Next Article in Journal
Effect of High Potency Growth Implants on Average Daily Gain of Grass-Fattened Steers
Next Article in Special Issue
Correction: Ghoreyshi, S.M.; et al. Effects of Dietary Supplementation of L-Carnitine and Excess Lysine-Methionine on Growth Performance, Carcass Characteristics, and Immunity Markers of Broiler Chicken. Animals 2019, 9, 362
Previous Article in Journal
Clinical Effects of the Extract of the Seeds of the Indian Celery—Apium graveolens—In Horses Affected by Chronic Osteoarthritis
Previous Article in Special Issue
Omega-3 and Omega-6 Fatty Acids in Poultry Nutrition: Effect on Production Performance and Health
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 9
Issue 9
10.3390/ani9090586
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Threonine Requirements in Dietary Low Crude Protein for Laying Hens under High-Temperature Environmental Climate

by
Mahmoud Mostafa Azzam
1,3,*,
Rashed Alhotan
1,
Abdulaziz Al-Abdullatif
1,
Saud Al-Mufarrej
1,
Mohammed Mabkhot
1,
Ibrahim Abdullah Alhidary
1 and
Chuntian Zheng
2,*
1
Animal Production Department, College of Food and Agriculture Sciences, King Saud University, Riyadh 11451, Saudi Arabia
2
Guangdong Key Laboratory of Animal Breeding and Nutrition/Guangdong Public Laboratory of Animal Breeding and Nutrition/The Key Laboratory of Animal Nutrition and Feed Science (South China) of Ministry of Agriculture/State Key Laboratory of Livestock and Poultry Breeding/Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China
3
Poultry Production Department, Faculty of Agriculture, Mansoura University, Mansoura 35516, Egypt
*
Authors to whom correspondence should be addressed.
Animals 2019, 9(9), 586; https://doi.org/10.3390/ani9090586
Submission received: 10 July 2019 / Revised: 5 August 2019 / Accepted: 6 August 2019 / Published: 21 August 2019
(This article belongs to the Special Issue Poultry Nutrition)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

The threonine (Thr) requirement of laying hens in a high-temperature climate is scarcely referred in the review of literature. Therefore, our aim was to estimate the dietary Thr requirement in low CP diets in a high-temperature environmental climate. Based on our findings, the optimal dietary Thr requirements to optimize egg production, serum uric acid, and serum CuZn-SOD were 0.58%, 0.59%, and 0.56%, respectively, by regression analysis.

Abstract

Lohmann Brown hens (n = 420), at 28 weeks of age, were divided into five dietary treatments, and each treatment included six replicates of 14 laying hens. Dietary crude protein (14%) was presented as the control diet. Dietary L-Thr was added to the control diet for 12 weeks. Dietary Thr levels are 0.43%, 0.49%, 0.57%, 0.66%, and 0.74%, based on digestible base. From 28 to 40 weeks, hen-day egg production presented a quadratic trend to supplementing dietary Thr (R2 = 0.96, p = 0.02), and reached a maximum level at 0.58%. Serum uric acid demonstrated a quadratic trend (R2 = 0.62, p = 0.02) at 0.59%. Both serum total cholesterol and 3-hydroxy-3-methylglutaryl (HMG-CoA) reductase showed lower levels (p < 0.05) at 0.66% Thr. Serum CuZn-SOD elevated (p < 0.05) at 0.49%, 0.57%, and 0.66% Thr, as compared to the control group, and showed a quadratic trend (R2 = 0.87, p = 0.003) at 0.56%. Supplemental L-Thr decreased (p < 0.05) the expression of ileal HSP70 at 0.66% Thr. In summary, the optimal dietary Thr requirements to optimize egg production, serum uric acid, and serum CuZn-SOD were 0.58%, 0.59%, and 0.56%, respectively, by regression analysis.

1. Introduction

High temperatures negatively affect protein utilization efficiency [1]. In addition, diets that contain a high content of dietary crude protein (CP) will increase internal heat production by the elevated heat increment in a high-temperature climate [2]. Therefore, low levels of CP with supplementing limiting amino acids can overcome the bad effects of heat stress [3,4] and enhance protein utilization [5,6]. Recently, it has been reported that laying performance was equal among 14%, 15%, and 16% dietary CP [7]. Since synthetic dietary L-Thr became commercially available, it is possible to decrease CP. Thr affects protein synthesis and is the third limiting amino acid [8,9]. Recently, it has been reported that Thr is a limiting amino acid in diets containing 14% CP [10].
It has been showed that heat stress provoked lipid accumulation by elevated de novo lipogenesis, decreased lipolysis, and enhanced amino acid catabolism [11]. In addition, during stress times, the bird’s body begins freeing heat shock proteins to secure itself from the harmful cellular effects of reactive oxygen species [12]. Heat stress is usually accompanied by increasing levels of 70 kilodalton heat shock proteins (HSP70) [13,14]. In addition, high temperatures disturb oxidative status [15] and increase serum total cholesterol, triglyceride, and zinc [16,17,18,19,20].
The present research aimed to estimate the dietary Thr requirement in low CP diets for laying hens in a high-temperature environmental climate. In addition, the effects of increasing Thr on lipid peroxidation, antioxidants enzymes activities, mineral levels, and HSP70 were investigated.

2. Material and Methods

2.1. Management

All procedures in this study were conducted according to the guide for the care and use of agricultural animals in research and teaching (American society of animal science and poultry science association, 2010), through research group (No. RG-1440-146).
Lohmann Brown hens (n = 420), at 28 weeks of age, and with almost similar live body weights (1800 g), were divided into five dietary treatments. Each treatment included six replicates of 14 laying hens (4 birds/cage; 471.5 cm2/hen). They were exposed to 16-h light. The study began during the middle of May and ended in August; it lasted 13 weeks, including one week for acclimation. The mean daily temperature and humidity are both presented in Figure 1.

