Comparative Activity of Six Recombinant Stilbene Synthases in Yeast for Resveratrol Production
Featured Application
Abstract
1. Introduction
2. Materials and Methods
2.1. Yeast Strain and DNA Sequences
2.2. Genetic Construction and Heterologous Expression
2.3. Yeast Viability and Effect of pH on p-Coumaric Acid Uptake
2.4. Batch Fermentation
2.5. Extraction and Analysis of Resveratrol
2.6. Statistical Analysis
3. Results and Discussion
3.1. Tolerance of Yeast Strains to p-Coumaric Acid
3.2. Conversion of p-Coumaric Acid into Resveratrol under Batch Fermentation Conditions
3.3. Effect of pH on p-Coumaric Acid Uptake
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Elshaer, M.; Chen, Y.; Wang, X.J.; Tang, X. Resveratrol: An overview of its anti-cancer mechanisms. Life Sci. 2018, 207, 340–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de la Lastra, C.A.; Villegas, I. Resveratrol as an antioxidant and pro-oxidant agent: Mechanisms and clinical implications. Biochem. Soc. Trans. 2007, 35, 1156–1160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhullar, K.S.; Hubbard, B.P. Lifespan and healthspan extension by resveratrol. Biochim. Biophys. Acta Mol. Basis Dis. 2015, 1852, 1209–1218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samappito, S.; Page, J.E.; Schmidt, J.; De-Eknamkul, W.; Kutchan, T.M. Aromatic and pyrone polyketides synthesized by a stilbene synthase from Rheum tataricum. Phytochemistry 2003, 62, 313–323. [Google Scholar] [CrossRef] [Scilit]
- Pan, L.P.; Yu, S.Y.; Chen, C.J.; Li, H.; Wu, Y.L.; Li, H.H. Cloning a peanut resveratrol synthase gene and its expression in purple sweet potato. Plant Cell Rep. 2012, 31, 121–131. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Kildegaard, K.R.; Chen, Y.; Rodriguez, A.; Borodina, I.; Nielsen, J. De novo production of resveratrol from glucose or ethanol by engineered Saccharomyces cerevisiae. Metab. Eng. 2015, 32, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Schneider, K.; Kristensen, M.; Borodina, I.; Nielsen, J. Engineering yeast for highlevel production of stilbenoid antioxidants. Sci. Rep. 2015, 6, 36827. [Google Scholar] [CrossRef] [Scilit]
- Lim, C.G.; Fowler, Z.L.; Hueller, T.; Schaffer, S.; Koffas, M.A. High-yield resveratrol production in engineered Escherichia coli. Appl. Environ. Microbiol. 2015, 77, 3451–3460. [Google Scholar] [CrossRef] [Scilit]
- Zheng, S.; Zhao, S.; Li, Z.; Wang, Q.; Yao, F.; Yang, L.; Pan, J.; Liu, J. Evaluating the Effect of expressing a peanut resveratrol synthase gene in rice. PLoS ONE 2015, 10, e0136013. [Google Scholar] [CrossRef] [Scilit]
- Camacho-Zaragoza, J.M.; Hernández-Chávez, G.; Moreno-Avitia, F.M.; Ramírez-Iñiguez, R.; Martínez, A.; Gosset, G. Engineering of a microbial coculture of Escherichia coli strains for the biosynthesis of resveratrol. Microb. Cell Fact. 2016, 15, 163. [Google Scholar] [CrossRef] [Scilit]
- Jeandet, P.; Delaunois, B.; Aziz, A.; Donnez, D.; Vasserot, Y.; Cordelier, S.; Courot, E. Metabolic engineering of yeast and plants for the production of the biologically active hydroxystilbene, resveratrol. J. Biomed. Biotechnol. 2012, 579089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Hu, Y.; Wang, X.; Zhong, J.; Lin, Z. High Content of resveratrol in lettuce transformed with a stilbene synthase gene of Parthenocissus henryana. J. Agric. Food Chem. 2006, 54, 8082–8085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thapa, S.B.; Pandey, R.P.; Park, Y.; Sohng, J.K. Biotechnological advances in resveratrol production and its chemical diversity. Molecules 2019, 24, 2571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, S.Y.; Han, N.M.; Park, Y.C.; Kim, M.D.; Seo, J.H. Production of resveratrol from p-coumaric acid in recombinant Saccharomyces cerevisiae expressing 4-coumarate:coenzyme A ligase and stilbene synthase genes. Enzyme Microb. Technol. 2011, 48, 48–53. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Zhi, S.; Liu, C.; Xu, F.; Zhao, A.; Wang, X.; Ren, Y.; Li, Z.; Yu, M. Characterization of stilbene synthase genes in mulberry (Morus atropurpurea) and metabolic engineering for the production of resveratrol in Escherichia coli. J. Agric. Food Chem. 2017, 65, 1659–1668. [Google Scholar] [CrossRef] [Scilit]
- Rose, M.D.; Winston, F.; Hieter, P. Methods in Yeast Genetics: A Laboratory Course Manual, 1th ed.; Cold Spring Harbor Press: New York, NY, USA, 1990. [Google Scholar] [CrossRef] [Scilit]
- Sarker, S.D.; Nahar, L.; Kumarasamy, Y. Microtiter plate-based antibacterial assay incorporating resazurin as an indicator of cell growth, and its application in the in vitro antibacterial screening of phytochemicals. Methods 2007, 42, 321–324. [Google Scholar] [CrossRef] [Scilit]
- Lefebvre, D.; Gabriel, V.; Vayssier, Y.; Fontagné-Faucher, C. Simultaneous HPLC determination of sugars, organic acids and ethanol in sourdough process. LWT-Food Sci. Technol. 2002, 355, 407–414. [Google Scholar] [CrossRef] [Scilit]
- Glavnik, V.; Simonovska, B.; Albreht, A.; Vovk, I. TLC and HPLC screening of p-coumaric acid, trans-resveratrol, and pterostilbene in bacterial cultures, food supplements, and wine. J. Planar Chromat. 2012, 25, 251–258. [Google Scholar] [CrossRef] [Scilit]
- Watts, K.T.; Lee, P.C.; Schmidt-Dannert, C. Biosynthesis of plant-specific stilbene polyketides in metabolically engineered Escherichia coli. BMC Biotechnol. 2006, 6, 22. [Google Scholar] [CrossRef] [Scilit]
- Lou, Z.; Wang, H.; Rao, S.; Sun, J.; Ma, C.; Li, J. p-Coumaric acid kills bacteria through dual damage mechanisms. Food Control 2012, 25, 550–554. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.W.; Guo, H.L.; Li, X.; Huang, L.L.; Zhang, B.N.; Pang, X.B.; Liu, B.Y.; Ma, L.Q.; Wang, H. Two type III polyketide synthases from Polygonum cuspidatum: Gene structure, evolutionary route and metabolites. Plant Biotechnol. Rep. 2013, 7, 371–381. [Google Scholar] [CrossRef] [Scilit]
- Benvidi, A.; Dadras, A.; Abbasi, S.; Tezerjani, M.D.; Rezaeinasab, M.; Tabaraki, R.; Namazian, M. Experimental and computational study of the pK a of coumaric acid derivatives. J. Chin. Chem. Soc. 2019, 66, 589–593. [Google Scholar] [CrossRef] [Scilit]
- Han, M.; Yu, X. Enhanced expression of heterologous proteins in yeast cells via the modification of N-glycosylation sites. Bioengineered 2015, 6, 115–118. [Google Scholar] [CrossRef] [Scilit]
- Tropf, S.; Lanz, T.; Rensing, S.A.; Schröder, J.; Schröder, G. Evidence that stilbene synthases have developed from chalcone synthases several times in the course of evolution. J. Mol. Evol. 1994, 38, 610–618. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.; Yu, H.N.; Xu, R.X.; Cheng, A.X.; Lou, H.X. Cloning and functional characterization of a 4-coumarate CoA ligase from liverwort Plagiochasma appendiculatum. Phytochemstry 2015, 111, 48–58. [Google Scholar] [CrossRef] [Scilit]






| Oligonuclotide Pairs (5->3′) | PCR Conditions | Restriction Sites Added | Target |
|---|---|---|---|
| GGCCGGATCCCGATTTGGGCGCGAATCC GGCCGAATTCTGTTTTATATTTGTTGTAA | 3 min at 94 °C initial denaturation, 35 cycles of 30 s at 94 °C, 30 at 55 °C and 1 min at 72 °C | BamHI EcoRI | Amplification and insertion of PGK promoter into pESC-TRP vector |
| GGCCGGATCCAGTTTATCATTATCAATACTCG AGCCTGGGCCCTCTAGAATCCGTCGAAACTAAG | 3 min at 94 °C initial denaturation, 35 cycles of 30 s at 94 °C, 30 at 56 °C and 1 min 20 s at 72 °C | BamHI ApaI | Amplification and insertion of GPD promoter into the pESC-TRP vector |
| CGGGGCCCATGGGTTATGAGAAATCAG CGCTCGAGTCACAGCTTAGAGCTGGG | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 57 °C and 1 min 30 s at 72 °C | ApaI XhoI | Amplification and insertion of Pa4CL1 from Plagiochasma appendiculatum into the pESC-TRP-PGPD-PPGK |
| CTAGGACTAGTATGGCTAGTGTGGAGGAAT GGAAAGATCTTTAATTAGTAACCATAG | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 58 °C and 1 min 20 s at 72 °C | SpeI BglII | Amplification and insertion of PhStS from Parthenocissus henryana into the pESC-TRP-PGPD-PPGK |
| CTAGGACTAGTATGGCGGCTTCCACAGAGT GGAAAGATCTTTAAATGATTGGAACAGAAC | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 58 °C and 1 min 20 s at 72 °C | SpeI BglII | Amplification and insertion of PcPKS5 from Polygonum cuspidatum into the pESC-TRP-PGPD-PPGK |
| CTAGGACTAGTATGGCACCGAACAATGTATC GGAAAGATCTCTATGCAACGATAGGTACAG | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 58 °C and 1 min 20 s at 72 °C | SpeI BglII | Amplification and insertion of MaSTS3 Morus alba var. atropurpurea into the pESC-TRP-PGPD-PPGK |
| CTAGGACTAGTATGGCCCCAGAGGAGTCTC GGAAAGATCTTCAAGTGATTAGTGGTACGC | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 58 °C and 1 min 20 s at 72 °C | SpeI BglII | Amplification and insertion of RtSTS from Rheum tataricum into the pESC-TRP-PGPD-PPGK |
| CTAGGACTAGTATGGCCAGCGTTGAAGAG GGAAAGATCTTTAATTAGTAACCGTCGGTA | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 58 °C and 1 min 20 s at 72 °C | SpeI BglII | Amplification and insertion of VvVST1n from Vitis vinifera into the pESC-TRP-PGPD-PPGK |
| CTAGGACTAGATGGTTTCAGTGTCTGGC GGAAAGATCTTTATATCGCCATACTCCTAAG | 3 min at 94 °C initial denaturation, 30 cycles of 30 s at 94 °C, 30 at 58 °C and 1 min 20 s at 72 °C | SpeI BglII | Amplification and insertion of AhSTS from Arachis hypogaea into the pESC-TRP-PGPD-PPGK |
| Strain | 50 mg L−1 | 70 mg L−1 |
|---|---|---|
| pESC-Pa4CL1-PhStS | 23.7 ± 2.6 b | 27.1 ± 3.1 c |
| pESC-Pa4CL1- PcPKS5 | 34.5 ± 4.1 a | 39.9 ± 2.5 a |
| pESC-Pa4CL1-MaSTS3 | 31.3 ± 4.7 a | 34.4 ± 3.8 b |
| pESC-Pa4CL1-RtSTS | 24.2 ± 3.1 b | 28.5 ± 2.4 c |
| pESC-Pa4CL1-VvVST1 | 25.4 ± 1.8 b | 27.6 ± 3.7 c |
| pESC-Pa4CL1-AhSTS | 24.7 ± 2.9 b | 30.9 ± 4.3 b |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Villa-Ruano, N.; Rivera, A.; Rubio-Rosas, E.; Landeta-Cortés, G.; Varela-Caselis, J.L.; Romero-Arenas, O. Comparative Activity of Six Recombinant Stilbene Synthases in Yeast for Resveratrol Production. Appl. Sci. 2020, 10, 4847. https://doi.org/10.3390/app10144847
Villa-Ruano N, Rivera A, Rubio-Rosas E, Landeta-Cortés G, Varela-Caselis JL, Romero-Arenas O. Comparative Activity of Six Recombinant Stilbene Synthases in Yeast for Resveratrol Production. Applied Sciences. 2020; 10(14):4847. https://doi.org/10.3390/app10144847
Chicago/Turabian StyleVilla-Ruano, Nemesio, Antonio Rivera, Efraín Rubio-Rosas, Gerardo Landeta-Cortés, Jenaro Leocadio Varela-Caselis, and Omar Romero-Arenas. 2020. "Comparative Activity of Six Recombinant Stilbene Synthases in Yeast for Resveratrol Production" Applied Sciences 10, no. 14: 4847. https://doi.org/10.3390/app10144847
APA StyleVilla-Ruano, N., Rivera, A., Rubio-Rosas, E., Landeta-Cortés, G., Varela-Caselis, J. L., & Romero-Arenas, O. (2020). Comparative Activity of Six Recombinant Stilbene Synthases in Yeast for Resveratrol Production. Applied Sciences, 10(14), 4847. https://doi.org/10.3390/app10144847

