Next Article in Journal
Transcriptome-Based Identification and Molecular Evolution of the Cytochrome P450 Genes and Expression Profiling under Dimethoate Treatment in Amur Stickleback (Pungitius sinensis)
Previous Article in Journal
Protective Effect of Resveratrol Improves Systemic Inflammation Responses in LPS-Injected Lambs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 9
Issue 11
10.3390/ani9110874
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characteristics of the BMP7 Promoter in Hu Sheep

by
Xiaoyang Lv
1,
Wei Sun
1,2,*,
Shuangxia Zou
1,
Ling Chen
3,4,
Joram M. Mwacharo
5 and
Jinyu Wang
1,*
1
College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
2
Joint International Research Laboratory of Agriculture and Agri-Product Safety of Ministry of Education of China, Yangzhou University, Yangzhou 225009, China
3
Animal Science and Veterinary Medicine Bureau of Suzhou City, Suzhou 215200, China
4
Suzhou Stud Farm, Suzhou 215200, China
5
Small Ruminant Genomics Group, International Center for Agricultural Research in the Dry Areas (ICARDA), Addis Ababa P.O. BOX 5689, Ethiopia
*
Authors to whom correspondence should be addressed.
Animals 2019, 9(11), 874; https://doi.org/10.3390/ani9110874
Submission received: 28 June 2019 / Revised: 25 September 2019 / Accepted: 11 October 2019 / Published: 28 October 2019
(This article belongs to the Section Small Ruminants)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Bone morphogenetic protein 7 (BMP7) is one of the largest secretory signal conductive molecules and is in the TGF-β superfamily. It plays an important role in the growth and development of hair follicles. We cloned the proximal promoter of the BMP7 gene for bioinformatics analysis. Dual-luciferase reporter system and overexpression were used to analyze the key regions and transcription factor binding sites. There was high activity between −758 bp and −545 bp in the core region of the gene and a possible binding site for transcription factors SP1 and EGR1.

Abstract

The BMP7 gene is involved in the growth and development of hair follicles but its regulation mechanism is unclear. We studied the regulation mechanism of the BMP7 promoter by cloning the proximal promoter of BMP7 for bioinformatics analysis. A series of missing vectors was then constructed for dual-fluorescein activity detection based on the bioinformatics analysis results. We tested transcription-factor binding-site mutations and transcription factor over-expression to analyze the transcriptional regulation principle of the BMP7 promoter region. The upstream transcriptional regulatory region of the BMP7 gene proximal promoter was predicted by bioinformatics. There were −1216 bp to −1166 bp and −632 bp to −582 bp transcription initiation sites in the upstream transcriptional regulatory region of the BMP7 gene proximal promoter. The CpG islands’ distribution showed that there were many CpG islands at −549 bp to 1 bp. A dual-luciferase assay revealed high activity between −758 bp and −545 bp in the core region and a possible binding site for transcription factors SP1 and EGR1. The transcriptional activity of BMP7 was significantly decreased in the transcriptional regulatory region of the BMP7 after EGR1 and SP1 mutation. Transcription was significantly enhanced by over expression of the EGR1 transcription factor, which strongly suggests that EGR1 and SP1 play important roles in BMP7 regulation.

1. Introduction

Bone morphogenetic protein (BMP) belongs to the transforming growth factor-β (TGF-β) superfamily [1]. The BMP family has many biological functions in cell proliferation, differentiation, bone formation, tumors, and hair follicle growth. The BMP signaling pathway may inhibit the Wnt/β-catenin signaling pathways to promote hair cycle growth [2] and enable the hair follicle stem cells in the growth cycle to be stationary [3]. The BMP signaling pathway is critical for the differentiation of hair root sheaths and hair shafts. Kulessa [4] found that transgenic mice overexpressed the BMP antagonist noggin caused hair matrix cells proliferation and hair precursor cells differentiation leading to hair growth. In noggin-knockout mice, prolonged periods of excessive BMPs impeded the development of primary hair follicles and affected the formation process of inner root sheaths and hair shafts [5,6]. In addition, Noramly [7] found that BMP7 is related to the size and spatial distribution of feather embryos. These studies identified BMPs as regulators of the genetic control of hair shaft differentiation in hair follicles. The BMP7 is one of the most biologically active proteins in the BMP family and it is also an important signaling molecule involved in hair follicle development. The BMP7 gene is highly expressed when hair follicles are in their growth phase, especially when the cells begin to proliferate at the basement membrane. When hair follicle enters the degenerative phase or the resting phase, BMP7 is low or undetected [8]. Wang [9] noted that BMP7 can inhibit wool growth in fine wool sheep. These results indicate that BMP7 may promote the proliferation of hair follicle cells in the hair follicle growth phase.
High-throughput sequencing allows the screening of trait-related genes. Research on the regulation of gene expression is a current research emphasis area. Research on small RNA is another research focus, but promoters are also key components of the expression regulation. Understanding the promoter structure is the first step in determining transcriptional regulation. The eukaryotic promoter is located upstream of the 5′ end of the gene and it can bind to RNA polymerase II to regulate gene transcription. This regulation affects cell growth, differentiation, and apoptosis and is the main method of regulating gene expression. To clarify the molecular mechanism of gene transcription regulation, understanding the transcriptional regulation of the promoter is necessary. In this study, we cloned the proximal promoter region of BMP7 and predicted the transcription initiation site and CpG island (a 200 bp region of DNA with a high G_C content greater than 50% and observed CpG_expected CpG ratio of greater or equal to 0.6). A series of deletion vectors were constructed to determine the core region using a dual-luciferase assay. Based on the core region, we analyzed the transcription factor sites by bioinformatics analysis methods. Site-directed mutagenesis and transcription factor over-expression tests were performed to verify the authenticity of the candidate BMP7 transcription factor. Finally, we identified the transcription factor of BMP7.

2. Material and Methods

2.1. Ethics Statement

The Institutional Animal Care and Use Committee (IACUC) of the government of Jiangsu Province (Permit No. 45) and the Ministry of Agriculture of China (Permit No. 39) approved the animal study proposal. All experimental procedures were conducted in strict compliance with the recommendations of the Guide for the Care and Use of Laboratory Animals of Jiangsu Province and of the Animal Care and Use Committee of the Chinese Ministry of Agriculture. Efforts were made to minimize animal suffering.

2.2. Sample Collection

Sheep were obtained from the Suzhou stud farm in China. A 0.5 cm2 sample of ear tissue was collected from each sheep. Tissue was frozen with liquid nitrogen and ground to a powder. An animal Tissues/Cells Genomic DNA Extraction Kit (Solarbio, Beijing, China) was used to extract DNA from the ground ear tissue. Extracted DNA was stored at −20 °C.

2.3. Bioinformatics Analysis of Proximal Promoter

According to the BMP7 promoter sequence, bioinformatics software and websites were used to predict basic BMP7 information. Promoter 2.0 Prediction Server [10] and NNPP [11] were used to predict the core region of the proximal promoter of BMP7. MethPrimer [12] was used to predict CpG islands. TRANSFAC [13] and JASPAR [14] were used to predict the transcription factor binding site.

2.4. Deletion Plasmids Construction

According to the DNA sequence in NCBI (Gene ID: 443175), Oligo7 was used to design different primers for deletion fragments to amplify the BMP7 promoter region. The restriction sites (KpnI and HindIII) were added to the 5′ ends of the forward and reverse primers. The volume of the PCR amplification system was 50 μL, including 25 μL of 2 × GC Buffer I (II) (Takara, Dalian, China), 8 μL of dNTP Mix (Takara, Dalian, China), 2 μL of 10 mmol/L primer (forward and reverse), 0.5 μL of LA Taq (Takara, Dalian, China), 2 μL of DNA, and 10.5 μL of ddH2O. The amplification program was as follows: initial denaturation at 94 °C for 1 min, followed by an optimal number of cycles (33 cycles) of denaturation at 94 °C for 30 s, annealing at 68 °C for 30 s, extension at 72 °C for 60 s, with a final extension at 72 °C for 5 min. The final PCR product was stored at 4 °C.
MiniEST Agarose Gel DNA Extraction Kit (TaKaRa, Dalian, China) was used to recover the PCR product. Connection system: Recycling PCR product 4 μL, pGL3-Base vector 1 μL, Solution I 5 μL, connection at 16 °C for 16 h; 2 μL ligation product was added to a 50 μL of DH5α competent cell and suspended on ice for 30 min at 42 °C for 45–60 s; after 2 min, ice bath Liquid LB medium was added (948 μL), and the mix was shaken with 120 rpm at 37 °C for 1 h. Then, 50 μL of LB medium with DH5α was applied on the LB plates with Amp culturing at 37 °C for 12–16 h. A single colony was selected for culturing and plasmid purification. Polymerase Chain Reaction(PCR) and enzyme digestion experiments were used to perform colony selection. The positive plasmids were sent to Sangon Biotech Co. Ltd. (Shanghai, China) for sequencing. The EndoFree Maxi Plasmid Kit (DP117) (TaKaRa, Dalian, China) was used to extract the plasmids and they were stored at −20 °C. We selected the sequence from 2000 bp upstream and 500 bp downstream of the initiation codon ATG of BMP7 (−2000 bp to +500 bp), and different fragments of the promoter region were amplified, including B1(−1500 bp to +257 bp), B2 (−985 bp to +29 bp), B3 (−758 bp to +29 bp), and B4 (−545 bp to +29 bp). Then, we constructed B5 (−758 bp to −545 bp) fragment vectors for regions with high transcriptional activity (Table 1).

2.5. Transfection and Dual-Luciferase Assay

The HEK293T cells were cultured in a 24 well plate at a density of 5 × 105 with DMEM/F12 (Gibco, New York, NY, USA) supplemented with 10% FBS (Sigma, San Francisco, CA, USA) with 5% CO2 in air at 37 °C. After 24 h, the cells were cultured to 80% confluence and transfected using FuGENE® HD Transfection Reagent (Promega, WI, USA), according to its manufacturer instructions. The target plasmid and the internal reference plasmid pGL-TK were co-transfected into the cells at a ratio of 15–20:1, and negative and positive controls were set. After 24 h, 10 μL of cell lysate were added to the non-transparent 96 well plate, and 50 μL of Luciferase Reagent were added to immediately measure the Firefly luciferase activity with the Synergy 2 chemiluminescence detector (Bio Tek, Vermont, USA). The corresponding Renilla luciferase activity values were measured immediately after adding 50 μL of 1× Stop & Glo® Reagent.

2.6. Mutant and Overexpression Plasmids Construction and Dual-Luciferase Assays

Bioinformatics analysis of the regions with high transcriptional activity revealed two transcription factors EGR1 and SP1 with high scores. To verify whether these two transcription factors have significant effects on transcription activity, transcription factor binding sites were mutated. According to the primer design requirements of the Fast Site-Directed Mutagenesis Kit (Tiangen, Beijing), the transcription factor point mutation primers (Table 2) were designed using Oligo7. The mutation plasmid BT1 (mutation of EGR1 binding site) and BT2 (mutation of SP1 binding site) were constructed using the B5 fragment as a template, respectively. The EGR1 overexpression plasmid was constructed by Suzhou Jinglun Biotechnology Co., Ltd., Suzhou, China.

2.7. Statistical Analysis

The relative activity of luciferase (the ratio of firefly luciferase activity value to Renilla luciferase activity value) was analyzed using one-way analysis of variance (ANOVA). A p < 0.05 was considered to be a significant. The statistics software used was SPSS version 16.0.

3. Results

3.1. Bioinformatics Analysis of the Proximal Promoter Region of Hu Sheep BMP7

The 2000 bp upstream sequence and the 500 bp downstream sequence of the BMP7 from translation initiation codon (ATG) were retrieved from the NCBI database. We predicted the possible transcription initiation site. The results showed that there were two possible locations including −1216 bp to −1166 bp and −632 bp to −582 bp. The CpG island prediction of the BMP7 promoter was performed using CpG finder and MethPrimer. The prediction was based on Island size > 100, GC Percent > 50.0, Obs/Exp > 0.6. The results showed CpG-rich islands at −549 bp to 1 bp, with a fragment length of 549 bp (Figure 1).

3.2. Deletion Fragment Analysis of the BMP7 Promoter

In order to identify the core region of the BMP7 promoter, four deletion plasmids were constructed. They were used to transfect cells and detect dual-luciferase activity (Figure 2). The activity of B1 and B2 fragments were similar and the difference was not significant. Compared with B1 and B2, the activity of B3 significantly decreased (p < 0.05). Compared to B1, B2, and B3, the activity of B4 significantly decreased (p < 0.01). The promoter activity was shown between B3 and B4, specifically in the −758 bp to −545 bp region. The total activity of B4 and the −758 bp to −545 bp region was not different than that of the B3 (Figure 3). Therefore, the −758 bp to −545 bp region may have a cis element that positively regulates the BMP7 promoter activity.

3.3. Conservative Analysis of Transcription Core and Prediction of Transcription Factors

To identify the conservation of the transcriptional core sequences (−758 to −545 bp), MEGA X software was used for homology analysis between the transcriptional core sequences of BMP7 and the published sequences in Genbank Homo sapiens (NM_001719.3), Mus musculus (NM_007557.3), Rattus norvegicus (NM_001191856.2), Sus scrofa (NM_001105290.1), Bos taurus (NM_001206015.1), Canis lupus familiaris (NM_001197052.1), Pan troglodytes (XM_001170064), Canis lupus familiaris (NM_001197052.1); we then constructed a phylogenetic tree (Figure 4). Homology analysis showed that: the transcriptional core sequences of the Hu sheep BMP7 promoter had the highest homology (99%) with Bos taurus. However, the promoter transcriptional core sequences of sheep and other species (Homo sapiens, Pan troglodytes, Rattus norvegicus, Canis lupus familiaris, Sus scrofa, and Mus musculus) have very low homology. Sequence analysis showed that homology of the transcriptional core sequences (−758 to −545 bp) between sheep and other species was low, except for Bos Taurus.
We screened for possible transcription factors and JASPAR was used to predict the transcription factor between −758 and −545 bp of the BMP7 promoter. There were no typical RNA polymerase II binding elements, such as CAAT and TATA boxes. In the prediction results, ZNF263 had the highest score, and SP1 had the highest frequency of occurrence. The possible transcription factors in this region also included EGR1, NRF1, KLF5, FOXI1, FOXB1, and FOXC1. Analysis of the prediction results showed that the transcription factors SP1 and EGR1 had higher scores, and they were involved in cell growth and development. We selected these factors for verification and analysis and believe that they play important roles in transcriptional regulation (Table 3).

3.4. Verification of Point Mutation of Transcription Factor

The transcription activity of the B5 (−758 to −545 bp) fragment is high. Transcription factors EGR1 and SP1 exist in this fragment and these two transcription factors have an effect on the transcription activity. Therefore, we determined whether the transcription activity of the B5 fragment is reduced by site-specific mutations of EGR1 and SP1, respectively. Compared to B5 fragment activity, we analyzed the transcription activity level after mutation. Compared with the non-mutated groups, the promoter activity significantly decreased (p < 0.01) after EGR1 and SP1 mutations, and there was a particularly more significant difference between the B5 and the EGR1 mutant plasmids (Figure 5). Therefore, these two transcription factors EGR1 and SP1 may play an important role in the regulation of promoter activity; as EGR1 had a greater influence on BMP7 promoter activity, an EGR1 overexpression plasmid was constructed to further verify the binding sites.

