Heat Treatment at an Early Age Has Effects on the Resistance to Chronic Heat Stress on Broilers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Determination of Serum GOT and GPT
2.3. Determination of Serum Dopamine, Serotonin, and Corticosterone Levels
2.4. Determination of HSPs, HOP, and HIP by Western Blot
2.5. Gene Expression by Real Time qPCR
2.6. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum GOT and GPT Assay
3.3. Analysis of Serum Dopamine, Serotonin, and Corticosterone Concentrations
3.4. Expression of HSPs and Related Proteins by Western Blot
3.5. RT-qPCR Amplification of HSPs, HSFs, and Pro-Inflammatory Cytokine Gene Expression
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zulkifli, I.; Liew, P.; Israf, D.; Omar, A.; Hair-Bejo, M. Effects of early age feed restriction and heat conditioning on heterophil/lymphocyte ratios, heat shock protein 70 expression and body temperature of heat-stressed broiler chickens. J. Therm. Boil. 2003, 28, 217–222. [Google Scholar] [CrossRef]
- Borges, S.A.; Da Silva, A.V.F.; Majorka, A.; Hooge, D.M.; Cummings, K.R. Physiological responses of broiler chickens to heat stress and dietary electrolyte balance (sodium plus potassium minus chloride, milliequivalents per kilogram). Poult. Sci. 2004, 83, 1551–1558. [Google Scholar] [CrossRef]
- Farooqi, H.; Khan, M.; Khan, M.; Rabbani, M.; Pervez, K.; Khan, J. Evaluation of betaine and vitamin C in alleviation of heat stress in broilers. Int. J. Agric. Biol. 2005, 5, 744–746. [Google Scholar]
- Harsini, S.G.; Habibiyan, M.; Moeini, M.M.; Abdolmohammadi, A.R. Effects of Dietary Selenium, Vitamin E, and Their Combination on Growth, Serum Metabolites, and Antioxidant Defense System in Skeletal Muscle of Broilers under Heat Stress. Boil. Trace Elem. Res. 2012, 148, 322–330. [Google Scholar] [CrossRef] [PubMed]
- Vathana, S.; Kang, K.; Loan, C.; Thinggaard, G.; Kabasa, J.; ter Meuler, U. Effect of vitamin C supplementation on performance of broiler chickens in Cambodia. Deutscher Tropentag. In Proceedings of the Conference on International Agricultural Research for Development, Witzenhausen, Germany, 9–11 October 2002. [Google Scholar]
- Arjona, A.A.; Denbow, D.M.; Weaver, W.D. Effect of Heat Stress Early in Life on Mortality of Broilers Exposed to High Environmental Temperatures Just Prior to Marketing. Poult. Sci. 1988, 67, 226–231. [Google Scholar] [CrossRef]
- Zaboli, G.-R.; Rahimi, S.; Shariatmadari, F.; Torshizi, M.A.K.; Baghbanzadeh, A.; Mehri, M. Thermal manipulation during Pre and Post-Hatch on thermotolerance of male broiler chickens exposed to chronic heat stress. Poult. Sci. 2016, 96, 478–485. [Google Scholar] [CrossRef] [PubMed]
- Yalçin, S.; Özkan, S.; Çabuk, M.; Siegel, P.B. Criteria for Evaluating Husbandry Practices to Alleviate Heat Stress in Broilers. J. Appl. Poult. Res. 2003, 12, 382–388. [Google Scholar] [CrossRef]
- May, J.D. Ability of Broilers to Resist Heat Following Neonatal Exposure to High Environmental Temperature. Poult. Sci. 1995, 74, 1905–1907. [Google Scholar] [CrossRef]
- Star, L.; Juul-Madsen, H.R.; Decuypere, E.; Nieuwland, M.G.B.; Reilingh, G.D.V.; Brand, H.V.D.; Kemp, B.; Parmentier, H.K. Effect of early life thermal conditioning and immune challenge on thermotolerance and humoral immune competence in adult laying hens. Poult. Sci. 2009, 88, 2253–2261. [Google Scholar] [CrossRef]
- Liu, L.L.; He, J.H.; Xie, H.B.; Yang, Y.S.; Li, J.C.; Zou, Y. Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens. Poult. Sci. 2013, 93, 54–62. [Google Scholar] [CrossRef]
- Wang, W.C.; Yan, F.F.; Hu, J.Y.; Amen, O.A.; Cheng, H.W. Supplementation of Bacillus subtilis-based probiotic reduces heat stress-related behaviors and inflammatory response in broiler chickens. J. Anim. Sci. 2018, 96, 1654–1666. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Tang, L.; Lu, L.; Zhang, L.; Xi, L.; Liu, H.-C.; Odle, J.; Luo, X. Differential Expression of Heat Shock Transcription Factors and Heat Shock Proteins after Acute and Chronic Heat Stress in Laying Chickens (Gallus gallus). PLoS ONE 2014, 9, e102204. [Google Scholar] [CrossRef] [PubMed]
- Vinoth, A.; Thirunalasundari, T.; Tharian, J.A.; Shanmugam, M.; Rajkumar, U.; Murugesan, S. Effect of thermal manipulation during embryogenesis on liver heat shock protein expression in chronic heat stressed colored broiler chickens. J. Therm. Boil. 2015, 53, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Yeğenoğlu, E.; Lgen, G. Effects of thermal conditioning treatments on brain HSP70 level in broilers under heat stress. In Proceedings of the World Poultry Science Association (WPSA), 2nd Mediterranean Summit of WPSA, Antalya, Turkey, 4–7 October 2009; pp. 139–142. [Google Scholar]
- Marwah, A.; Marwah, P.; Lardy, H. Liquid chromatography-electrospray ionization mass spectrometric analysis of corticosterone in rat plasma using selected ion monitoring. J. Chromatogr. B Biomed. Sci. Appl. 2001, 757, 333–342. [Google Scholar] [CrossRef]
- Taylor, S.C.; Berkelman, T.; Yadav, G.; Hammond, M. A defined methodology for reliable quantification of Western blot data. Mol. Biotechnol. 2013, 55, 217–226. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Slawinska, A.; Zampiga, M.; Sirri, F.; Meluzzi, A.; Bertocchi, M.; Tavaniello, S.; Maiorano, G. Impact of galactooligosaccharides delivered in ovo on mitigating negative effects of heat stress on performance and welfare of broilers. Poult. Sci. 2019. [Google Scholar] [CrossRef]
- Goodla, L.; Manubolu, M.; Pathakoti, K.; Poondamalli, P.R. Preventive and curative effects of Cocculus hirsutus (Linn.) Diels leaves extract on CCl4 provoked hepatic injury in rats. Egypt. J. Basic Appl. Sci. 2017, 4, 264–269. [Google Scholar] [CrossRef]
- Sudhanshu, S.; Gupta, D. Assessment of liver damage in male albino rats after repetitive heat stress of moderate level. Natl. J. Physiol. Pharm. Pharmacol. 2013, 3, 147. [Google Scholar] [CrossRef]
- Melesse, A.; Maak, S.; Schmidt, R.; Von Lengerken, G. Effect of long-term heat stress on some performance traits and plasma enzyme activities in Naked-neck chickens and their F1 crosses with commercial layer breeds. Livest. Sci. 2011, 141, 227–231. [Google Scholar] [CrossRef]
- Xie, J.; Tang, L.; Lu, L.; Zhang, L.; Lin, X.; Liu, H.-C.; Odle, J.; Luo, X. Effects of acute and chronic heat stress on plasma metabolites, hormones and oxidant status in restrictedly fed broiler breeders. Poult. Sci. 2015, 94, 1635–1644. [Google Scholar] [CrossRef] [PubMed]
- Felver-Gan, J.; Dennis, R.; Zhao, J.; Cheng, H. Effects of Dietary Antioxidant on Performance and Physiological Responses Following Heat Stress in Laying Hens. Int. J. Poult. Sci. 2014, 13, 260–271. [Google Scholar]
- Ma, X.; Lin, Y.; Zhang, H.; Chen, W.; Wang, S.; Ruan, D.; Jiang, Z. Heat stress impairs the nutritional metabolism and reduces the productivity of egg-laying ducks. Anim. Reprod. Sci. 2014, 145, 182–190. [Google Scholar] [CrossRef] [PubMed]
- Braganza, A.; Wilson, W.O. Elevated temperature effects on catecholamines and serotonin in brains of male Japanese quail. J. Appl. Physiol. 1978, 45, 705–708. [Google Scholar] [CrossRef] [PubMed]
- Sinha, R.K. Study of changes in some pathophysiological stress markers in different age groups of an animal model of acute and chronic heat stress. Iran. Biomed. J. 2007, 11, 101–111. [Google Scholar] [PubMed]
- Sinha, R.K. Serotonin synthesis inhibition by pre-treatment of p-CPA alters sleep-electrophysiology in an animal model of acute and chronic heat stress. J. Therm. Boil. 2008, 33, 261–273. [Google Scholar] [CrossRef]
- Filipovic, D.; Zlatkovic, J.; Gass, P.; Inta, D. The differential effects of acute vs. chronic stress and their combination on hippocampal parvalbumin and inducible heat shock protein 70 expression. Neuroscience 2013, 236, 47–54. [Google Scholar] [CrossRef]
- Lindquist, S. The heat-shock response. Annu. Rev. Biochem. 1986, 55, 1151–1191. [Google Scholar] [CrossRef]
- Zulkifli, I.; Al-Aqil, A.; Omar, A.R.; Sazili, A.Q.; Rajion, M.A. Crating and heat stress influence blood parameters and heat shock protein 70 expression in broiler chickens showing short or long tonic immobility reactions. Poult. Sci. 2009, 88, 471–476. [Google Scholar] [CrossRef]
- Tamzil, M.; Noor, R.; Hardjoswor, P.; Manalu, W.; Sumantri, C. Acute Heat Stress Responses of Three Lines of Chickens with Different Heat Shock Protein (HSP)-70 Genotypes. Int. J. Poult. Sci. 2013, 12, 264–272. [Google Scholar] [CrossRef]
- Yu, J.; Bao, E. Effect of Acute Heat Stress on Heat Shock Protein 70 and Its Corresponding mRNA Expression in the Heart, Liver, and Kidney of Broilers. Asian Australas. J. Anim. Sci. 2008, 21, 1116–1126. [Google Scholar] [CrossRef]
- Yu, J.; Bao, E.; Yan, J.; Lei, L. Expression and localization of Hsps in the heart and blood vessel of heat-stressed broilers. Cell Stress Chaperones 2008, 13, 327–335. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. Proinflammatory cytokines. Chest 2000, 118, 503–508. [Google Scholar] [CrossRef] [PubMed]
- Oskoueian, E.; Abdullah, N.; Idrus, Z.; Ebrahimi, M.; Goh, Y.-M.; Shakeri, M.; Oskoueian, A. Palm kernel cake extract exerts hepatoprotective activity in heat-induced oxidative stress in chicken hepatocytes. BMC Complement. Altern. Med. 2014, 14, 368. [Google Scholar] [CrossRef] [Green Version]
- Yun, S.-H.; Moon, Y.-S.; Sohn, S.-H.; Jang, I.-S. Effects of cyclic heat stress or vitamin C supplementation during cyclic heat stress on HSP70, inflammatory cytokines, and the antioxidant defense system in Sprague Dawley rats. Exp. Anim. 2012, 61, 543–553. [Google Scholar] [CrossRef] [Green Version]
- Dong, X.F.; Tong, J.M.; Deng, W.; Zhang, Q. The probiotic Bacillus licheniformis ameliorates heat stress-induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens. Poult. Sci. 2012, 91, 575–582. [Google Scholar] [CrossRef]
- Jin, Y.; Hu, Y.; Han, D.; Wang, M. Chronic Heat Stress Weakened the Innate Immunity and Increased the Virulence of Highly Pathogenic Avian Influenza Virus H5N1 in Mice. J. Biomed. Biotechnol. 2011, 2011, 1–10. [Google Scholar] [CrossRef] [Green Version]
Chemical Composition | Starter 1 | Finisher 2 |
---|---|---|
Crude protein | 20.0% | 19.0% |
Crude fat | 4.0% | 4.0% |
Calcium | 0.75% | 0.75% |
Phosphate | 0.70% | 0.70% |
Crude fiber | 6.0% | 5.5% |
Crude ash | 8.0% | 8.0% |
Met + Cys + MHA 3 | 0.75% | 0.65% |
ME 4 | 3.00 Mcal/kg | 3.05 Mcal/kg |
Machine | LC-MS/MS, Waters Xevo TQ-S, USA |
---|---|
Column | Synergi Hydro-RP column, 4 μm, 150 × 2 mm; Waters, USA |
Injection volume | 5 μL |
Column temperature | 35 °C |
Flow rate | 0.2 mL/min |
Mobile phase | A: 0.1% formic acid in distilled water |
B: 0.1% formic acid in methanol | |
Gradient program | Initial to 1 min for 0% |
1–4 min for linear increase to 100% | |
Hold for 0.5 min | |
4.5–5 min for linear decrease to 0% B | |
Hold 0% B for 5 min |
Genes | Primer Sequences (5′-3′) | Accession Number | Annealing Temp. (°C) |
---|---|---|---|
HSP90 | F: TGAAACACTGAGGCAGAAGG | NC_006092.5 | 62 °C |
R: AAAGCCAGAGGACAGGAGAG | |||
HSP70 | F: GGTAAGCACAAGCGTGACAATGCT | AY143693.1 | 55 °C |
R: TCAATCTCAATGCTGGCTTGCGTG | |||
HSP60 | F: ATGTGTGGAGCAGCAAGACAGAGA | NM_001012916.1 | 55 °C |
R: TTCATGAGCTCCCAATCCCAGACA | |||
HSP47 | F: ACTGGCTCATAAGCTCTCCAGCAT | X57157.1 | 57 °C |
R: TCATCTTGCTGGCCCA GGTCTTTA | |||
HSP40 | F: GGGCATTCAACAGCATAGA | NM_001199325.1 | 60 °C |
R: TTCACATCCCCAAGTTTAGG | |||
HSP27 | F: ACACGAGGAGAAACAGGATGAG | NM_205290.1 | 60 °C |
R: ACTGGATGGCTGGCTTGG | |||
HSF1 | F: AAGTCACCAGCGTGTCCAG | NM_001305256.1 | 60 °C |
R: GCCTCGTTCTCATGCTTCA | |||
HSF2 | F: TACTGCATTTCCGCTGCTC | NM_001167764.2 | 60 °C |
R: AGGGGTTTGTCCACAGAGG | |||
HSF3 | F: ACGACGTCATCTGCTGGAG | NM_001305041.1 | 60 °C |
R: TTGAGCTGTCGGATGAAGC | |||
TNF-α | F: AGATGGGAAGGGAATGAACC | NM_204267.1 | 60 °C |
R: GACGTGTCACGATCATCTGG | |||
IFNG | F: TGAACTGAGCCATCACCAAG | NM_205149.1 | 60 °C |
R: AGGTCCACCGTCAGCTACAT | |||
IL-6 | F: CTCCTCGCCAATCTGAAGTC | NM_204628 | 60 °C |
R: CCCTCACGGTCTTCTCCATA | |||
GAPDH | F: AGAACATCATCCCAGCGT | K01458 | 60 °C |
R: AGCCTTCACTACCCTCTTG |
Factors | Control | Chronic Heat | p-Value | |
---|---|---|---|---|
C | CH | HH | ||
Initial body weight (g/bird) | 33.02 ± 0.62 | 32.48 ± 0.7 | 32.55 ± 0.58 | 0.8162 |
Body weight (g/bird) | ||||
7 days | 118.12 ± 3.65 | 120.45 ± 3.63 | 114.98 ± 3.79 | 0.0517 |
21 days | 814.45 ± 17.66 | 797.05 ± 17.51 | 777.71 ± 21.22 | 0.4062 |
35 days | 2029.18 ± 13.51 a | 1812.75 ± 11.94 b | 1834.58 ± 8.48 b | <0.0001 |
BDG 1 (g/bird) | ||||
0–7 days | 12.16 ± 0.53 | 12.57 ± 0.5 | 11.78 ± 0.54 | 0.5613 |
8–21 days | 99.48 ± 2.12 | 96.66 ± 2.16 | 94.68 ± 2.82 | 0.3850 |
22–35 days | 173.53 ± 2.44 a | 145.1 ± 2.88 b | 150.98 ± 2.95 b | <0.0001 |
Feed intake (g/bird) | ||||
0–7 days | 92.2 ± 1.81 | 89.1 ± 1.39 | 87.02 ± 1.11 | 0.0915 |
8–21 days | 927.16 ± 13.82 | 906.16 ± 15.7 | 908.11 ± 22.9 | 0.6693 |
22–35 days | 2266.32 ± 23.67 a | 1994.9 ± 39.2 b | 1989.77 ± 20.74 b | 0.0001 |
FCR 2 | ||||
0–7 days | 1.1 ± 0 | 1.1 ± 0.04 | 1.03 ± 0.03 | 0.1410 |
8–21 days | 1.38 ± 0.03 | 1.35 ± 0.03 | 1.4 ± 0 | 0.3227 |
22–35 days | 1.85 ± 0.03 | 1.93 ± 0.03 | 1.88 ± 0.03 | 0.1439 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, D.; Park, J.; Shim, K. Heat Treatment at an Early Age Has Effects on the Resistance to Chronic Heat Stress on Broilers. Animals 2019, 9, 1022. https://doi.org/10.3390/ani9121022
Kang D, Park J, Shim K. Heat Treatment at an Early Age Has Effects on the Resistance to Chronic Heat Stress on Broilers. Animals. 2019; 9(12):1022. https://doi.org/10.3390/ani9121022
Chicago/Turabian StyleKang, Darae, JinRyong Park, and KwanSeob Shim. 2019. "Heat Treatment at an Early Age Has Effects on the Resistance to Chronic Heat Stress on Broilers" Animals 9, no. 12: 1022. https://doi.org/10.3390/ani9121022
APA StyleKang, D., Park, J., & Shim, K. (2019). Heat Treatment at an Early Age Has Effects on the Resistance to Chronic Heat Stress on Broilers. Animals, 9(12), 1022. https://doi.org/10.3390/ani9121022