2.2. Experimental Diets

Hens were fed adlibitum (mash form), and water was available through nipples. Dietary CP (14%) was presented as the control diet (Table 1). Dietary Thr levels are 0.43%, 0.49%, 0.57%, 0.66%, and 0.74%, based on digestible base. Ingredient and analyzed CP and total amino acids are presented in Table 1 and Table 2, respectively. L-Thr (98.5% purity) was supplied at the expense of kaolin (inert filler). Samples from each diet were analyzed for CP and amino acids according to [21]. Total amino acids in diets were analyzed using HPLC, as described by the authors of [10].

2.3. Laying Performance

Mortalities were recorded daily. Egg numbers and egg weight were recorded daily. However, feed consumption was recorded weekly. Egg mass was calculated according to this formula (egg weight × egg production), while feed conversion ratio (FCR) was calculated according to grams of feed consumption/grams of egg mass produced.

2.4. Blood, Liver, and Ileum Sampling and Laboratory Analyses

At the end of the trial (40 weeks), 6 hens per treatment were slaughtered. The blood was collected and was centrifuged (3000× g) for 10 min. It was aspirated by pipette and stored in Eppendorf tubes at −70 °C. Serum concentrations of zinc (Zn), copper (Cu), triglyceride (TG), total cholesterol (CHO), glutamic oxaloacetic transaminase (GOT), and glutamic pyruvic transaminase (GPT) were determined by kits from (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The levels of serum uric acid, high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were analyzed by commercial kits from the previous company. The HDL-C levels in serum supernatant were determined after precipitation of lipoprotein-B using phosphotungstic acid/Mg2+ (PTA/Mg2+).
Serum 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase was determined following the manufacturer’s protocols from Sigma (St. Louis, MO, USA).
After slaughter, the liver of each hen was collected immediately, snap-frozen with liquid nitrogen, and stored at −80 °C until analysis. About 0.5 g of liver of every bird was homogenized and analyzed for CHO, TG, GOT, and GPT, as described above in the serum.

2.5. Oxidant and Antioxidant Status

Serum levels malondialdehyde (MDA), superoxide dismutase (SOD), total antioxidative capability (T-AOC), and copper zinc superoxide dismutase (CuZn-SOD) were analyzed as described by [22,23]. Liver tissues were homogenized in ice-cold isotonic physiological saline to form homogenates at the concentration of 0.1 g liver/mL. The samples of liver tissues were homogenized and centrifuged, and the supernatants were collected to analyze MDA, T-AOC, and SOD.

2.6. HSP70 mRNA Expression Assay

Total RNA was isolated from 50 mg of ileum, according to the instructions (TRIzol; Invitrogen, Carlsbad, CA, USA). The quality of RNA was examined by both native RNA electrophoresis on 1.0% agarose gel and the UV absorbance at 260 nm and 280 nm. The cDNA was synthesized from 2 lg of total RNA by a reverse transcriptase at 42 °C for 60 min with oligo dT-adaptor primer, using the protocol of the manufacturer (M-MLV; Takara, Dalian, China). The abundance of mRNA was determined based on a Step-One-Plus Real-Time PCR (ABI 7500; Applied Biosystems, Foster, CA, USA). The PCR used a kit (SYBR Premix PCR kit; Takara, Dalian, China) as described by [10]. Average gene expression relative to the endogenous control for each sample was calculated using the 2−ΔΔCt method [24]. The calibrator for each studied gene was the average ΔCt value of the control group (Table 3).

2.7. Statistical Analyses

Data (Replicate; n = 6) were statistically analyzed by one-way ANOVA (SPSS Inc., Chicago, IL, USA). Polynomial comparisons were applied to test for linear and quadratic responses of dependent variables to dietary Thr. Inflection points in response curves at increasing dietary Thr levels were calculated following [28]. To estimate the optimal Thr requirement, a quadratic regression equation based on 95% of the maximum or minimum response was used [29,30].

3. Results

3.1. Laying Performance and Optimal Dietary Thr

The results showed that both egg mass and hen-day egg production increased quadratically (p < 0.05) (Table 4).
From 28 to 34 weeks, hen-day egg production presented a quadratic trend to increasing dietary Thr (R2 = 0.97, p = 0.03) at 0.58%. In addition, hen-day egg production presented a quadratic trend (R2 = 0.96, p = 0.02), at 0.58% from 28–40 weeks (Table 5).

3.2. Serum Biochemical Parameters

Serum uric acid declined (p < 0.05) at 0.57% Thr (Figure 2) and showed a quadratic trend (R2 = 0.62, p = 0.02) at 0.59% (Table 5).
Serum total cholesterol decreased (p < 0.05) at 0.66% dietary Thr. Serum HMG-CoA reductase activity decreased (p < 0.05) at 0.49% and 0.66% dietary Thr (Table 6). No effects were observed in the liver for total CHO, HDL-C, HDL-C, and triglyceride.
Serum T-SOD increased (p < 0.05) at 0.49% dietary Thr. In addition, serum level of CuZn-SOD elevated (p < 0.05) from 0.49% to 0.66% dietary Thr (Table 7) and showed a quadratic trend (R2 = 0.87, p = 0.003) at 0.56% (Table 5).
Graded levels of dietary Thr did not affect serum or liver concentration of T-AOC, MDA, Zn, Cu, GOT, and GPT (Table 7).

3.3. Ileal HSP70 mRNA Expression

The expression of ileal HSP70 decreased (p < 0.05) at 0.66% Thr (Figure 3).