3.5. Overexpression of EGR1 on Transcriptional Activity of the BMP7 Promoter

To study binding sites of the EGR1 transcription factor in the BMP7 promoter, the EGR1 overexpression plasmid was co-transfected with the B5. The dual-luciferase activity in the overexpression group was significantly higher (p < 0.01) than in the control group (Figure 6). Overexpression of EGR1 may have affected the transcriptional activity of B5. The EGR1 transcription factor binding site may exist in the BMP7 promoter region. This could affect the transcriptional activity and regulation of the BMP7 promoter.

4. Discussion

4.1. Characteristics of the Hu Sheep BMP7 Promoter

Among molecular regulatory processes, transcription regulation has a significant impact on gene expression. The gene BMP7 is well known to be expressed in bone, kidney, and skin [15], and it has many biological functions, including participation in bone formation and regeneration, hair follicle growth and development, and the growth and development of the reproductive system. [6,16,17]. However, there is little research on the transcriptional regulation of BMP7. It is necessary to study the regulation of BMP7 at the transcriptional level because the promoter is the most important transcriptional regulatory element. We analyzed the promoter activity of the 5′-flanking region of BMP7 and found that a positive regulatory region is located upstream of the initiation codon (−758 bp to −545 bp). Similar to our results, the tongue sole BMP7 promoter contained one potential region located upstream of the initiation codon (−740 bp to −396 bp) [18]. However, there are multiple core transcription regions (−3070 bp to −1771 bp; −1277 bp to −491 bp) in the human BMP7 promoter [19]. In addition, Simon [20] found that the sequence within the 1394 bp BMP7 5′-flanking region has a high activity. We found that the sequence within 1500 bp BMP7 5′-flanking region has a high activity in human and tongue sole. The Hu sheep BMP7 promoter contained two main transcription initiation sites (−1216 bp and −632 bp). The human BMP7 promoter contains a single transcription initiation site (−764 bp) [19].

4.2. The Regulatory Elements Involved in Control of Hu Sheep BMP7 Expression

Gene transcriptional regulation by a promoter occurs in a system in which the transcription factor and regulatory elements are the most important components [21]. There are many regulatory elements and transcription factor binding sites on each promoter, such as CAAT box, TATA box, SP1, and AP1. Transcription factors are trans-acting factors that are located on promoter sequences and bind to cis-acting elements to regulate transcriptional regulation [22]. In the present study, regulatory elements and transcription factors were identified. There were no typical RNA polymerase II binding elements (CAAT and TATA box) in the positive regulatory region (−758 bp to −545 bp). No TATA and CAAT boxes were found in the positive regulatory region of BMP7 in mice [20]. Previous studies have detected that only 10–20% of mammalian promoters had TATA box. The transcriptional regulation processes of mammals can be performed without the TATA box [23,24].
We predicted transcription factor binding sites were in the core region of the promoter of BMP7, and we screened transcription factors related to transcriptional regulation. The transcription factors SP1, SP2, ZNF263, EGR1, NRF1, KLF5, FOXI1, FOXB1, and FOXC1 were predicted from −758 to −545 bp of the Hu sheep BMP7 promoter. At present, some reports showed that SNPs on promoters could affect the binding of transcription factors. Four SNPs were found on a porcine BMP7 promoter, including T-3722C, A-3684G, C-3522G, A-1027G. T-3722C, C-3522G, and A-1027G were located at transcription factor binding site and affected the transcriptional activity [25]. Therefore, site-directed mutagenesis experiment is needed to study the transcription factors. In our study, transcription factors EGR1 and SP1 with high scores were selected by site-directed mutagenesis and transcription factor overexpression experiments. The SP1 has also been in the BMP7 promoter of other mammal species [19,20], while EGR1 appeared in the BMP7 promoter core region of Hu sheep. We speculate that EGR1 might participate in the transcriptional regulation of BMP7.

4.3. Functions of EGR1 and SP1

The transcription factors SP1 and SP2, belong to the SP/KLF family. It is known that SP1 binds to the GC/CT cassette in the promoter region of the gene, activates the transcription process, and is abnormally expressed in various tumor groups [26,27,28]. The DNA binding activity of SP1 in human dermal papilloma was significantly higher than that of normal cells [29]. In addition, SP2 has both activation and inhibitory effects; it competes with SP1 or SP4 to bind to the GC/CT cassette, thereby inhibiting the onset of transcription [30,31]. Early growth response protein 1 (EGR1) belongs to the immediate early gene family. It is an important transcription factor that activates or inhibits the transcription of genes and, thus, participates in the regulation of cell proliferation and cell apoptosis, growth, and differentiation [32,33]. Kwon [34] found that patulin HCT116 promoters promote the EGR1 binding promoter and inhibits cell growth. Kruppel-like factor 5 (KLF5) is a family of Sp/Kruppel transcription factors that regulates transcription by binding to a promoter. These transcription factors are abundantly expressed in epithelial tissues and are involved in cell proliferation, embryonic development, and tumorigenesis [35,36,37,38].

5. Conclusions

This study found a high degree of activity in the BMP7 promoter region between −758 bp and −545 bp and its homology between sheep and other species was low, except for Bos Taurus, and CpG-rich islands at −549 bp to 1 bp, with a fragment length of 549 bp. The transcription factors SP1 and EGR1 may have binding sites that regulate the BMP7 gene promoter. Both EGR1 and SP1 could be used as candidate transcription factors for future studies (Figure 7).

Author Contributions

Conceptualization, J.W. and W.S.; Formal analysis, X.L. and S.Z.; Methodology, J.W. and W.S.; Supervision, W.S.; Validation, L.C., J.W. and W.S.; Writing—original draft, X.L.; Writing—review and editing, X.L., S.Z. and J.M.M.

Funding

This work was funded by the National Natural Science Foundation of China (31872333), the Projects of Domesticated Animals Platform of the Ministry of Science, Key Research and Development Plan (modern agriculture) in Jiangsu Province (BE2018354), the Major New Varieties of Agricultural Projects in Jiangsu Province (PZCZ201739), the Jiangsu Agricultural Science and Technology Innovation Fund (CX (18)2003), the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, and the Major Projects of the Natural Science Research of Colleges and Universities in Jiangsu Province (17KJA230001).

Acknowledgments

We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Conflicts of Interest

All authors declare no conflicts of interest.

References

  1. Termaat, M.F.; Den, B.F.C.; Bakker, F.C.; Bakker, F.C.; Patka, P.; Haarman, H.J. Bone morphogenetic proteins. Development and clinical efficacy in the treatment of fractures and bone defects. J. Bone Jt. Surg. 2005, 87, 1367–1378. [Google Scholar]
  2. Oshinmori, N.; Fuchs, E. Paracrine TGF-β signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012, 10, 63–75. [Google Scholar] [CrossRef] [PubMed]
  3. Genander, M.; Cook, P.J.; Ramsköld, D.; Ramskold, D.; Keyes, B.E.; Mertz, A.F.; Sandberg, R.; Fuchs, E. BMP signaling and its pSMAD1/5 target genes differentially regulate hair follicle stem cell lineages. Cell Stem Cell 2014, 15, 619–633. [Google Scholar] [CrossRef] [PubMed]
  4. Kulessa, H.; Turk, G.; Hogan, B.L. Inhibition of bmp signaling affects growth and differentiation in the anagen hair follicle. EMBO J. 2000, 19, 6664–6674. [Google Scholar] [CrossRef] [PubMed]
  5. Andl, T.; Ahn, K.; Kairo, A.; Chu, E.Y.; Wine-Lee, L.; Reddy, S.T.; Croft, N.J.; Cebra-Thomas, J.A.; Metzger, D.; Chambon, P.; et al. Epithelial bmprla regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 2004, 131, 2257–2268. [Google Scholar] [CrossRef]
  6. Ma, Y.N.; You, Y.; Shen, H.H.; Sun, Z.Z.; Zeng, L.; Fa, Y.Z. Effect of Noggin silencing on the BMP and Wnt signaling pathways. Acta Lab. Anim. Sci. Sin. 2016, 24, 475–478. (In Chinese) [Google Scholar]
  7. Noramly, S.; Morgan, B.A. BMPs mediate lateral inhibition at successive stages in feather tract development. Development 1998, 125, 3775–3787. [Google Scholar]
  8. Song, L.L.; Cui, Y.; Yu, S.J.; Liu, P.G.; Zhang, Q. Expression characteristics of bmp2, bmpr-ia and noggin in different stages of hair follicle in yak skin. Gen. Comp. Endocrinol. 2017, 260, 18–24. [Google Scholar] [CrossRef]
  9. Adly, M.A.; Assaf, H.A.; Hussein, M.R. Expression of bone morphogenetic protein-7 in human scalp skin and hair follicles. Br. J. Dermatol. 2010, 154, 551–554. [Google Scholar] [CrossRef]
  10. Knudsen, S. Promoter2.0: for the recognition of PolII promoter sequences. Bioinformatics 1999, 5, 356–361. [Google Scholar] [CrossRef]
  11. Reese, M.G. Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome. Comput. Chem. 2002, 1, 51–56. [Google Scholar]
  12. Li, L.C.; Dahiya, R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002, 11, 1427–1431. [Google Scholar] [CrossRef] [PubMed]
  13. Wingender, E. The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation. Brief. Bioinform. 2008, 4, 326–332. [Google Scholar] [CrossRef] [PubMed]
  14. Aziz, K.; Oriol, F.; Arnaud, S.; Marius, G.; Jaime, A.C.; Robin, V.D.L.; Adrien, B.; Jeanne, C.; Shubhada, R.K.; Ge, T.; et al. JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Res. 2018, D1, D1284. [Google Scholar]
  15. Lee, W.S.; Otsuka, F.; Moore, R.K.; Shimasaki, S. Effect of Bone Morphogenetic Protein-7 on Folliculogenesis and Ovulation in the Rat. Biol. Reprod. 2014, 65, 994–999. [Google Scholar] [CrossRef]
  16. Dudley, A.T.; LyonS, K.M.; Robertson, E.J. A requirement for bone morphongenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 1995, 9, 2795–2807. [Google Scholar] [CrossRef]
  17. Ross, A.; Munger, S.; Capel, B. Bmp7 Regulates Germ Cell Proliferation in Mouse Fetal Gonads. Sex. Dev. 2007, 1, 127. [Google Scholar] [CrossRef]
  18. Ma, Q.; Feng, W.R.; Zhuang, Z.M.; Liu, S.F. Cloning, expression profiling and promoter functional analysis of Bone morphogenetic protein 6 and 7 in tongue sole (Cynoglossus semilaevis). Fish Physiol. Biochem. 2017, 43, 435–454. [Google Scholar] [CrossRef]
  19. Kawai, S.; Sugiura, T. Characterization of Human Bone Morphogenetic Protein(BMP)-4 and -7 Gene Promoters: Activation of BMP Promoters by Gli, a Sonic Hedgehog Mediator. Bone 2001, 29, 54–61. [Google Scholar] [CrossRef]
  20. Simon, M.; Feliers, D.; Arar, M.; Bhandari, B.; Abboud, H.E. Cloning of the 5′-flanking region of the murine bone morphogenetic protein-7 gene. Mol. Cell. Biochem. 2002, 233, 31–37. [Google Scholar] [CrossRef]
  21. Li, M.; Chen, Q.X.; Sun, G.R.; Shi, X.M.; Zhao, Q.H.; Zhang, C.; Zhou, J.S.; Qin, N. Characterization and expression of bone morphogenetic protein 4 gene in postnatal pigs. Mol. Biol. Rep. 2010, 37, 2369–2377. [Google Scholar] [CrossRef] [PubMed]
  22. Du, Y.P.; Wu, C.M.; Miao, J.H. Research Progress of Transcription Factors Sp1 and SP2. Int. J. Lab. Med. 2016, 37, 1094–1096. [Google Scholar]
  23. Ling, F.; Wang, T.; Wei, L.Q.; Zhu, X.P.; Chen, Y.S.; Li, J.Q.; Zhang, Z.W.; Du, H.L.; Wang, X.N.; Wang, J.F. Cloning and characterization of the 5′-flanking region of the pig AgRP gene. Mol. Boil. Rep. 2009, 381, 236–240. [Google Scholar] [CrossRef] [PubMed]
  24. Sandelin, A.; Carninci, P.; Lenhard, B.; Ponjavic, J.; Hayashizaki, Y.; Hume, D.A. Mammalian RNA polymerase II core promoters: Insights from genome-wide studies. Nat. Rev. Genet. 2007, 8, 424–436. [Google Scholar] [CrossRef] [PubMed]
  25. Qin, N. Polymorphism in the promoter region of swine BMP7 gene and their association with reproductive traits. Henan Agric. Univ. 2011. (In Chinese) [Google Scholar] [CrossRef]
  26. Li, F.; Jiang, Z.; Wang, K.; Guo, J.; Hu, G.; Sun, L.X.; Wang, T.; Tang, X.Z.; He, L.; Yao, J.C.; et al. Transactivation of the human NME5 gene by Sp1 in pancreatic cancer cells. Gene 2012, 503, 200–207. [Google Scholar] [CrossRef] [PubMed]
  27. Xu, K.; Shu, H.K.G. EGFR activation results in enhanced cyclooxygenase-2 expression through p38 mitogen-activated protein kinase-dependent activation of the Sp1/Sp3 transcription factors in buman gliomas. Cancer Res. 2007, 67, 6121–6129. [Google Scholar] [CrossRef]
  28. Nam, E.H.; Lee, Y.; Zhao, X.F.; Park, Y.K.; Lee, J.W.; Kim, S. ZEB2-Sp1 cooperation induces invasion by upregulating cadherin-11 and integrin α5 expression. Carcinogenesis 2014, 35, 302–314. [Google Scholar] [CrossRef]
  29. Bai, X.; Deng, H. Research progress on relationship between transcription factor Sp1 and tumor. J. Zhejiang Univ. (Med. Sci.) 2010, 39, 215–220. (In Chinese) [Google Scholar]
  30. Haugen, T.H.; Lace, M.J.; Ishiji, T.; Sameshima, A.; Anson, J.R.; Turek, L.P. Cellular factors are required to activate bovine papillomavirus-1 early gene transcription and to establish viral plasmid persistence but are not required for cellular transformation. Virology 2009, 389, 82–90. [Google Scholar] [CrossRef] [Green Version]
  31. Zhao, C.; Meng, A. Sp1-like transcription factors are regulators of embryonic development in vertebrates. Dev. Growth Regen. 2005, 47, 201–211. [Google Scholar] [CrossRef] [PubMed]
  32. Bhattacharyya, S.; Wu, M.; Fang, F.; Tourtellotte, W.; Feghali-Bostwick, C.; Varga, J. Early growth response transcription factors: Key mediators of fibrosis and novel targets for anti-fibrotic therapy. Matrix Biol. 2011, 30, 235–242. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Lu, Y.; Li, T.; Qureshi, H.Y.; Han, D.; Paudel, H.K. Early growth response 1 (Egr-1) regulates phosphorylation of microtubule-associated protein tau in mammalian brain. J. Biol. Chem. 2011, 286, 20569–20581. [Google Scholar] [CrossRef] [PubMed]
  34. Kwon, O.; Soung, N.K.; Thimmegowda, N.R.; Jeong, S.J.; Jang, J.H.; Moon, D.O.; Chung, J.K.; Lee, K.S.; Kwon, Y.T.; Erikson, R.L.; et al. Patulin induces colorectal cancer cells apoptosis through EGR-1 dependent ATF3 up-regulation. Cell. Signal. 2012, 24, 943–950. [Google Scholar] [CrossRef] [Green Version]
  35. Dong, J.T.; Chen, C. Essential role of KLF5 transcription factor in cell proliferation and differentiation and its implications for human diseases. Cell. Mol. Life Sci. Cmls 2009, 66, 2691–2706. [Google Scholar] [CrossRef]
  36. Shindo, T.; Manabe, I.; Fukushima, Y.; Tobe, K.; Aizawa, K.; Miyamoto, S.; Kawai-Kowase, K.; Moriyama, N.; Imai, Y.; Kawakami, H.; et al. Kruppel-like zinc-finger transcription factor KLF5/BTEB2 is a target for angiotensin II signaling and and essential regulator of cardiovascular remodeling. Nat. Med. 2002, 8, 856–863. [Google Scholar] [CrossRef]
  37. Kaczynski, J.; Cook, T.; Urrutia, R. Sp1- and Kruppel-like transcription factors. Genome Biol. 2003, 4, 206. [Google Scholar] [CrossRef]
  38. Nandan, M.O.; Mcconnell, B.B.; Ghaleb, A.M.; Bialkowska, A.B.; Sheng, H.; Shao, J.; Babbin, B.A.; Robine, S.; Yang, V.W. Krüppel-like factor 5 mediates cellular transformation during oncogenic KRAS-induced intestinal tumorigenesis. Gastroenterology 2008, 134, 120–130. [Google Scholar] [CrossRef]
Animals 09 00874 g001 550
Figure 1. A region of DNA with a high G_C content (greater than 50%) and observed CpG_expected CpG ratio of greater or equal to 0.6 (CpG islands) predicted in the bone morphogenetic protein 7 (BMP7) promoter. Note that the site of “1 bp” means the initiation codon (ATG). The −2000 bp indicator means 2000 bp in the upstream region of the transcription start site, and the 500 bp indicator means 500 bp in the downstream region of the transcription start site.
Figure 1. A region of DNA with a high G_C content (greater than 50%) and observed CpG_expected CpG ratio of greater or equal to 0.6 (CpG islands) predicted in the bone morphogenetic protein 7 (BMP7) promoter. Note that the site of “1 bp” means the initiation codon (ATG). The −2000 bp indicator means 2000 bp in the upstream region of the transcription start site, and the 500 bp indicator means 500 bp in the downstream region of the transcription start site.
Animals 09 00874 g001
Animals 09 00874 g002 550
Figure 2. Relative luciferase activity of the Hu sheep BMP7 promoter with different lengths. Note that the basic was the pGL3-Base vector. For B1, the target fragment (−1500 bp to +257 bp) was ligated to the pGL3-Base vector; for B2, the target fragment (−985 bp to +29 bp) was ligated to the pGL3-Base vector; for B3, the target fragment (−758 bp to +29 bp) was ligated to the pGL3-Base vector; and for B4, the target fragment (−545 bp to +29 bp) was ligated to the pGL3-Base vector. The basic was the blank control group and B1 was the normal control group. The marker “*” represents a significant difference (p < 0.05), while “**” represents a highly significant difference (p < 0.01).
Figure 2. Relative luciferase activity of the Hu sheep BMP7 promoter with different lengths. Note that the basic was the pGL3-Base vector. For B1, the target fragment (−1500 bp to +257 bp) was ligated to the pGL3-Base vector; for B2, the target fragment (−985 bp to +29 bp) was ligated to the pGL3-Base vector; for B3, the target fragment (−758 bp to +29 bp) was ligated to the pGL3-Base vector; and for B4, the target fragment (−545 bp to +29 bp) was ligated to the pGL3-Base vector. The basic was the blank control group and B1 was the normal control group. The marker “*” represents a significant difference (p < 0.05), while “**” represents a highly significant difference (p < 0.01).
Animals 09 00874 g002
Animals 09 00874 g003 550
Figure 3. Activity analysis of the −758 bp to −545 bp region of the Hu sheep BMP7 promoter. Note that for B5, the target fragment (−758 bp to −545 bp) was ligated to the pGL3-Base vector; B3 was the normal control group. The marker “**” represents a highly significant difference (p < 0.01).
Figure 3. Activity analysis of the −758 bp to −545 bp region of the Hu sheep BMP7 promoter. Note that for B5, the target fragment (−758 bp to −545 bp) was ligated to the pGL3-Base vector; B3 was the normal control group. The marker “**” represents a highly significant difference (p < 0.01).
Animals 09 00874 g003
Animals 09 00874 g004 550
Figure 4. BMP7 promoter sequence (−758 to −545 bp) phylogenetic tree of eight species.
Figure 4. BMP7 promoter sequence (−758 to −545 bp) phylogenetic tree of eight species.
Animals 09 00874 g004
Animals 09 00874 g005 550
Figure 5. Point mutation analysis of EGR1 and SP1. Note that the binding sites of EGR1 and SP1 were in the B5 fragment. SP1: the SP1 mutation. EGR1: the EGR1 mutation. The marker “**” represents a highly significant difference (p < 0.01).
Figure 5. Point mutation analysis of EGR1 and SP1. Note that the binding sites of EGR1 and SP1 were in the B5 fragment. SP1: the SP1 mutation. EGR1: the EGR1 mutation. The marker “**” represents a highly significant difference (p < 0.01).
Animals 09 00874 g005
Animals 09 00874 g006 550
Figure 6. Relative activity analysis of EGR1. Note that for pcDNA-3.1-EGR1 and B5, the EGR1 overexpression vector was co-transfected with the B5 fragment; for pcDNA-3.1-Basic and B5, the pcDNA-3.1 vector was co-transfected with the B5 fragment. The group of pcDNA-3.1-Basic and B5 was the control group. The marker “**” represents a highly significant difference (p < 0.01).
Figure 6. Relative activity analysis of EGR1. Note that for pcDNA-3.1-EGR1 and B5, the EGR1 overexpression vector was co-transfected with the B5 fragment; for pcDNA-3.1-Basic and B5, the pcDNA-3.1 vector was co-transfected with the B5 fragment. The group of pcDNA-3.1-Basic and B5 was the control group. The marker “**” represents a highly significant difference (p < 0.01).
Animals 09 00874 g006
Animals 09 00874 g007 550
Figure 7. Schematic diagram of the BMP7 promoter structure of from Hu sheep.
Figure 7. Schematic diagram of the BMP7 promoter structure of from Hu sheep.
Animals 09 00874 g007
Table
Table 1. Primers for deletion plasmids construction from the Hu sheep BMP7 promoter.
Table 1. Primers for deletion plasmids construction from the Hu sheep BMP7 promoter.
NameSequence (5′–3′)Product Length/bp
B1F: GGGGTACCCCAAGTGGGCAACTCAGTGTC1757
R: CCAAGCTTGTACAGGTCCAGCATGAACATGG
B2F: GGGGTACCCAGTACAAAGGCAAACTGGCAACA1014
B3F: GGGGTACCCGCTCGTATTCCCCTCTCCGCATC787
B4F: GGGGTACCCCCAGGCCCCAGCGCGTACCA574
R: CCAAGCTTCCAGAGCGCCACGAAGCTGT
B5F: GGGGTACCCGAGTCCGGAGAAGGCAGG214
R: CCAAGCTTGCTGGGGCCTGGGAGGAGGA
Note that the underline represents enzyme sites. B2, B3, and B4 have the same reverse primer.
Table
Table 2. Site-directed mutation primers of the Hu sheep BMP7 promoter.
Table 2. Site-directed mutation primers of the Hu sheep BMP7 promoter.
NamePrimer Sequence (5′–3′)Length/bp
BTF1GCCCTTGGAAAGGCCGTCCTCTTCTCCCTCCTCCTCCCAG214
BTR1CTGGGAGGAGGAGGGAGAAGAGGACGGCCTTTCCAAGGGC
BTF2AGGCCGTCCTCCTCCCCCGCCGCCGCCCAGGCCCCAGC214
BTR2GCTGGGGCCTGGGCGGCGGCGGGGGAGGAGGACGGCCT
Note that the underline means mutation sites.
Table
Table 3. Transcription factor binding sites predicted in the region from −758 bp to −545 bp of BMP7 promoter.
Table 3. Transcription factor binding sites predicted in the region from −758 bp to −545 bp of BMP7 promoter.
RegionTranscription Factor Start SiteSequence
−758 bp to −545 bpFOXB1−675 (1)TCAGTAAATAT
FOXC1−675 (1)TCAGTAAATAT
FOXC2−675 (1)TCAGTAAATATT
FOXD2−672 (1)GTAAATA
FOXI1−672 (1)GTAAATA
FOXL1−672 (1)GTAAATA
FOXO4−672 (1)GTAAATA
Klf4−612 (1)AGGGCGGGGC
NRF1−552 (1)CCGCGGGCGCG
EGR1−552 (1)CCTCCTCCCCCTCC
KLF5−552 (1)CCTCCTCCCC
SP1−552 (1)CCTCCTCCCCC
EGR1−546 (1)CCCCCTCCTCCTCC
SP1−546 (1)CCCCCTCCTCC
SP2−546 (1)CCCCCTCCTCCTCCC
SP1−546 (1)CCTCCTCCTCC
Note that this table shows the cis elements appearing in JASPAR programs. The score was more than 10 and the relative score was more than 0.9.

Share and Cite

MDPI and ACS Style

Lv, X.; Sun, W.; Zou, S.; Chen, L.; Mwacharo, J.M.; Wang, J. Characteristics of the BMP7 Promoter in Hu Sheep. Animals 2019, 9, 874. https://doi.org/10.3390/ani9110874

AMA Style

Lv X, Sun W, Zou S, Chen L, Mwacharo JM, Wang J. Characteristics of the BMP7 Promoter in Hu Sheep. Animals. 2019; 9(11):874. https://doi.org/10.3390/ani9110874

Chicago/Turabian Style

Lv, Xiaoyang, Wei Sun, Shuangxia Zou, Ling Chen, Joram M. Mwacharo, and Jinyu Wang. 2019. "Characteristics of the BMP7 Promoter in Hu Sheep" Animals 9, no. 11: 874. https://doi.org/10.3390/ani9110874

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop