Investigating Association of rs5918 Human Platelets Antigen 1 and rs1800790 Fibrinogen β Chain as Critical Players with Recurrent Pregnancy Loss
Abstract
1. Introduction
2. Materials and Methods
2.1. Patient Selection and DNA Isolation
2.2. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Rodger, M.A.; Paidas, M.; McLintock, C.; Middeldorp, S.; Kahn, S.; Martinelli, I.; Hague, W.; Rosene Montella, K.; Greer, I. Inherited thrombophilia and pregnancy complications revisited. Obstet. Gynecol. 2008, 112, 320–324. [Google Scholar] [CrossRef] [PubMed]
- Abu-Asab, N.S.; Ayesh, S.K.; Ateeq, R.O.; Nassar, S.M.; El-Sharif, W.A. Association of inherited thrombophilia with recurrent pregnancy loss in palestinian women. Obstet. Gynecol. Int. 2011, 2011, 689684. [Google Scholar] [CrossRef] [PubMed]
- Parveen, F.; Shukla, A.; Agrawal, S. Should factor V Leiden mutation and prothrombin gene polymorphism testing be done in women with recurrent miscarriage from North India? Arch. Gynecol. Obstet. 2013, 287, 375–381. [Google Scholar] [CrossRef] [PubMed]
- Voetsch, B.; Loscalzo, J. Genetic determinants of arterial thrombosis. Arterioscler. Thromb. Vasc. Biol. 2004, 24, 216–229. [Google Scholar] [CrossRef] [PubMed]
- Leander, R.; Hallqvist, J.; Falk, G.; De Faire, U. The G55A polymorphism of the fibrinogen Bb-gene relates to plasma fibrinogen in male cases, but does not interact with environmental factors in causing myocardial infarction in either men or women. J. Intern. Med. 2002, 252, 332–341. [Google Scholar] [CrossRef] [PubMed]
- Klovaite, J.; Nordestgaard, B.G.; Tybjaerg-Hansen, A.; Benn, M. Elevated fibrinogen levels are associated with risk of pulmonary embolism, but not with deep venous thrombosis. Am. J. Respir. Crit. Care Med. 2013, 187, 286–293. [Google Scholar] [CrossRef] [PubMed]
- Shattil, S.J. Signaling through platelet integrin alpha IIb beta 3: Inside-out, outside-in, and sideways. Thromb. Haemost. 1999, 82, 318–325. [Google Scholar] [PubMed]
- Tan, J.Y.; Lian, L.H.; Nadarajan, V.S. Genetic polymorphisms of human platelet antigens-1 to -6, and -15 in the Malaysian population. Blood Transfus. 2012, 10, 368–376. [Google Scholar] [CrossRef] [PubMed]
- Bigdeli, R.; Younesi, M.R.; Panahnejad, E.; Asgary, V.; Heidarzadeh, S.; Mazaheri, H.; Aligoudarzi, S.L. Association between thrombophilia gene polymorphisms and recurrent pregnancy loss risk in the Iranian population. Syst. Biol. Reprod. Med. 2018, 64, 274–282. [Google Scholar] [CrossRef] [PubMed]
- Torabi, R.; Zarei, S.; Zeraati, H.; Zarnani, A.H.; Akhondi, M.M.; Hadavi, R.; Shiraz, E.S.; Jeddi-Tehrani, M. Combination of thrombophilic gene polymorphisms as a cause of increased the risk of recurrent pregnancy loss. J. Reprod. Infertil. 2012, 13, 89–94. [Google Scholar] [PubMed]
- Yenicesu, G.I.; Cetin, M.; Ozdemir, O.; Cetin, A.; Ozen, F.; Yenicesu, C.; Yildiz, C.; Kocak, N. A prospective case-control study analyzes 12 thrombophilic gene mutations in Turkish couples with recurrent pregnancy loss. Am. J. Reprod. Immunol. 2010, 63, 126–136. [Google Scholar] [CrossRef] [PubMed]
- Chatzidimitriou, M.; Chatzidimitriou, D.; Mavridou, M.; Anetakis, C.; Chatzopoulou, F.; Lialiaris, T.; Mitka, S. Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek women. Int. J. Lab. Hematol. 2017, 39, 590–595. [Google Scholar] [CrossRef] [PubMed]
- Goncharova, I.A.; Babushkina, N.P.; Minaycheva, L.I.; Markova, V.V.; Kulish, E.V.; Salakhov, R.R.; Makeeva, O.A.; Puzyrev, V.P. Prevalence of alleles of polymorphic variants Leu33Pro and Leu66Arg gene ITGB3 among inhabitants of Siberia. Russ. J. Genet. 2013, 49, 877–880. [Google Scholar] [CrossRef]
- Goodman, C.S.; Coulam, C.B.; Jeyendran, R.S.; Acosta, V.A.; Roussev, R. Which thrombophilic gene mutations are risk factors for recurrent pregnancy loss? Am. J. Reprod. Immunol. 2006, 56, 230–236. [Google Scholar] [CrossRef] [PubMed]
- Coulam, C.B.; Jeyendran, R.S.; Fishel, L.A.; Roussev, R. Multiple thrombophilic gene mutations rather than specific gene mutations are risk factors for recurrent miscarriage. Am. J. Reprod. Immunol. 2006, 55, 360–368. [Google Scholar] [CrossRef] [PubMed]
- Maziri, P.; Tehrani, G.A.; Hidagi, F.B.; Nejatollahi, M.; Asadi, S. Association between Thrombophilic Gene Polymor-phisms and Recurrent Pregnancy Loss in Iranian Women. Iran. J. Neonatol. IJN 2017, 8, 13–19. [Google Scholar] [CrossRef]
- Wu, S.M.; Chen, Z.F.; Young, L.; Shiao, S.P. Meta-Prediction of the Effect of Methylenetetrahydrofolate Reductase Polymorphisms and Air Pollution on Alzheimer’s Disease Risk. Int. J. Environ. Res. Public Health 2017. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.L.; Yang, H.L.; Shiao, S.P.K. Meta-Prediction of MTHFR Gene Polymorphisms and Air Pollution on the Risk of Hypertensive Disorders in Pregnancy Worldwide. Int. J. Environ. Res. Public Health 2018. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.F.; Young, L.; Yu, C.H.; Shiao, S.P.K. A Meta-Prediction of Methylenetetrahydrofolate-Reductase Polymorphisms and Air Pollution Increased the Risk of Ischemic Heart Diseases Worldwide. Int. J. Environ. Res. Public Health 2018. [Google Scholar] [CrossRef] [PubMed]
- Gauderman, W.J. Sample size requirements for association studies of gene-gene interaction. Am. J. Epidemiol. 2002, 155, 478–484. [Google Scholar] [CrossRef]
- Shi, X.; Xie, X.; Jia, Y.; Li, S. Maternal genetic polymorphisms and unexplained recurrent miscarriage: A systematic review and meta-analysis. Clin. Genet. 2017, 91, 265–284. [Google Scholar] [CrossRef] [PubMed]
- Poursadegh Zonouzi, A.; Chaparzadeh, N.; Ghorbian, S.; Sadaghiani, M.M.; Farzadi, L.; Ghasemzadeh, A.; Kafshdooz, T.; Sakhinia, M.; Sakhinia, E. The association between thrombophilic gene mutations and recurrent pregnancy loss. J. Assist. Reprod. Genet. 2013, 30, 1353–1359. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wu, H.; Chen, Y.; Wu, H.; Xu, H.; Li, L. Genetic association between FXIII and beta-fibrinogen genes and women with recurrent spontaneous abortion: A meta- analysis. J. Assist. Reprod. Genet. 2015, 32, 817–825. [Google Scholar] [CrossRef] [PubMed]
- Al-Astal, M.G.; Sharif, F.A. Beta-fibrinogen (-455 G/A) and Integrin beta-3 (PLA1/A2) polymorphisms and recurrent pregnancy loss in Gaza strip-Palestine. Int. J. Reprod. Contracept. Obstet. Gynecol. 2014, 3, 134–138. [Google Scholar] [CrossRef]
- Hohlagschwandtner, M.; Unfried, G.; Heinze, G.; Huber, J.C.; Nagele, F.; Tempfer, C. Combined thrombophilic polymorphisms in women with idiopathic recurrent miscarriage. Fertil. Steril. 2003, 79, 1141–1148. [Google Scholar] [CrossRef]
- Ozdemir, O.; Yenicesu, G.I.; Silan, F.; Koksal, B.; Atik, S.; Ozen, F.; Göl, M.; Cetin, A. Recurrent pregnancy loss and its relation to combined parental thrombophilic gene mutations. Genet. Test. Mol. Biomarkers 2012, 16, 279–286. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Xu, J.; Bao, X.; Niu, W.; Wang, L.; Du, L.; Zhang, N.; Sun, Y. Association between Genetic Polymorphisms in Interleukin Genes and Recurrent Pregnancy Loss—A Systematic Review and Meta-Analysis. PLoS ONE 2017, 12, e0169891. [Google Scholar] [CrossRef] [PubMed]
- Kerlin, B.; Cooley, B.C.; Isermann, B.H.; Hernandez, I.; Sood, R.; Zogg, M.; Hendrickson, S.B.; Mosesson, M.W.; Lord, S.; Weiler, H. Cause-effect relation between hyperfibrinogenemia and vascular disease. Blood 2004, 103, 1728–1734. [Google Scholar] [CrossRef] [PubMed]
- Gu, L.; Wu, G.; Su, L.; Yan, Y.; Long, J.; Tan, J.; Liang, B.; Guo, X.; Huang, G. Genetic polymorphism of beta-fibrinogen gene-455G/A can contribute to the risk of ischemic stroke. Neurol. Sci. 2014, 35, 151–161. [Google Scholar] [CrossRef] [PubMed]


| Gene (Polymorphism) | Primer Sequence (5′–3′) | T (°C) * | 
|---|---|---|
| FGB rs1800790 G > A | F: CATTTAGTCTGTGAGCATAC′ R: ACCTACTCACAAGGCAACCA | 52 | 
| HPA-1 rs5918 T > C | F: CCTTCTAGCTACAACTCCATGA R: GGGACTGACTTGAGTGACCTG | 60 | 
| Cases | Controls | |
|---|---|---|
| Age | 33.13 ± 6.2 | 32 ± 6.36 | 
| Number of abortion | 2.28 ± 0.67 | 0 | 
| Number of live birth | 0 | 2.5 ± 1.02 | 
| Controls (%) | Cases (%) | p Value | HWE * | |
|---|---|---|---|---|
| Alleles | ||||
| T | 202 (91.81%) | 198 (90%) | ||
| C | 18 (8.18%) | 22 (10%) | ||
| Total | 220 (100) | 220 (100) | 0.08 | |
| Genotypes | ||||
| TT | 95(86.36%) | 88 (80%) | ||
| TC | 12 (10.91%) | 22 (20%) | ||
| CC | 3 (2.73%) | 0 (0%) | ||
| Total | 110 (110) | 110 (100) | 0.02 | 0.24 | 
| Controls (%) | Cases (%) | p Value | HWE * | |
|---|---|---|---|---|
| Alleles | ||||
| G | 27 (12.3%) | 199 (90.45%) | ||
| A | 193 (87.7%) | 21 (9.55%) | ||
| Total | 220 (100) | 220 (100) | >0.05 | |
| Genotypes | ||||
| GG | 0 (0%) | 91 (82.73%) | ||
| GA | 27 (24.55%) | 17 (15.45%) | ||
| AA | 83 (75.45%) | 2 (1.82%) | ||
| Total | 110 (100) | 110 (100) | >0.05 | 0.14 | 
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Karami, F.; Askari, M.; Modarressi, M.H. Investigating Association of rs5918 Human Platelets Antigen 1 and rs1800790 Fibrinogen β Chain as Critical Players with Recurrent Pregnancy Loss. Med. Sci. 2018, 6, 98. https://doi.org/10.3390/medsci6040098
Karami F, Askari M, Modarressi MH. Investigating Association of rs5918 Human Platelets Antigen 1 and rs1800790 Fibrinogen β Chain as Critical Players with Recurrent Pregnancy Loss. Medical Sciences. 2018; 6(4):98. https://doi.org/10.3390/medsci6040098
Chicago/Turabian StyleKarami, Fatemeh, Maliheh Askari, and Mohammad Hossein Modarressi. 2018. "Investigating Association of rs5918 Human Platelets Antigen 1 and rs1800790 Fibrinogen β Chain as Critical Players with Recurrent Pregnancy Loss" Medical Sciences 6, no. 4: 98. https://doi.org/10.3390/medsci6040098
APA StyleKarami, F., Askari, M., & Modarressi, M. H. (2018). Investigating Association of rs5918 Human Platelets Antigen 1 and rs1800790 Fibrinogen β Chain as Critical Players with Recurrent Pregnancy Loss. Medical Sciences, 6(4), 98. https://doi.org/10.3390/medsci6040098
 
        

 
       