4. Discussion

It is important to formulate accurate diets to meet the requirements of laying hens because feed ingredients are expensive. In addition, laying hens have been selected for massive egg production, resulting in greater metabolic activity and reduced thermo-tolerance [31,32]. Heat stress has adverse effects on laying hens [33,34,35]. In addition, high temperatures increase the hens’ discomfort and lead to behavioral and endocrinological changes.
In the present study, rapid panting was noticed. In addition, the expression of ileal HSP70 protein decreased (p < 0.05) at 0.66% Thr. It has been reported that heat shock protein protects birds from high temperatures by preventing unwanted protein aggregation and channelizing their degradation [36]. The expression of mRNA HSP70 was measured in the gut [14,37], liver [38], hypothalamus [27,39], and blood and feather [40]. Here, we focused on detecting HSP70 in ileum because it plays a vital role in digestion and absorption, as well as immunity. In addition, the effects of Thr on intestinal function were known [41,42], and the effects of heat stress on gut function become obviously clear.
Both serum CHO and serum 3-HMG-CoA reductase decreased significantly (p < 0.05) at 0.66% dietary Thr. It has been reported that 3-hydroxy-3-methylglutaric acid (HMG) is a potent agent for reducing serum triglyceride and cholesterol concentrations [43,44]. It has been reported that HMG causes a 40% to 50% reduction of [1–14C] acetate incorporation into cholesterol in male rats [45]. In addition, HMG inhibited fatty acid synthesis in vivo [46]. In vitro, HMG inhibited 3-HMG-CoA reductase [mevalonate: NADP oxidoreductase (CoA-acylating), EC 1.1.1.34] and interfered with the enzymatic steps involved in the conversion of acetate to HMG-CoA [46]. Taken together, the data suggest that dietary Thr level affect CHO, especially biochemical pathways in which HMG-CoA reductase is involved. Our findings are in agreement with the results of the previous study in broiler chickens [47]. They found that plasma CHO levels decreased significantly (p < 0.05) when dietary Thr was sufficient [47]. Here, we did not find a decrease in total CHO levels in the liver. Recently, it has been reported that Thr supplementation did not have an effect (p > 0.05) on hepatic cholesterol in Pekin ducks [48]. They suggested that dietary Thr supplementation enhanced hepatic lipid metabolism by regulating lipid synthesis, transport, and oxidation. It has been reported that there is no relationship between the plasma CHO level and the level of yolk cholesterol [49,50,51], and, consequently, liver CHO.
The levels of GOT and GPT did not change due to treatments. The enzymatic activity of GOT and GPT are indicators of liver health. These enzymes are elevated in acute hepatotoxicity, but they are decreased with prolonged intoxication [52].
In the present study, dietary Thr at 0.49% increased serum levels of T-SOD (p < 0.05). In addition, dietary Thr at 0.49%, 0.57%, and 0.66% increased the levels of CuZn-superoxide dismutase (Cu-ZnSOD). The present result suggests that Thr may promote the antioxidative ability of laying hens. Previous studies [22,53] also found that supplemental amino acids (L-Thr and L-Trp) increased T-SOD in serum and the liver.
Uric acid is the metabolic product of protein metabolism and has been suggested as a dominant scavenger of free radicals [54]. We found that level of serum uric acid was declined at 0.57% Thr, which confirms that sufficient Thr increases amino acid utilization. Thr is considered a limiting amino acid in low CP diets [55,56], affecting utilization of TSAA and Lys [57]. It has been reported that the levels of plasma uric acid and excreta were higher from increasing CP than from lowering CP in the diet [58]. In addition, a decrease in the level of uric acid excretion was reported with supplementing limiting amino acids, which indicated better N utilization [59,60]. The plasma urea nitrogen and uric acid have been used to estimate amino acids requirements in swine and broilers [61,62,63].
It has been reported that laying performance decreased by feeding low CP diets [64]. Here, reduction CP (14%) in the control group reduced egg production quadratically. The effect of the low crude protein diet was pronounced clearly during the late cycle of laying production (43–63 weeks of age) [65]. This study was conducted during the first cycle of egg production (28–40 weeks).
Increasing dietary Thr to 0.57% improved egg production quadratically. It has been found that egg mass and hen-day egg production were reduced (p < 0.05) by feeding hens a Thr deficient diet [66]. This means that increasing recognition of Thr as a critical amino acid in the diet of laying hens fed a low CP diet under high-temperature environmental climate. The current results showed that 0.58% dietary Thr based on quadratic regressions guaranteed the best egg production. The present results are in agreement with [67]. They estimated that Thr requirement was 0.57% of dietary Thr from 24 to 40 weeks in Hy-Line W36.
Egg weight, feed consumption, and FCR were similar among dietary Thr levels. Previous studies reported no effect of Thr levels on the egg weight and FCR in laying hens [68,69,70,71]. It has been indicated that total Thr deficiency beyond 0.42% decreased feed intake [72].

5. Conclusions

From 28 to 40 weeks of age, the optimal dietary Thr requirements to optimize egg production, serum uric acid, and serum CuZn-SOD were 0.58%, 0.59%, and 0.56%, respectively, by regression analysis. In addition, serum total cholesterol, serum HMG-CoA reductase, and expression of ileal HSP70 decreased at 0.66% Thr.

Author Contributions

Data curation, M.M.A., R.A., A.A.-A., and M.M.; formal analysis, S.A.-M. and M.M.A.; investigation, M.M.A., A.A.-A., I.A.A., and C.Z.; methodology, M.M.A., R.A., I.A.A., and C.Z.; project administration, M.M.A.; writing—original draft, M.M.A.; writing—review and editing, M.M.A.

Funding

This research article was funded by the Deanship of Scientific Research at King Saud University, through research group No (RG-140-146).

Acknowledgments

The authors extend their acknowledgment to the Deanship of Scientific Research at King Saud University for funding this work through research group No (RG-1440-146).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zaman, Q.U.; Mushtaq, T.; Nawaz, H.; Mirza, M.A.; Mahmood, S.; Ahmad, T.; Babar, M.E.; Mushtaq, M.M.H. Effect of varying dietary energy and protein on broiler performance in hotclimate. Anim. Feed Sci. Technol. 2008, 146, 302–312. [Google Scholar] [CrossRef]
  2. Lin, H.; Decuypere, E.; Buyse, J. Acute heat stress induces oxidative stress in broiler chickens. Comp. Biochem. Physiol. 2006, 144, 11–17. [Google Scholar] [CrossRef] [PubMed]
  3. Laudadio, V.; Passantino, L.; Perillo, A.; Lopresti, G.; Passantino, A.; Khan, R.U.; Tufarelli, V. Productive performance and histological features of intestinal mucosa of broiler chickens fed different dietary protein levels. Poult. Sci. 2012, 91, 265–270. [Google Scholar] [CrossRef] [PubMed]
  4. Ghasemi, H.A.; Ghasemi, R.; Torki, M. Periodic usage of low-protein methionine-fortified diets in broiler chickens under high ambient temperature conditions: Effects on performance, slaughter traits, leukocyte profiles and antibody response. Int. J. Biometeorol. 2014, 58, 1405–1414. [Google Scholar] [CrossRef] [PubMed]
  5. Lin, H.; Jiao, H.C.; Buyse, J.; Decuypere, E. Strategies for preventing heat stress in poultry Worlds. Poult. Sci. J. 2006, 62, 71–85. [Google Scholar]
  6. Baker, D.H. Advances in protein-amino acid nutrition of poultry. Amino Acids. 2009, 37, 29–41. [Google Scholar] [CrossRef]
  7. Torki, M.; Nasiroleslami, M.; Ghasemi, H.A. The effects of different protein levels in laying hens under hot summer conditions. Anim. Prod. Sci. 2017, 57, 927–934. [Google Scholar] [CrossRef]
  8. Han, Y.; Suzuki, H.; Parsons, C.M.; Baker, D.H. Amino acid fortification of a low-protein corn and soybean meal diet for chicks. Poult. Sci. 1992, 71, 1168–1178. [Google Scholar] [CrossRef]
  9. Fernandez, S.R.; Aoyagi, S.; Han, Y.; Parsons, C.M.; Baker, D.H. Limiting order of amino acids in corn and soybean meal for growth of the chick. Poult. Sci. 1994, 73, 1887–1896. [Google Scholar] [CrossRef]
  10. Azzam, M.M.M.; Dong, X.Y.; Zou, X.T. Effect of dietary threonine on laying performance and intestinal immunity of laying hens fed low-crude-protein diets during the peak production period. J. Anim. Physiol. Anim. Nutr. 2017, 101, e55–e66. [Google Scholar] [CrossRef]
  11. Geraert, P.A.; Padilha, J.C.F.; Guillaumin, S. Metabolic and endocrine changes induced by chronic heat exposure in broiler chickens: Growth performance, body composition and energy retention. Br. J. Nutr. 1996, 75, 195–204. [Google Scholar] [CrossRef] [PubMed]
  12. Droge, W. Free radicals in the physiological control of cell function. Physiol. Rev. 2002, 82, 47–95. [Google Scholar] [CrossRef]
  13. Felver-Gant, J.N.; Mack, L.A.; Dennis, R.L.; Eicher, S.D.; Cheng, H.W. Genetic variations alter physiological responses following heat stress in 2 strains of laying hens. Poult. Sci. 2012, 91, 1542–1551. [Google Scholar] [CrossRef] [PubMed]
  14. Gu, X.H.; Hao, Y.; Wang, X.L. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult. Sci. 2012, 91, 790–799. [Google Scholar] [CrossRef] [PubMed]
  15. Ghazi, S.H.; Habibian, M.; Moeini, M.M.; Abdolmohammadi, A.R. Effects of different levels of organic and inorganic chromium on growth performance and immunocompetence of broilers under heat stress. Biol. Trace Elem. Res. 2012, 146, 309–317. [Google Scholar] [CrossRef] [PubMed]
  16. Feenster, R. High temperatures decrease vitamin utilization. Misset. Poult. 1985, 38, 38–41. [Google Scholar]
  17. Sahin, R.; Kucuk, O. A simple way to reduce heat stress in laying hens as judged by egg laying, body weight gain and biochemical parameters. Acta Vet. Hung. 2001, 49, 421–430. [Google Scholar] [CrossRef] [PubMed]
  18. Siegel, H.S. Stress, strains and resistance. Br. Poult. Sci. 1995, 36, 3–22. [Google Scholar] [CrossRef]
  19. Khan, R.U.; Naz, S.; Nikousefat, Z.; Tufarelli, V.; Javdani, M.; Naz, S.; Nikousefat, Z.; Tufarelli, V.; Javdani, M.; Rana, N.; et al. Effect of vitamin E in heat-stressed poultry. Worlds Poult. Sci. J. 2011, 67, 469–478. [Google Scholar] [CrossRef]
  20. Akdemir, F.; Sahin, N.; Orhan, C.; Tuzcu, M.; Sahin, K.; Hayirli, A. Chromium-histidinate ameliorates productivity in heat-stressed Japanese quails through reducing oxidative stress and inhibiting heat-shock protein expression. Br. Poult. Sci. 2015, 56, 247–254. [Google Scholar] [CrossRef]
  21. AOAC. Official Methods of Analysis; Association Official Analytical Chemists: Arlington, VA, USA, 2000. [Google Scholar]
  22. Azzam, M.M.M.; Dong, X.Y.; Xie, P.; Zou, X.T. Influence of L–threonine supplementation on goblet cell numbers, histological structure and antioxidant enzyme activities of laying hens reared in a hot and humid climate. Br. Poult. Sci. 2012, 53, 640–645. [Google Scholar] [CrossRef] [PubMed]
  23. Azzam, M.M.M.; Dong, X.Y.; Dai, L.; Zou, X.T. Effect of excess dietary L-valine on laying hen performance, egg quality, serum free amino acids, immune function and antioxidant enzyme activity. Br. Poult. Sci. 2015, 56, 72–78. [Google Scholar] [CrossRef] [PubMed]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  25. Deng, H.; Zheng, A.; Liu, G.; Chang, W.; Zhang, S.; Cai, H. Activation of mammalian target of rapamycin signaling in skeletal muscle of neonatal chicks: Effects of dietary leucine and age. Poult. Sci. 2014, 93, 114–121. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, Q.; Eicher, S.D.; Applegate, T.J. Development of intestinal mucin 2, IgA, and polymeric Ig receptor expressions in broiler chickens and Pekin ducks. Poult. Sci. 2015, 94, 172–180. [Google Scholar] [CrossRef] [PubMed]
  27. Hao, Y.; Gu, X.H.; Wang, X.L. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 1. Intestinal structure and digestive function. Poult. Sci. 2012, 91, 781–789. [Google Scholar] [CrossRef] [PubMed]
  28. Vedenov, D.; Pesti, G.M. A comparison of methods of fitting several models to nutritional response data. J. Anim. Sci. 2008, 86, 500–507. [Google Scholar] [CrossRef] [PubMed]
  29. Coma, J.; Carrion, D.; Zimmerman, D.R. Use of plasma urea nitrogen as a rapid response criterion to determine the lysine requirement of pigs. J. Anim. Sci. 1995, 73, 472–481. [Google Scholar] [CrossRef]
  30. Robbins, K.R.; Saxton, A.M.; Southern, L.L. Estimation of nutrient requirements using broken-line regression analysis. J. Anim.Sci. 2006, 84, E155–E165. [Google Scholar] [CrossRef]
  31. Settar, P.; Yalcin, S.; Turkmut, L.; Ozkan, S.; Cahanar, A. Season by genotype interaction related to broiler growth rate and heat tolerance. Poult. Sci. 1999, 78, 1353–1358. [Google Scholar] [CrossRef]
  32. Deeb, N.; Cahaner, A. Genotype-by-environment interaction with broiler genotypes differing in growth rate. 3. Growth rate and water consumption of broiler progeny from weight-selected versus non selected parents under normal and high ambient temperatures. Poult. Sci. 2002, 81, 293–301. [Google Scholar] [CrossRef] [PubMed]
  33. Star, L.; Juul-Madsen, H.R.; Decuypere, E.; Nieuwland, M.G.B.; de VriesReilingh, G.; Van Den Brand, H.; Kemp, B.; Parmentier, H.K. Effect of early life thermal conditioning and immune challenge on thermotolerance and humoral immune competence in adult laying hens. Poult. Sci. 2009, 88, 2253–2261. [Google Scholar] [CrossRef] [PubMed]
  34. Deng, W.; Dong, X.F.; Tong, J.M.; Zhang, Q. The probiotic Bacillus licheniformis ameliorates heat stress-induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens. Poult. Sci. 2012, 91, 575–582. [Google Scholar] [CrossRef] [PubMed]
  35. Mack, L.A.; Felver-Gant, J.N.; Dennis, R.L.; Cheng, H.W. Genetic variations alter production and behavioral responses following heat stress in 2 strains of laying hens. Poult. Sci. 2013, 92, 285–294. [Google Scholar] [CrossRef] [PubMed]
  36. Arndt, V.; Rogon, C.; Höhfeld, J. To be, or not to be—Molecular chaperones in protein degradation. Cell. Mol. Life Sci. 2007, 64, 2525–2541. [Google Scholar] [CrossRef] [PubMed]
  37. Flees, J.; Rajaei-Sharifabadi, H.; Greene, E.; Beer, L.; Hargis, B.M.; Ellestad, L.; Porter, T.; Donoghue, A.; Bottje, W.G.; Dridi, S. Effect of Morindacitrifolia (noni)-enriched diet on hepatic heat shock protein and lipid metabolism-related genes in heat stressed broiler chickens. Front. Physiol. 2017, 8, 919. [Google Scholar] [CrossRef] [PubMed]
  38. Rajaei-Sharifabadi, H.; Ellestad, L.; Porter, T.; Donoghue, A.; Bottje, W.G.; Dridi, S. Noni (Morindacitrifolia) modulates the hypothalamic expression of stress- and metabolic-related genes in broilers exposed to acute heat stress. Front. Genet. 2017, 8, 192. [Google Scholar] [CrossRef] [PubMed]
  39. Rajaei-Sharifabadi, H.; Greene, E.; Piekarski, A.; Falcon, D.; Ellestad, L.; Donoghue, A.; Bottje, W.; Porter, T.; Liang, Y.; Dridi, S. Surface wetting strategy prevents acute heat exposure-induced alterations of hypothalamic stress- and metabolic-related genes in broiler chickens. J. Anim. Sci. 2017, 95, 1132–1143. [Google Scholar] [CrossRef] [PubMed]
  40. Greene, E.S.; Rajaei-Sharifabadi, H.; Dridi, S. Feather HSP70: A novel non-invasive molecular marker for monitoring stress induced by heat exposure in broilers. Poult. Sci. 2019. [Google Scholar] [CrossRef]
  41. Wang, W.; Zeng, X.; Mao, X.; Wu, G.; Qiao, S. Optimal dietary true ileal digestible threonine for supporting the mucosal barrier in small intestine of weanling pigs. J. Nutr. 2010, 140, 981–986. [Google Scholar] [CrossRef]
  42. Bertrand, J.; Goichon, A.; Déchelotte, P.; Coëffier, M. Regulation of intestinal protein metabolism by amino acids. Amino Acids 2013, 45, 443–450. [Google Scholar] [CrossRef] [PubMed]
  43. Beg, Z.H.; Siddiqi, M. Hypocholesterolemic effect of 3-hydroxy-3methylglutaricacid. Experientia 1967, 23, 380. [Google Scholar] [CrossRef] [PubMed]
  44. Beg, Z.H.; Siddiqi, M. Effect of 3-hydroxy3-methylglutaric acid on blood lipids in normal and cholesterol-fed rats. Experientia 1968, 24, 791–792. [Google Scholar] [CrossRef] [PubMed]
  45. Beg, Z.H.; Lupien, P.J. In vitro and in vivo inhibition of hepatic cholesterol synthesis by 3-hydroxy-3-methylglutaric acid. Biochim. Biophys. Acta 1972, 260, 439–448. [Google Scholar] [CrossRef]
  46. Moorjani, S.; Lupien, P.J. Effect in vitro of 3-hydroxy-3-methylglutaric acid on the synthesis of mevalonate and its precursors. Arch. Int. Physiol. Biochim. 1977, 85, 1–10. [Google Scholar] [CrossRef]
  47. Azzam, M.M.M.; El-Gogary, M.R. Effects of dietary threonine levels and stocking density on the performance, metabolic status and immunity of broiler chickens. Asian J. Anim. Vet. Adv. 2015, 10, 215–225. [Google Scholar] [CrossRef]
  48. Jiang, Y.; Liao, X.D.; Xie, M.; Tang, J.; Qiao, S.Y.; Wen, Z.G.; Hou, S.S. Dietary threonine supplementation improves hepatic lipid metabolism of Pekin ducks. Anim. Prod. Sci. 2019, 59, 673–680. [Google Scholar] [CrossRef]
  49. Washburn, K.W.; Nix, D.F. A rapid technique for extraction of yolk cholesterol. Poult. Sci. 1974, 53, 1118–1122. [Google Scholar] [CrossRef]
  50. Shivaprasad, H.L.; Jaap, R.G. Egg and yolk production as influenced by liver weight, liver lipid and plasma lipid in three strains of small bodied chickens. Poult. Sci. 1977, 56, 1384–1390. [Google Scholar] [CrossRef]
  51. Vogt, H.; Harnisch, S.; Krieg, R. Versucheüber die notwendige Höheeines Nicotinamid-Zusatzeszum Broilerfutter. Arch. Geflügelk. 1990, 54, 45–49. [Google Scholar]
  52. Obi, E.; Orisakwe, O.E.; Asomugha, L.A.; Udemezue, O.O.; Orish, V.N. The hepatotoxic effect of halofantrine in guinea pigs. Indian J. Pharmacol. 2004, 36, 303–305. [Google Scholar]
  53. Dong, X.Y.; Azzam, M.M.M.; Rao, W.; Yu, D.Y.; Zou, X.T. Evaluating the impact of excess dietary tryptophan on laying performance and immune function of laying hens reared under hot and humid summer conditions. Br. Poult. Sci. 2012, 53, 491–496. [Google Scholar] [CrossRef] [PubMed]
  54. Simoyi, M.F.; Van Dyke, K.; Klandorf, H. Manipulation of plasma uric acid in broiler chicks and its effect on leukocyte oxidative activity. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 282, R791–R796. [Google Scholar] [CrossRef] [PubMed]
  55. Kidd, M.T.; Kerr, B.J. L-threonine for poultry: A review. J. Appl. Poult. Res. 1996, 5, 358–367. [Google Scholar] [CrossRef]
  56. Hussein, A.S.; Cantor, A.H.; Pescatore, A.J.; Gates, R.S.; Burnham, D.; Ford, M.J.; Paton, N.D. Effect of low protein diets with amino acid supplementation on broiler growth. J. Appl. Poult. Res. 2001, 10, 354–362. [Google Scholar] [CrossRef]
  57. Kidd, M.T. Nutritional considerations concerning threonine in broilers. World Poult. Sci. J. 2000, 56, 139–151. [Google Scholar] [CrossRef]
  58. Hsu, J.C.; Lin, C.Y.; Chiou, P.W.S. Effects of ambient temperature and methionine supplementation of a low protein diet on the performance of laying hens. Anim. Feed Sci. Tech. 1998, 74, 289–299. [Google Scholar] [CrossRef]
  59. Miles, R.D.; Featherston, W.R. Uric acid excretion as an indicator of the amino acid requirements of chicks. Proc. Soc. Exp. Biol. Med. 1974, 145, 686–689. [Google Scholar] [CrossRef]
  60. Salter, D.N.; Coates, M.E.; Hewitt, D. The utilization of protein and excretion of uric acid in germ-free and conventional chicks. Br. J. Nutr. 1974, 31, 307–318. [Google Scholar] [CrossRef] [Green Version]
  61. Knowles, T.A.; Southern, L.L.; Robbins, K.R. The use of serum urea nitrogen concentrations for the determination of lysine requirements of barrows. Prof. Anim. Sci. 1997, 13, 198–203. [Google Scholar] [CrossRef]
  62. Guzik, A.C.; Shelton, J.L.; Southern, L.L.; Kerr, B.J.; Bidner, T.D. The tryptophan requirement of growing and finishing barrows. J. Anim. Sci. 2005, 83, 1303–1311. [Google Scholar] [CrossRef] [PubMed]
  63. Donsbough, A.L.; Powell, S.; Waguespack, A.; Bidner, T.D.; Southern, L.L. Uric acid, urea, and ammonia concentrations in serum and uric acid concentration in excreta as indicators of amino acid utilization in diets for broilers. Poult. Sci. 2010, 89, 287–294. [Google Scholar] [CrossRef] [PubMed]
  64. Roberts, S.A.; Xin, H.; Kerr, B.J.; Russell, J.R.; Bregendahl, K. Effects of dietary fiber and reduced crude protein on ammonia emission from laying-hen manure. Poult. Sci. 2007, 86, 1625–1632. [Google Scholar] [CrossRef] [PubMed]
  65. Novak, C.; Yakout, H.M.; Scheideler, S.C. The effect of dietary protein level and total sulfur amino acid: lysine ratio on egg production parameters and egg yield in Hy-Line W-98 hens. Poult. Sci. 2006, 85, 2195–2206. [Google Scholar] [CrossRef] [PubMed]
  66. Harms, R.H.; Faria, D.E.; Russell, G.B. Evaluation of the suggested requirement of six amino acids for the commercial laying hen. J. Appl. Anim. Res. 2003, 23, 129–138. [Google Scholar] [CrossRef]
  67. Rocha, T.C.D.; Gomes, P.C.; Donzele, J.L.; Rostagno, H.S.; Mello, H.H.D.C.; Ribeiro, C.L.N.; Troni, A.R. Digestible threonine to lysine ratio in diets for laying hens aged 24–40 weeks. R. Bras. Zootec. 2013, 42, 879–884. [Google Scholar] [CrossRef]
  68. Ishibashi, T.; Ogawa, Y.; Itoh, T.; Fujimura, S.; Koide, K.; Watanabe, R. Threonine requirements of laying hens. Poult. Sci. 1998, 77, 998–1002. [Google Scholar] [CrossRef] [PubMed]
  69. Gomez, S.; Angeles, M. Effect of threonine and methionine levels in the diet of laying hens in the second cycle of production. J. Appl. Poult. Res. 2009, 18, 452–457. [Google Scholar] [CrossRef]
  70. Azzam, M.M.M.; Dong, X.Y.; Xie, P.; Wang, C.; Zou, X.T. The effect of supplemental L-threonine on laying performance, serum free amino acids, and immune function of laying hens under high-temperature and high-humidity environmental climates. J. Appl. Poult. Res. 2011, 20, 361–370. [Google Scholar] [CrossRef]
  71. Azzam, M.M.M.; Yuan, C.; Liu, G.H.; Zou, X.T. Effect of excess dietary threonine on laying performance, egg quality, serum free amino acids, and digestive enzymes activities of laying hens during the postpeak period. J. Appl. Poult. Res. 2014, 23, 605–613. [Google Scholar] [CrossRef]
  72. Faria, D.E.; Harms, R.H.; Russell, G.B. Threonine requirement of commercial laying hens fed a corn-soybean meal diet. Poult. Sci. 2002, 81, 809–814. [Google Scholar] [CrossRef] [PubMed]
Animals 09 00586 g001 550
Figure 1. Average temperature (°C) and humidity (%) inside the experimental farm by week.
Figure 1. Average temperature (°C) and humidity (%) inside the experimental farm by week.
Animals 09 00586 g001
Animals 09 00586 g002 550
Figure 2. Effect of Thr levels on the levels of serum uric acid. Values are means ± standard SEM. Means on each bar with no common letter differ (p < 0.05).
Figure 2. Effect of Thr levels on the levels of serum uric acid. Values are means ± standard SEM. Means on each bar with no common letter differ (p < 0.05).
Animals 09 00586 g002
Animals 09 00586 g003 550
Figure 3. Effect of graded levels of dietary Thr on mRNA expression of ileal HSP70. Values are means ± SEM. means with different superscripts; a,b differ (p < 0.05).
Figure 3. Effect of graded levels of dietary Thr on mRNA expression of ileal HSP70. Values are means ± SEM. means with different superscripts; a,b differ (p < 0.05).
Animals 09 00586 g003
Table
Table 1. The ingredients and nutrient level of the control diet.
Table 1. The ingredients and nutrient level of the control diet.
Ingredients%
Yellow Corn65.6
Soybean meal11.0
Peanut meal (47.8%)8.5
Soybean oil3.0
Limestone.38% Ca8.1
CaHPO41.8
L-Lys. HCL0.23
DL-Meth0.15
L-Thr0.0
L-Isoleucine0.22
L-Trp0.04
L-Val0.16
Premix 10.5
NaCl0.3
Filler (Kaolin)0.4
Total100
Nutrient Level 2%
Analyzed CP14.0
Digestible Lys 0.69
Digestible Meth + Cysteine0.54
Digestible Thr0.43
Ca3.60
P0.43
Metabolizable Energy, Kcal/kg2850
1 Premix per kilogram of diet: Vitamins (A, 12,000 IU; E, 20 IU; D3, 2,500 IU; K3, 1.8 mg; B1, 2.0 mg; B2, 6.0 mg; B6, 3.0 mg; B12, 0.020 mg; niacin, 25 mg; pantothenic acid, 10 mg; folic acid, 1.0 mg; biotin, 50 mg). Minerals per mg: Fe, 50; Zn, 65; Mn, 65; Co, 0.250. 2 Values of digestible amino acids were calculated according to (Rostagno et al., 2011).
Table
Table 2. Amino acids (g/kg) in experimental diets.
Table 2. Amino acids (g/kg) in experimental diets.
Amino Acids (g/kg)Dietary Treatments (L-Thr, g/kg)
0.01.02.03.04.0
Digestible Thr 14.34.95.76.67.4
Arginine8.78.58.48.78.6
Isoleucine7.16.96.96.86.9
Lysine7.47.27.47.47.3
Methionine3.43.33.53.43.4
Threonine4.55.26.06.97.8
Valine7.77.57.47.67.5
Glycine6.26.06.06.26.0
Serine6.66.86.86.66.7
1 Values of digestible Thr were calculated according to (Rostagno et al., 2011).
Table
Table 3. Gene and primer sequence.
Table 3. Gene and primer sequence.
Gene Name(5′–3′) Primer Sequence (5′–3′)Reference
18s rRNAR: ATTCCGATAACGAACGAGACT[25]
F: ATTCCGATAACGAACGAGACT
GAPDHR: TCCTAGGATACACAGAGGACCA[26]
F: CGGTTGCTATATCCAAACTCA
HSP70R: GTCAGTGCTGTGGACAAGAGTA[27]
F: CCTATCTCTGTTGGCTTCATCCT
HSP70 means the 70 kilodalton heat shock proteins.
Table
Table 4. Effect of graded levels of dietary Thr on laying performance of laying hens 1,2.
Table 4. Effect of graded levels of dietary Thr on laying performance of laying hens 1,2.
ItemsThr Levels (%)SEMp-Value
0.430.490.570.660.74ThrLinearQuadratic
28–34 weeks
Egg production, %91.5794.6695.9395.7394.261.760.03
Egg weight, g62.4963.0262.3962.7362.310.83
Egg mass, g/hen/day57.2259.6559.8460.0658.721.430.04
ADFI, g/hen/day123.15116.3135.22122.51130.210.35
FCR2.161.952.262.042.220.18
35–40 weeks
Egg production, %90.1493.3994.8994.3693.421.950.05
Egg weight, g63.5564.0863.3463.7163.330.89
Egg mass, g/hen/day57.2859.8360.1160.1659.161.63
ADFI, g/hen/day117.27115.77122.27115.09121.589.34
FCR2.051.942.041.922.050.16
28–40 weeks
Egg production, %90.8694.0295.4195.0493.841.70.03
Egg weight, g63.0263.5562.8663.2262.810.85
Egg mass, g/hen/day57.2559.7459.9860.1258.941.43
ADFI, g/hen/day120.21116.04128.74118.8125.8910.35
FCR2.11.942.151.982.130.18
1 Data are means of 6 replications with 14 hens/replicate; 2 Throughout the entire experimental period, 2 birds died.
Table
Table 5. Estimations of the dietary Thr requirements based on quadratic regressions.
Table 5. Estimations of the dietary Thr requirements based on quadratic regressions.
VariablesEquationsRequirementsp-ValueR2
Hen-day egg production (28–34 week)Y = −132.406X2 + 162.416X + 46.4460.580.030.97
Hen-day egg production (28–40 week)Y = −131.368X2 + 161.869X + 45.8090.580.020.96
Serum uric acidY = 3207.394X2 − 3995.371X + 1470.7050.590.020.62
Serum CuZn-SODY = −1130.848X2 + 1336.98X − 1130.8480.560.0030.87
Y = Dependent variables; X = The dietary Thr level (%).
Table
Table 6. Effect of graded levels of dietary Thr on the levels of lipoproteins and activities and HMG-CoA reductase of laying hens 1,2.
Table 6. Effect of graded levels of dietary Thr on the levels of lipoproteins and activities and HMG-CoA reductase of laying hens 1,2.
ItemsThr Levels (%)SEMp-Value
0.430.490.570.660.74ThrLinearQuadratic
Serum, mmol/L
Triglyceride15.9414.0916.1714.0513.041.62
Total cholesterol4.67 a3.35 a,b4.26 a2.61 b3.14 a,b0.460.0080.005
High-density lipoprotein0.320.250.250.270.180.06
Low-density lipoprotein1.010.880.91.00.840.14
HMG-CoA reductase activity, ng/L189.80 a104.41 b171.88 a103.29 b172.77 a14.970.00010.00
Liver, μmol/gprot
Triglyceride154.6123.49146.15159.66149.9912.91
Total cholesterol31.5119.6830.127.6427.594.63
High-density lipoprotein17.5518.6417.8717.2418.091.79
Low-density lipoprotein25.3320.6323.7514.221.084.34
1 n = 6 hens/treatment; 2 means with different superscripts; a,b differ (p < 0.05).
Table
Table 7. Effect of graded levels of dietary Thr on the levels of antioxidants in the liver and serum of laying hens 1,2.
Table 7. Effect of graded levels of dietary Thr on the levels of antioxidants in the liver and serum of laying hens 1,2.
ItemsThr Levels (%)SEMp-Value
0.430.490.570.660.74ThrLinearQuadratic
Serum
T-AOC, U/mL6.3197.3537.2836.8825.1491.15
T-SOD, U/ mL131.566 b184.003 a162.439 a,b161.869 a,b178.778 a,b16.340.03
CuZn-SOD, U/ mL75.03 b103.85 a102.80 a102.34 a83.60 a,b9.030.0080.001
MDA, nmol/ mL8.0718.9310.0438.9458.7951.01
Zn, μmol/L51.8162.966.9256.4460.58.56
Cu, μmol/L18.0517.4218.0717.4416.860.95
GOT, IU/L9.459.8410.228.68.920.65
GPT, IU/L3.152.833.873.33.410.66
Liver
T-AOC, U/mgprot1.781.621.81.871.60.31
T-SOD, U/mgprot93.73105.6991.01111.94102.7213.66
MDA, nmol/mgprot0.680.660.880.810.780.14
GOT, U/gprot40.0141.5942.0638.3939.53.04
GPT, U/gprot13.4913.1415.1414.3815.31.19
1 n = 6 hens/treatment; 2 means with different superscripts; a,b differ (p < 0.05).

Share and Cite

MDPI and ACS Style

Azzam, M.M.; Alhotan, R.; Al-Abdullatif, A.; Al-Mufarrej, S.; Mabkhot, M.; Alhidary, I.A.; Zheng, C. Threonine Requirements in Dietary Low Crude Protein for Laying Hens under High-Temperature Environmental Climate. Animals 2019, 9, 586. https://doi.org/10.3390/ani9090586

AMA Style

Azzam MM, Alhotan R, Al-Abdullatif A, Al-Mufarrej S, Mabkhot M, Alhidary IA, Zheng C. Threonine Requirements in Dietary Low Crude Protein for Laying Hens under High-Temperature Environmental Climate. Animals. 2019; 9(9):586. https://doi.org/10.3390/ani9090586

Chicago/Turabian Style

Azzam, Mahmoud Mostafa, Rashed Alhotan, Abdulaziz Al-Abdullatif, Saud Al-Mufarrej, Mohammed Mabkhot, Ibrahim Abdullah Alhidary, and Chuntian Zheng. 2019. "Threonine Requirements in Dietary Low Crude Protein for Laying Hens under High-Temperature Environmental Climate" Animals 9, no. 9: 586. https://doi.org/10.3390/ani9090586

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop