Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Method
2.1. Chemicals and Reagents
2.2. Cell Culture
2.3. Experimental Design and Treatment
2.4. Quantitative Real-Time PCR
2.5. Western Blot Analysis
2.6. Immunofluorescence Staining
2.7. Flow Cytometry (FCM)
2.8. Statistical Analysis
3. Results
3.1. Identification of BMECs
3.2. Chemerin Promotes Autophagy and Induces Apoptosis in BMECs
3.3. CQ Has an Inhibitory Effect on Autophagy Induced by Chemerin
3.4. Inhibition of Autophagy Enhances Chemerin-Induced Apoptosis in BMECs
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Walker, N.I.; Bennett, R.E.; Kerr, J.F. Cell death by apoptosis during involution of the lactating breast in mice and rats. Am. J. Anat. 1989, 185, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Warri, A.; Cook, K.L.; Hu, R.; Jin, L.; Zwart, A.; Soto-Pantoja, D.R.; Liu, J.; Finkel, T.; Clarke, R. Autophagy and unfolded protein response (UPR) regulate mammary gland involution by restraining apoptosis-driven irreversible changes. Cell Death Discov. 2018, 4, 40. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.; Kim, W.; Hens, J.; Dann, P.; Schedin, P.; Friedman, P.A.; Wysolmerski, J.J. NHERF1 Is Required for Localization of PMCA2 and Suppression of Early Involution in the Female Lactating Mammary Gland. Endocrinology 2019, 160, 1797–1810. [Google Scholar] [CrossRef] [PubMed]
- Sobolewska, A.; Gajewska, M.; Zarzynska, J.; Gajkowska, B.; Motyl, T. IGF-I, EGF, and sex steroids regulate autophagy in bovine mammary epithelial cells via the mTOR pathway. Eur. J. Cell Biol. 2009, 88, 117–130. [Google Scholar] [CrossRef]
- Yonezawa, T.; Yonekura, S.; Kobayashi, Y.; Hagino, A.; Katoh, K.; Obara, Y. Effects of long-chain fatty acids on cytosolic triacylglycerol accumulation and lipid droplet formation in primary cultured bovine mammary epithelial cells. J. Dairy Sci. 2004, 87, 2527–2534. [Google Scholar] [CrossRef]
- Shi, H.; Wang, L.; Luo, J.; Liu, J.; Loor, J.J.; Liu, H. Fatty Acid Elongase 7 (ELOVL7) Plays a Role in the Synthesis of Long-Chain Unsaturated Fatty Acids in Goat Mammary Epithelial Cells. Animals (Basel) 2019, 9, 389. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, L.; Gao, J.; Wen, L. Pro-Death or Pro-Survival: Contrasting Paradigms on Nanomaterial-Induced Autophagy and Exploitations for Cancer Therapy. Acc. Chem. Res. 2019. [Google Scholar] [CrossRef]
- Chiu, C.C.; Yeh, T.H.; Chen, R.S.; Chen, H.C.; Huang, Y.Z.; Weng, Y.H.; Cheng, Y.C.; Liu, Y.C.; Cheng, A.J.; Lu, Y.C.; et al. Upregulated Expression of MicroRNA-204-5p Leads to the Death of Dopaminergic Cells by Targeting DYRK1A-Mediated Apoptotic Signaling Cascade. Front. Cell. Neurosci. 2019, 13, 399. [Google Scholar] [CrossRef] [Green Version]
- Mizushima, N.; Yoshimori, T. How to interpret LC3 immunoblotting. Autophagy 2007, 3, 542–545. [Google Scholar] [CrossRef]
- Lee, H.M.; Shin, D.M.; Yuk, J.M.; Shi, G.; Choi, D.K.; Lee, S.H.; Huang, S.M.; Kim, J.M.; Kim, C.D.; Lee, J.H.; et al. Autophagy negatively regulates keratinocyte inflammatory responses via scaffolding protein p62/SQSTM1. J. Immunol. 2011, 186, 1248–1258. [Google Scholar] [CrossRef]
- Motyl, T.; Gajewska, M.; Zarzynska, J.; Sobolewska, A.; Gajkowska, B. Regulation of autophagy in bovine mammary epithelial cells. Autophagy 2007, 3, 484–486. [Google Scholar] [CrossRef] [PubMed]
- Dutta, D.; Xu, J.; Kim, J.S.; Dunn, W.A., Jr.; Leeuwenburgh, C. Upregulated autophagy protects cardiomyocytes from oxidative stress-induced toxicity. Autophagy 2013, 9, 328–344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mizushima, N.; Komatsu, M. Autophagy: Renovation of cells and tissues. Cell 2011, 147, 728–741. [Google Scholar] [CrossRef] [PubMed]
- Shacka, J.J.; Klocke, B.J.; Roth, K.A. Autophagy, bafilomycin and cell death: The “a-B-cs” of plecomacrolide-induced neuroprotection. Autophagy 2006, 2, 228–230. [Google Scholar] [CrossRef] [PubMed]
- Goralski, K.B.; McCarthy, T.C.; Hanniman, E.A.; Zabel, B.A.; Butcher, E.C.; Parlee, S.D.; Muruganandan, S.; Sinal, C.J. Chemerin, a novel adipokine that regulates adipogenesis and adipocyte metabolism. J. Biol. Chem. 2007, 282, 28175–28188. [Google Scholar] [CrossRef] [PubMed]
- Brunetti, L.; Orlando, G.; Ferrante, C.; Recinella, L.; Leone, S.; Chiavaroli, A.; Di Nisio, C.; Shohreh, R.; Manippa, F.; Ricciuti, A.; et al. Peripheral chemerin administration modulates hypothalamic control of feeding. Peptides 2014, 51, 115–121. [Google Scholar] [CrossRef]
- Wong, C.K.; Zhang, J.P.; Ip, W.K.; Lam, C.W. Activation of p38 mitogen-activated protein kinase and nuclear factor-kappaB in tumour necrosis factor-induced eotaxin release of human eosinophils. Clin. Exp. Immunol. 2002, 128, 483–489. [Google Scholar] [CrossRef]
- Pensa, S.; Lloyd-Lewis, B.; Sargeant, T.J.; Resemann, H.K.; Kahn, C.R.; Watson, C.J. Signal transducer and activator of transcription 3 and the phosphatidylinositol 3-kinase regulatory subunits p55alpha and p50alpha regulate autophagy in vivo. FEBS J. 2014, 281, 4557–4567. [Google Scholar] [CrossRef]
- Jovanovic-Tucovic, M.; Harhaji-Trajkovic, L.; Dulovic, M.; Tovilovic-Kovacevic, G.; Zogovic, N.; Jeremic, M.; Mandic, M.; Kostic, V.; Trajkovic, V.; Markovic, I. AMP-activated protein kinase inhibits MPP+-induced oxidative stress and apoptotic death of SH-SY5Y cells through sequential stimulation of Akt and autophagy. Eur. J. Pharmacol. 2019, 863, 172677. [Google Scholar] [CrossRef]
- Suzuki, Y.; Haga, S.; Katoh, D.; So, K.H.; Choi, K.C.; Jung, U.S.; Lee, H.G.; Katoh, K.; Roh, S.G. Chemerin is a novel regulator of lactogenesis in bovine mammary epithelial cells. Biochem. Biophys. Res. Commun. 2015, 466, 283–288. [Google Scholar] [CrossRef]
- Xie, Q.; Deng, Y.; Huang, C.; Liu, P.; Yang, Y.; Shen, W.; Gao, P. Chemerin-induced mitochondrial dysfunction in skeletal muscle. J. Cell. Mol. Med. 2015, 19, 986–995. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Chang, Y.; Ye, N.; Dai, D.; Chen, Y.; Zhang, N.; Sun, G.; Sun, Y. Advanced Glycation End Products Inhibit the Proliferation of Human Umbilical Vein Endothelial Cells by Inhibiting Cathepsin D. Int. J. Mol. Sci. 2017, 18, 436. [Google Scholar] [CrossRef] [PubMed]
- Thangarajan, S.; Vedagiri, A.; Somasundaram, S.; Sakthimanogaran, R.; Murugesan, M. Neuroprotective effect of morin on lead acetate- induced apoptosis by preventing cytochrome c translocation via regulation of Bax/Bcl-2 ratio. Neurotox. Teratol. 2018, 66, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Coelho, D.; Holl, V.; Weltin, D.; Lacornerie, T.; Magnenet, P.; Dufour, P.; Bischoff, P. Caspase-3-like activity determines the type of cell death following ionizing radiation in MOLT-4 human leukaemia cells. Br. J. Cancer 2000, 83, 642–649. [Google Scholar] [CrossRef] [PubMed]
- Shu, B.; Zhang, J.; Jiang, Z.; Cui, G.; Veeran, S.; Zhong, G. Harmine induced apoptosis in Spodoptera frugiperda Sf9 cells by activating the endogenous apoptotic pathways and inhibiting DNA topoisomerase I activity. Pestic. Biochem. Physiol. 2019, 155, 26–35. [Google Scholar] [CrossRef]
- Marino, G.; Niso-Santano, M.; Baehrecke, E.H.; Kroemer, G. Self-consumption: the interplay of autophagy and apoptosis. Nat. Rev. Mol. Cell Biol. 2014, 15, 81–94. [Google Scholar] [CrossRef] [Green Version]
- Jiao, G.; Ren, T.; Guo, W.; Ren, C.; Yang, K. Arsenic trioxide inhibits growth of human chondrosarcoma cells through G2/M arrest and apoptosis as well as autophagy. Tumour Biol. 2015, 36, 3969–3977. [Google Scholar] [CrossRef]
- Liu, D.; Yang, Y.; Liu, Q.; Wang, J. Inhibition of autophagy by 3-MA potentiates cisplatin-induced apoptosis in esophageal squamous cell carcinoma cells. Med. Oncol. 2011, 28, 105–111. [Google Scholar] [CrossRef]
- Sui, X.; Chen, R.; Wang, Z.; Huang, Z.; Kong, N.; Zhang, M.; Han, W.; Lou, F.; Yang, J.; Zhang, Q.; et al. Autophagy and chemotherapy resistance: A promising therapeutic target for cancer treatment. Cell Death Dis. 2013, 4, e838. [Google Scholar] [CrossRef]
- Mauthe, M.; Orhon, I.; Rocchi, C.; Zhou, X.; Luhr, M.; Hijlkema, K.J.; Coppes, R.P.; Engedal, N.; Mari, M.; Reggiori, F. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018, 14, 1435–1455. [Google Scholar] [CrossRef]
- Singh, K.; Sharma, A.; Mir, M.C.; Drazba, J.A.; Heston, W.D.; Magi-Galluzzi, C.; Hansel, D.; Rubin, B.P.; Klein, E.A.; Almasan, A. Autophagic flux determines cell death and survival in response to Apo2L/TRAIL (dulanermin). Mol. Cancer 2014, 13, 70. [Google Scholar] [CrossRef] [PubMed]
- Cai, N.; Zhao, X.; Jing, Y.; Sun, K.; Jiao, S.; Chen, X.; Yang, H.; Zhou, Y.; Wei, L. Autophagy protects against palmitate-induced apoptosis in hepatocytes. Cell Biosci. 2014, 4, 28. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
p62 | ATTGAGCCAGCTCAGGCTGT | CTGGCTGGAAGTCAGGCTGT |
Bax | CCAGCAAACTGGTGCTCAAGG | AGCCGCTCTCGAAGGAAGTC |
Bcl-2 | AGCATCGCCCTGTGGATGAC | CAGCCTCCGTTGTCCTGGAT |
GAPDH | AAGGTCGGAGTGAACR | CGTTCTCTGCCTTGACTGTG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, B.; Song, W.; Tang, Y.; Shi, M.; Li, H.; Yu, D. Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells. Animals 2019, 9, 848. https://doi.org/10.3390/ani9100848
Hu B, Song W, Tang Y, Shi M, Li H, Yu D. Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells. Animals. 2019; 9(10):848. https://doi.org/10.3390/ani9100848
Chicago/Turabian StyleHu, Bianhong, Wenjuan Song, Yujie Tang, Mingyan Shi, Huixia Li, and Debing Yu. 2019. "Induction of Chemerin on Autophagy and Apoptosis in Dairy Cow Mammary Epithelial Cells" Animals 9, no. 10: 848. https://doi.org/10.3390/ani9100848