 4 and Figure 5). It is known that the biosynthesis of one LOV molecule requires two SAMe molecules [54]. For the synthesis of one molecule of Spd, one molecule of SAMe molecule is required; to synthesize one Spm molecule (from putrescine), two SAMe molecules are required [16]. The observed upregulation of genes for PAs biosynthesis (including samdc gene, coding SAMe-consuming enzyme), amid upregulation of lov genes (including lovB and lovF genes, coding SAMe-consuming enzymes), may lead to the depletion of the SAMe content during fermentation with 10–15 g/L yield of LOV (Figure 5).
It has also been shown that SAMe is required for the functioning of epigenetic factors, SAMe-dependent methyl-transferases of DNA and histones, the most important of which is LaeA, a positive regulator of LOV biosynthesis in A. terreus [55] or beta-lactams in Penicillium chrysogenum [19,56] and A. chrysogenum [20]. In this regard, maintaining an increased pool of PAs in improved strains partly takes up the resources required for the biosynthesis of the target SM. The introducing of exogenous PAs can lead by a feedback mechanism to a decrease in PAs endogenous biosynthesis [32] and the release of resources, for example, SAMe, for the production of the target SM. This may explain the additional increase in production in the improved strains during fermentation with PAs [16].

5. Conclusions

In our work, for the first time, an increased resistance of Aspergillus terreus lovastatin (LOV) high-yielding strain to the inhibitors of ornithine decarboxylase, a key enzyme of polyamine biosynthesis (PAs) in filamentous fungi, was found. This phenomenon may be of fundamental importance for explaining the relationship between the biosynthesis of LOV and PAs in the fungal cell and of practical value for increasing the LOV yield during the optimizing of fermentation conditions with exogenously introduced PAs.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-3417/10/22/8290/s1, Table S1: Growth inhibition of the A. terreus WT and HY strains with 1 and 5 mM DFMO, 1 and 5 mM APA and the reversal of the inhibition with 0.5 mM Spd on CDA medium.

Author Contributions

Conceptualization, A.A.Z. and I.A.V.; methodology, A.A.Z. and G.K.N.; software, A.A.Z. and G.K.N.; resources, A.A.Z. and I.A.V.; data curation, A.A.Z. and I.A.V.; writing—original draft preparation, A.A.Z.; writing—A.A.Z. and I.A.V.; visualization, A.A.Z. and G.K.N.; supervision, A.A.Z. and I.A.V.; project administration, A.A.Z. and I.A.V.; funding acquisition, A.A.Z. and I.A.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially funded by Russian Foundation for Basic Research (grant number 19-04-01173). G.K. Nuraeva and I.A. Volkov are grateful to the Ministry of Science and Higher Education of the Russian Federation for support of the work on cultivation of A. terreus strains within the framework of the state contract no. 075-00337-20-03 (project identifier FSMG-2020-0007).

Acknowledgments

The authors are grateful to V.G. Dzhavakhiya, the head of the Department of Molecular Biology of the All-Russian Scientific Research Institute of Phytopathology (Moscow region, Bolshie Vyazemy, Russia) for kindly provided A. terreus ATCC 20542 and No. 43-16 strains. The authors are grateful A.R. Khomutov (Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia) for kindly provided compounds, DFMO, APA and Spd. The authors are also grateful to M.A. El`darov, the head of the group of genetic engineering of fungi (Federal Research Center of Biotechnology RAS, Institute of Bioengineering, Moscow, Russia) for every assistance in carrying out this research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Subhan, M.; Faryal, R.; Macreadie, I. Exploitation of Aspergillus terreus for the production of natural statins. J. Fungi 2016, 2, 13. [Google Scholar] [CrossRef] [Scilit]
  2. Stancu, C.; Sima, A. Statins: Mechanism of action and effects. J. Cell. Mol. Med. 2001, 5, 378–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Pandey, V.V.; Varshney, V.K.; Pandey, A. Lovastatin: A Journey from Ascomycetes to Basidiomycetes Fungi. J. Biol. Act. Prod. Nat. 2019, 9, 162–178. [Google Scholar] [CrossRef] [Scilit]
  4. Manzoni, M.; Bergomi, S.; Rollini, M.; Cavazzoni, V. Production of statins by filamentous fungi. Biotechnol. Lett. 1999, 21, 253–257. [Google Scholar] [CrossRef] [Scilit]
  5. Javed, S.; Bukhari, S.; Zovia, I.; Meraj, M. Screening of Indigenously Isolated Fungi for Lovastatin Production and Its in vivo Evaluation. Curr. Pharm. Biotechnol. 2014, 15, 422–427. [Google Scholar] [CrossRef] [Scilit]
  6. Jia, Z.; Zhang, X.; Cao, X.; Liu, J.; Qin, B. Production of lovastatin by a self-resistant mutant of Aspergillus terreus. Ann. Microbiol. 2011, 61, 615–621. [Google Scholar] [CrossRef] [Scilit]
  7. Keller, N.P. Translating biosynthetic gene clusters into fungal armor and weaponry. Nat. Chem. Biol. 2015, 11, 671–677. [Google Scholar] [CrossRef] [Scilit]
  8. Barrios-González, J.; Pérez-Sánchez, A.; Bibián, M.E. New knowledge about the biosynthesis of lovastatin and its production by fermentation of Aspergillus terreus. Appl. Microbiol. Biotechnol. 2020, 1–20. [Google Scholar] [CrossRef] [Scilit]
  9. Dzhavakhija, V.G.; Voinova, T.M.; Vavilova, N.A.; Santsevich, N.I.; Vinokurova, N.G.; Kadomtseva, V.M.; Dzhavakhija, V.V.; Mishin, A.G. Fungus Strain Aspergillus Terreus 44-62 as Producer of Lovastatin, Industrial Method for Isolation of Lovastatin and Method for Lactoninization of Statins. Patent RU 2261901C2, 27 June 2005. [Google Scholar]
  10. Zhgun, A.A.; Dumina, M.V.; Voinova, T.M.; Dzhavakhiya, V.V.; Eldarov, M.A. Role of acetyl-CoA Synthetase and LovE Regulator Protein of Polyketide Biosynthesis in Lovastatin Production by Wild-Type and Overproducing Aspergillus terreus Strains. Appl. Biochem. Microbiol. 2018, 54, 188–197. [Google Scholar] [CrossRef] [Scilit]
  11. Zhgun, A.A.; Nuraeva, G.K.; Eldarov, M. The Role of LaeA and LovE Regulators in Lovastatin Biosynthesis with Exogenous Polyamines in Aspergillus terreus. Appl. Biochem. Microbiol. 2019, 55, 626–635. [Google Scholar] [CrossRef] [Scilit]
  12. Zhgun, A.A.; Nuraeva, G.K.; Dumina, M.V.; Voinova, T.M.; Dzhavakhiya, V.V.; Eldarov, M.A. 1,3-Diaminopropane and spermidine upregulate lovastatin production and expression of lovastatin biosynthetic genes in Aspergillus terreus via LaeA regulation. Appl. Biochem. Microbiol. 2019, 55, 244–255. [Google Scholar] [CrossRef] [Scilit]
  13. Peñalva, M.A.; Rowlands, R.T.; Turner, G. The optimization of penicillin biosynthesis in fungi. Trends Biotechnol. 1998, 16, 483–489. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Zhgun, A.A.; Ivanova, M.A.; Domracheva, A.G.; Novak, M.I.; Elidarov, M.A.; Skryabin, K.G.; Bartoshevich, Y.E. Genetic transformation of the mycelium fungi Acremonium chrysogenum. Appl. Biochem. Microbiol. 2008, 44, 600–607. [Google Scholar] [CrossRef] [Scilit]
  15. Dumina, M.V.; Zhgun, A.A.; Domracheva, A.G.; Novak, M.I.; El’darov, M.A. Chromosomal polymorphism of Acremonium chrysogenum strains producing cephalosporin C. Russ. J. Genet. 2012, 48, 778–784. [Google Scholar] [CrossRef] [Scilit]
  16. Zhgun, A.A. Random Mutagenesis of Filamentous Fungi Stains for High-Yield Production of Secondary Metabolites: The Role of Polyamines. In Genotoxicity and Mutagenicity—Mechanisms and Test Methods; Soloneski, S., Ed.; IntechOpen: London, UK, 2020; pp. 1–17. ISBN 978-1-83880-042-0. [Google Scholar]
  17. Domratcheva, A.G.; Zhgun, A.A.; Novak, N.V.; Dzhavakhiya, V.V. The Influence of Chemical Mutagenesis on the Properties of the Cyclosporine a High-Producer Strain Tolypocladium inflatum VKM F-3630D. Appl. Biochem. Microbiol. 2018, 54, 53–57. [Google Scholar] [CrossRef] [Scilit]
  18. Bartoshevich, Y.; Novak, M.; Domratcheva, A.; Skryabin, K. Method of cephalosporin C biosynthesis by using new Acremonium chrysogenum strain RNCM NO F-4081D. Russian Federation 2,426,793, 2011. [Google Scholar]
  19. Martín, J.; García-Estrada, C.; Kosalková, K.; Ullán, R.V.; Albillos, S.M.; Martín, J.-F. The inducers 1,3-diaminopropane and spermidine produce a drastic increase in the expression of the penicillin biosynthetic genes for prolonged time, mediated by the laeA regulator. Fungal Genet. Biol. 2012, 49, 1004–1013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Zhgun, A.A.; Kalinin, S.G.; Novak, M.I.; Domratcheva, A.G.; Petukhov, D.V.; Dzhavakhiya, V.V.; Eldarov, M.A.; Bartoshevitch, I.E. The influence of polyamines on cephalosporine C biosynthesis in Acremonium chrysogenum strains. Izv Vuzov. Prikl Khim i Biotech. 2015, 14, 47–54. [Google Scholar]
  21. Hyvönen, M.T.; Keinänen, T.A.; Nuraeva, G.K.; Yanvarev, D.V.; Khomutov, M.; Khurs, E.N.; Kochetkov, S.N.; Vepsäläinen, J.; Zhgun, A.A.; Khomutov, A.R. Hydroxylamine analogue of agmatine: Magic bullet for arginine decarboxylase. Biomolecules 2020, 10, 406. [Google Scholar] [CrossRef] [Scilit]
  22. Khomutov, A.R.; Khomutov, R.M. Synthesis of putrescine and spermidine aminooxy analogues. Bioorganicheskaya Khimiya 1989, 15, 698–703. [Google Scholar]
  23. Zhgun, A.; Avdanina, D.; Shumikhin, K.; Simonenko, N.; Lyubavskaya, E.; Volkov, I.; Ivanov, V. Detection of potential biodeterioration risks for tempera painting in 16th century exhibits from State Tretyakov Gallery. PLoS ONE 2020, 15, e0230591. [Google Scholar] [CrossRef] [Scilit]
  24. Zhgun, A.A.; Avdanina, D.A.; Shagdarova, B.T.; Troyan, E.V.; Nuraeva, G.K.; Potapov, M.P.; Il’ina, A.V.; Shitov, M.V.; Varlamov, V.P. Search for Efficient Chitosan-Based Fungicides to Protect the 15th‒16th Centuries Tempera Painting in Exhibits from the State Tretyakov Gallery. Microbiology 2020, 89, 750–755. [Google Scholar] [CrossRef] [Scilit]
  25. Dumina, M.V.; Zhgun, A.A.; Kerpichnikov, I.V.; Domracheva, A.G.; Novak, M.I.; Valiachmetov, A.Y.; Knorre, D.A.; Severin, F.F.; Eldarov, M.A.; Bartoshevich, Y.E. Functional analysis of MFS protein CefT involved in the transport of beta-lactam antibiotics in Acremonium chrysogenum and Saccharomyces cerevisiae. Appl. Biochem. Microbiol. 2013, 49, 368–377. [Google Scholar] [CrossRef] [Scilit]
  26. Dumina, M.V.; Zhgun, A.A.; Novak, M.I.; Domratcheva, A.G.; Petukhov, D.V.; Dzhavakhiya, V.V.; Eldarov, M.A.; Bartoshevitch, I.E. Comparative gene expression profiling reveals key changes in expression levels of cephalosporin C biosynthesis and transport genes between low and high-producing strains of Acremonium chrysogenum. World J. Microbiol. Biotechnol. 2014, 30, 2933–2941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. El-Sayed, A.S.A.; George, N.M.; Yassin, M.A.; Alaidaroos, B.A.; Bolbol, A.A.; Mohamed, M.S.; Rady, A.M.; Aziz, S.W.; Zayed, R.A.; Sitohy, M.Z. Purification and Characterization of Ornithine Decarboxylase from Aspergillus terreus; Kinetics of Inhibition by Various Inhibitors. Molecules 2019, 24, 2756. [Google Scholar] [CrossRef] [Scilit]
  28. Khomutov, A.R.; Dzhavakhiya, V.G.; Voinova, T.M.; Ermolinskii, B.S.; Khomutov, R.M. Aminooxy analogue of putrescine inhibits polyketide biosynthetic pathway of natural products. Bioorganicheskaya Khimiya 1989, 15, 706–709. [Google Scholar]
  29. Campbell, C.D.; Vederas, J.C. Biosynthesis of lovastatin and related metabolites formed by fungal iterative PKS enzymes. Biopolymers 2010, 93, 755–763. [Google Scholar] [CrossRef] [Scilit]
  30. Barrios-González, J.; Baños, J.G.; Covarrubias, A.A.; Garay-Arroyo, A. Lovastatin biosynthetic genes of Aspergillus terreus are expressed differentially in solid-state and in liquid submerged fermentation. Appl. Microbiol. Biotechnol. 2008, 79, 179–186. [Google Scholar] [CrossRef] [Scilit]
  31. Teresa, P.; Armando, M.; Javier, B.-G. Amplification of laeA Gene in Aspergillus terreus: A Strategy to Generate Lovastatin-Overproducing Strains for Solid-State Fermentation. Int. J. Curr. Microbiol. App. Sci. 2015, 4, 537–555. [Google Scholar]
  32. Minois, N.; Carmona-Gutierrez, D.; Madeo, F. Polyamines in aging and disease. Aging (Albany. NY) 2011, 3, 716–732. [Google Scholar] [CrossRef] [Scilit]
  33. Pegg, A.E. Mammalian polyamine metabolism and function. IUBMB Life 2009, 61, 880–894. [Google Scholar] [CrossRef] [Scilit]
  34. Pegg, A.E. Functions of polyamines in mammals. J. Biol. Chem. 2016, 291, 14904–14912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Campilongo, R.; Di Martino, M.L.; Marcocci, L.; Pietrangeli, P.; Leuzzi, A.; Grossi, M.; Casalino, M.; Nicoletti, M.; Micheli, G.; Colonna, B.; et al. Molecular and functional profiling of the polyamine content in enteroinvasive E. coli: Looking into the gap between commensal E. coli and harmful Shigella. PLoS ONE 2014, 9, e106589. [Google Scholar] [CrossRef] [Scilit]
  36. Valdés-Santiago, L.; Cervantes-Chávez, J.A.; León-Ramírez, C.G.; Ruiz-Herrera, J. Polyamine Metabolism in Fungi with Emphasis on Phytopathogenic Species. J. Amino Acids 2012, 2012, 1–13. [Google Scholar] [CrossRef] [Scilit]
  37. Nickerson, K.W.; Dunkle, L.D.; Van Etten, J.L. Absence of spermine in filamentous fungi. J. Bacteriol. 1977, 129, 173–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Marshall, M.; Russo, G.; Van Etten, J.; Nickerson, K. Polyamines in dimorphic fungi. Curr. Microbiol. 1979, 2, 187–190. [Google Scholar] [CrossRef] [Scilit]
  39. Hart, D.; Winther, M.; Stevens, L. Polyamine distribution and S-adenosyl methionine decarboxylase activity in filamentous fungi. FEMS Microbiol. Lett. 1978, 3, 173–175. [Google Scholar] [CrossRef]
  40. Sannazzaro, A.I.; Álvarez, C.L.; Menéndez, A.B.; Pieckenstain, F.L.; Albertó, E.O.; Ruiz, O.A. Ornithine and arginine decarboxylase activities and effect of some polyamine biosynthesis inhibitors on Gigaspora rosea germinating spores. FEMS Microbiol. Lett. 2004, 230, 115–121. [Google Scholar] [CrossRef] [Scilit]
  41. Walters, D.R. Inhibition of polyamine biosynthesis in fungi. Mycol. Res. 1995, 99, 129–139. [Google Scholar] [CrossRef] [Scilit]
  42. Shapira, R.; Altman, A.; Henis, Y.; Chet, I. Polyamines and Ornithine Decarboxylase Activity during Growth and Differentiation in Sclerotium rolfsii. Microbiology 1989, 135, 1361–1367. [Google Scholar] [CrossRef] [Scilit]
  43. Rajam, M.V.; Galston, A.W. The Effects of Some Polyamine Biosynthetic Inhibitors on Growth and Morphology of Phytopathogenic Fungi. Plant Cell Physiol. 1985, 26, 683–692. [Google Scholar] [CrossRef] [Scilit]
  44. Pieckenstain, F.L.; Gárriz, A.; Chornomaz, E.M.; Sánchez, D.H.; Ruiz, O.A. The effect of polyamine biosynthesis inhibition on growth and differentiation of the phytopathogenic fungus Sclerotinia sclerotiorum. Antonie van Leeuwenhoek 2001, 80, 245–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Walters, D.; Keenan, J.; Cowley, T.; McPherson, A.; Havis, N. Inhibition of polyamine biosynthesis in Phytophthora infestans and Pythium ultimum. Plant Pathol. 1995, 44, 80–85. [Google Scholar]
  46. Akasaka, N.; Fujiwara, S. The therapeutic and nutraceutical potential of agmatine, and its enhanced production using Aspergillus oryzae. Amino Acids 2020, 52, 181–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Soda, K. Polyamine Metabolism and Gene Methylation in Conjunction with One-Carbon Metabolism. Int. J. Mol. Sci. 2018, 19, 3106. [Google Scholar] [CrossRef] [Scilit]
  48. Lu, S.C.; Mato, J.M. S-adenosylmethionine in liver health, injury, and cancer. Physiol. Rev. 2012, 92, 1515–1542. [Google Scholar] [CrossRef] [Scilit]
  49. Perez-Leal, O.; Merali, S. Regulation of polyamine metabolism by translational control. Amino Acids 2012, 42, 611–617. [Google Scholar] [CrossRef] [Scilit]
  50. Zhgun, A.; Dumina, M.; Valiakhmetov, A.; Eldarov, M. The critical role of plasma membrane H+-ATPase activity in cephalosporin C biosynthesis of Acremonium chrysogenum. PLoS ONE 2020, 15, e0238452. [Google Scholar] [CrossRef] [Scilit]
  51. Murray Stewart, T.; Dunston, T.T.; Woster, P.M.; Casero, R.A. Polyamine catabolism and oxidative damage. J. Biol. Chem. 2018, 293, 18736–18745. [Google Scholar] [CrossRef] [Scilit]
  52. Ha, H.C.; Sirisoma, N.S.; Kuppusamy, P.; Zweier, J.L.; Woster, P.M.; Casero, R.A. The natural polyamine spermine functions directly as a free radical scavenger. Proc. Natl. Acad. Sci. USA 1998, 95, 11140–11145. [Google Scholar] [CrossRef] [Scilit]
  53. Lee, C.-Y.; Su, G.-C.; Huang, W.-Y.; Ko, M.-Y.; Yeh, H.-Y.; Chang, G.-D.; Lin, S.-J.; Chi, P. Promotion of homology-directed DNA repair by polyamines. Nat. Commun. 2019, 10, 65. [Google Scholar] [CrossRef] [Scilit]
  54. Kennedy, J.; Auclair, K.; Kendrew, S.G.; Park, C.; Vederas, J.C.; Hutchinson, C.R.; Auclais, K.; Kendrew, S.G.; Park, C.; Vederas, J.C.; et al. Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science 1999, 284, 1368–1372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Brosch, G.; Loidl, P.; Graessle, S. Histone modifications and chromatin dynamics: A focus on filamentous fungi. FEMS Microbiol. Rev. 2008, 32, 409–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Sarikaya-Bayram, Ö.; Palmer, J.M.; Keller, N.; Braus, G.H.; Bayram, Ö. One Juliet and four Romeos: VeA and its methyltransferases. Front. Microbiol. 2015, 6, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Growth inhibition of the WT (wild type) and HY (high-yielding lovastatin producer) A. terreus strains with 1 and 5 mM α-difluoromethylornithine (DFMO), 1 and 5 mM 1-aminooxy-3-aminopropane (APA) and the reversal of the inhibition with 0.5 mM spermidine (Spd) at 15 days after inoculation on agarized Czapek-Dox (CDA) medium.
Figure 1. Growth inhibition of the WT (wild type) and HY (high-yielding lovastatin producer) A. terreus strains with 1 and 5 mM α-difluoromethylornithine (DFMO), 1 and 5 mM 1-aminooxy-3-aminopropane (APA) and the reversal of the inhibition with 0.5 mM spermidine (Spd) at 15 days after inoculation on agarized Czapek-Dox (CDA) medium.
Applsci 10 08290 g001
Figure 2. Growth inhibition of the A. terreus WT and HY strains with 1 and 5 mM DFMO, 1 and 5 mM APA and the reversal of the inhibition with 0.5 mM Spd on CDA medium. Growth inhibition (%) of A. terreus WT and HY strains with 1 mM DFMO (a), 5 mM DFMO (b), 1 mM APA (c), 5 mM APA (d), and reverse of the inhibition with 0.5 mM Spd (ad). Data are means ± SD, n = 3. ND, not detected.
Figure 2. Growth inhibition of the A. terreus WT and HY strains with 1 and 5 mM DFMO, 1 and 5 mM APA and the reversal of the inhibition with 0.5 mM Spd on CDA medium. Growth inhibition (%) of A. terreus WT and HY strains with 1 mM DFMO (a), 5 mM DFMO (b), 1 mM APA (c), 5 mM APA (d), and reverse of the inhibition with 0.5 mM Spd (ad). Data are means ± SD, n = 3. ND, not detected.
Applsci 10 08290 g002
Figure 3. Relative gene expression in A. terreus WT and HY strains: lovA (a), lovB (b), lovC (c), lovD (d), lovE (e), lovF (f), lovG (g), odc (h), oaz (i), samdc (j), and spds (k), 15 days after inoculation on CDA medium. Data are means ± SD, n = 3.
Figure 3. Relative gene expression in A. terreus WT and HY strains: lovA (a), lovB (b), lovC (c), lovD (d), lovE (e), lovF (f), lovG (g), odc (h), oaz (i), samdc (j), and spds (k), 15 days after inoculation on CDA medium. Data are means ± SD, n = 3.
Applsci 10 08290 g003
Figure 4. The putative pathway of polyamine (PAs) biosynthesis in A. terreus and growth inhibition (%) of WT (wild type) and HY (high-yielding lovastatin producer) strains by 5 mM inhibitors of ornithine decarboxylase (ODC). Fifteen days after inoculation on CDA medium. Green and up arrow next to the protein name means upregulation of corresponding gene in A. terreus HY strain; white and down arrow next to the protein name means downregulation of corresponding gene in A. terreus HY strain. SAMe—S-adenosylmethionine; dcSAMe—decarboxylated S-adenosylmethionine. OAZ—ornithine decarboxylase antizyme, AdoMetS—S-adenosylmethionine synthetase, SamDC—S-adenosylmethionine decarboxylase, SpdS—spermidine synthase, SpmS—spermine synthase, DFMO—α-difluoromethylornithine, APA—1-aminooxy-3-aminopropane.
Figure 4. The putative pathway of polyamine (PAs) biosynthesis in A. terreus and growth inhibition (%) of WT (wild type) and HY (high-yielding lovastatin producer) strains by 5 mM inhibitors of ornithine decarboxylase (ODC). Fifteen days after inoculation on CDA medium. Green and up arrow next to the protein name means upregulation of corresponding gene in A. terreus HY strain; white and down arrow next to the protein name means downregulation of corresponding gene in A. terreus HY strain. SAMe—S-adenosylmethionine; dcSAMe—decarboxylated S-adenosylmethionine. OAZ—ornithine decarboxylase antizyme, AdoMetS—S-adenosylmethionine synthetase, SamDC—S-adenosylmethionine decarboxylase, SpdS—spermidine synthase, SpmS—spermine synthase, DFMO—α-difluoromethylornithine, APA—1-aminooxy-3-aminopropane.
Applsci 10 08290 g004
Figure 5. S-adenosylmethionine consumption for biosynthesis of lovastatin (LOV) and polyamines (PAs) in Aspergillus terreus. Green and up arrow next to the protein name means upregulation of corresponding gene in A. terreus high-yielding lovastatin producer (HY strain); red and down arrow next to the protein name means downregulation of corresponding gene in A. terreus HY strain. SAMe—S-adenosylmethionine; SAH—S-adenosylhomocysteine; dcSAMe—decarboxylated S-adenosylmethionine; MTA—5’-methylthioadenosine. LovA—dihydromonacolin L monooxygenase; LovB—lovastatin nonaketide synthase; LovC—enoyl reductase; LovD—2-methylbutyryl/monacolin J transesterase; LovF—lovastatin diketide synthase; LovF—thioesterase; ODC—ornithine decarboxylase; OAZ—ornithine decarboxylase antizyme, SamDC—S-adenosylmethionine decarboxylase, SpdS—spermidine synthase, SpmS—spermine synthase. Lovastatin dependent consumption and regeneration pathway of SAMe are shown in blue; polyamines dependent consumption and regeneration pathway of SAMe are shown in red.
Figure 5. S-adenosylmethionine consumption for biosynthesis of lovastatin (LOV) and polyamines (PAs) in Aspergillus terreus. Green and up arrow next to the protein name means upregulation of corresponding gene in A. terreus high-yielding lovastatin producer (HY strain); red and down arrow next to the protein name means downregulation of corresponding gene in A. terreus HY strain. SAMe—S-adenosylmethionine; SAH—S-adenosylhomocysteine; dcSAMe—decarboxylated S-adenosylmethionine; MTA—5’-methylthioadenosine. LovA—dihydromonacolin L monooxygenase; LovB—lovastatin nonaketide synthase; LovC—enoyl reductase; LovD—2-methylbutyryl/monacolin J transesterase; LovF—lovastatin diketide synthase; LovF—thioesterase; ODC—ornithine decarboxylase; OAZ—ornithine decarboxylase antizyme, SamDC—S-adenosylmethionine decarboxylase, SpdS—spermidine synthase, SpmS—spermine synthase. Lovastatin dependent consumption and regeneration pathway of SAMe are shown in blue; polyamines dependent consumption and regeneration pathway of SAMe are shown in red.
Applsci 10 08290 g005
Table 1. Primers used for RT-PCR analysis.
Table 1. Primers used for RT-PCR analysis.
PrimerGeneProduct, FunctionOligonucleotide (Sequence 5→3)Source Sequence
Act_RT_FactinA major component of the cytoskeletonCCACGTTACCACTTTCAACTCCXM_001209659.1, [10]
Act_RT_RGAGGAGCGATGATCTTGACCT
E2_6_RT_Fube2 6Ubiquitin-conjugating enzyme E2 6TGACCAGCGAAGAAATGACAXM_001211932.1, [10]
E2_6_RT_RTTATCTTTCATCCATTTCCA
LovA_FlovADihydromonacolin L monooxygenaseGCGATGTCAAGCCACTCCTCATTATGAH007774.2, [12]
LovA_RAGACCCAAGCTCCCAAGTACGTCAAG
LovB_F1lovBLovastatin nonaketide synthaseGCCCCATTCTATAAAAACCTGAGGATTCAF151722, [12]
LovB_R1AGTCCTCATTATTCGAGACTCGCAGC
LovC_F1lovCEnoyl reductaseGCAGAGGAGGTCTTTGACTATCGAH007774.2, [10]
LovC_R1GACTCGACGTTGGTGATACAGTCG
LovD_F1lovD2-Methylbutyryl/monacolin J transesteraseGGATCTGGACGGAGAGAACTG
LovD_R1CAGGGTTCCAGTTGGAAGAAC
LovE_FlovEGAL4-like transcription factorTCGATGCGTCTACAGTGAGC
LovE_RTAGCTGTCCGGTGGATCAAG
LovF_FlovFLovastatin diketide synthaseTTGCATCTTGCCATTCAGAG
LovF_RTCGAGTCAAATGAGTAGGA
LovG_FlovGThioesteraseGCTCCGTTCCCTTCCTCTGCAAH007774.2, [12]
LovG_RGGGGTGTTGAGTCTGCCAGTCG
ODC_RT_FodcOrnithine decarboxylaseCCCCGGTGAGGAAGATGCGTCH476600.1, [12]
ODC_RT_RTCGATCTCCGCCTTGGACGC
SamDC_RT_FsamdcS-adenosylmethionine
decarboxylase
TACACGACCTCGCCGTCATCCTCH476605.1, [12]
SamDC_RT_RCCTTCCAGATCTCCTCCGACACG
SpdS_RT_F1spdsSpermidine synthaseGAAGGTCCTGGTCATTGGCGGTCH476594.1, [12]
SpdS_RT_R1TCTTGAGGAACTCGAAGCCGTCG
AZ_RT_FoazAntizyme, Ornithine decarboxylase inhibitor ATCTCAGTCTCCGAAGCGTCCTGGXM_001214792.1, [12]
AZ_RT_RCGAGGATTTGTGACCGACATAAGTGG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhgun, A.A.; Nuraeva, G.K.; Volkov, I.A. High-Yielding Lovastatin Producer Aspergillus terreus Shows Increased Resistance to Inhibitors of Polyamine Biosynthesis. Appl. Sci. 2020, 10, 8290. https://doi.org/10.3390/app10228290

AMA Style

Zhgun AA, Nuraeva GK, Volkov IA. High-Yielding Lovastatin Producer Aspergillus terreus Shows Increased Resistance to Inhibitors of Polyamine Biosynthesis. Applied Sciences. 2020; 10(22):8290. https://doi.org/10.3390/app10228290

Chicago/Turabian Style

Zhgun, Alexander A., Gulgina K. Nuraeva, and Ivan A. Volkov. 2020. "High-Yielding Lovastatin Producer Aspergillus terreus Shows Increased Resistance to Inhibitors of Polyamine Biosynthesis" Applied Sciences 10, no. 22: 8290. https://doi.org/10.3390/app10228290

APA Style

Zhgun, A. A., Nuraeva, G. K., & Volkov, I. A. (2020). High-Yielding Lovastatin Producer Aspergillus terreus Shows Increased Resistance to Inhibitors of Polyamine Biosynthesis. Applied Sciences, 10(22), 8290. https://doi.org/10.3390/app10228290

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop