Tea Saponin Exerts Dose-Dependent Dual Effects on Growth and Hepatic Health in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) Fed a High-Lipid, Low-Protein Diet via Redox-Immune Regulation
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Diets
2.3. Fish and Feeding Trial
2.4. Sampling
2.5. Analysis of Basic Dietary Components
2.6. Histological Analysis of Liver
2.7. Analysis of Immunological and Biochemical Parameters in Liver Samples
2.8. Liver RNA Extraction and Quantitative Real-Time PCR
2.9. Transcriptome Sequencing and Analysis
2.10. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Histomorphology of the Liver
3.3. Antioxidant Capacity and Cellular Stress Response
3.4. Immune Parameters and Inflammatory Cytokine Expression
3.5. Hepatic Transcriptome Analysis
3.5.1. Sequencing Quality Assessment and Reference Genome Mapping
3.5.2. Principal Component Analysis and Differential Expression Statistics
3.5.3. GO Annotation and Functional Classification
3.5.4. KEGG Annotation Classification and Enrichment Analysis
3.5.5. Gene Expression Trend Analysis and Screening of Immune-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hemre, G.-I.; Mommsen, T.P.; Krogdahl, Å. Carbohydrates in Fish Nutrition: Effects on Growth, Glucose Metabolism and Hepatic Enzymes. Aquacult. Nutr. 2002, 8, 175–194. [Google Scholar] [CrossRef] [Scilit]
- Kamalam, B.S.; Medale, F.; Panserat, S. Utilisation of Dietary Carbohydrates in Farmed Fishes: New Insights on Influencing Factors, Biological Limitations and Future Strategies. Aquaculture 2017, 467, 3–27. [Google Scholar] [CrossRef] [Scilit]
- He, C.; Jia, X.; Zhang, L.; Gao, F.; Jiang, W.; Wen, C.; Chi, C.; Li, X.; Jiang, G.; Mi, H.; et al. Dietary Berberine Can Ameliorate Glucose Metabolism Disorder of Megalobrama amblycephala Exposed to a High-Carbohydrate Diet. Fish Physiol. Biochem. 2021, 47, 499–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.; Wang, A.; Li, Z.; Zhang, J.; Sang, C.; Chen, N. Antioxidant Defenses and Non-Specific Immunity at Enzymatic and Transcriptional Levels in Response to Dietary Carbohydrate in a Typical Carnivorous Fish, Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂). Fish Shellfish Immunol. 2020, 100, 109–116. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Liao, L.; Tang, X.; Liang, J.; Liu, Q.; Luo, W.; Adam, A.A.; Luo, J.; Li, Z.; Yang, S.; et al. High-Carbohydrate Diet Altered Conversion of Metabolites, and Deteriorated Health in Juvenile Largemouth Bass. Aquaculture 2022, 549, 737816. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Li, Z.; Chen, N.; Jin, P.; Zhang, J. Dietary Lipid and Carbohydrate Interactions: Implications on Growth Performance, Feed Utilization and Non-Specific Immunity in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂). Aquaculture 2019, 498, 568–577. [Google Scholar] [CrossRef] [Scilit]
- Tocher, D.R. Metabolism and Functions of Lipids and Fatty Acids in Teleost Fish. Rev. Fish. Sci. 2003, 11, 107–184. [Google Scholar] [CrossRef] [Scilit]
- Jump, D.B. The Biochemistry of N-3 Polyunsaturated Fatty Acids. J. Biol. Chem. 2002, 277, 8755–8758. [Google Scholar] [CrossRef] [Scilit]
- Welengane, E.; Sado, R.Y.; Bicudo, Á.J.D.A. Protein-sparing Effect by Dietary Lipid Increase in Juveniles of the Hybrid Fish Tambatinga (♀ Colossoma macropomum × ♂ Piaractus brachypomus). Aquacult. Nutr. 2019, 25, 1272–1280. [Google Scholar] [CrossRef] [Scilit]
- Luo, G.; Xu, J.; Teng, Y.; Ding, C.; Yan, B. Effects of Dietary Lipid Levels on the Growth, Digestive Enzyme, Feed Utilization and Fatty Acid Composition of Japanese Sea Bass (Lateolabrax japonicus L.) Reared in Freshwater. Aquacult. Res. 2010, 41, 210–219. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.-F.; Cao, K.-L.; Huang, H.-F.; Li, X.-Q.; Leng, X.-J. Dietary Effects of Lipid and Protein Levels on Growth, Feed Utilization, Lipid Metabolism, and Antioxidant Capacity of Triploid Rainbow Trout (Oncorhynchus mykiss). Aquacult. Nutr. 2023, 2023, 8325440. [Google Scholar] [CrossRef] [Scilit]
- Liao, Z.; Liu, Y.; Wei, H.; He, X.; Wang, Z.; Zhuang, Z.; Zhao, W.; Masagounder, K.; He, J.; Niu, J. Effects of Dietary Supplementation of Bacillus Subtilis DSM 32315 on Growth, Immune Response and Acute Ammonia Stress Tolerance of Nile Tilapia (Oreochromis niloticus) Fed with High or Low Protein Diets. Anim. Nutr. 2023, 15, 375–385. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.; Du, Y.; De Cruz, C.; Zhao, J.; Shao, X.; Xu, Q. Effects of Supplementation with Crystalline or Coated Methionine and Lysine in Low Protein Diet on Growth Performance, Intestinal Health and Muscle Quality of Gibel Carp, Carassius auratus gibelio. Aquac. Rep. 2024, 36, 102084. [Google Scholar] [CrossRef] [Scilit]
- Yi, X.; Zhang, F.; Xu, W.; Li, J.; Zhang, W.; Mai, K. Effects of Dietary Lipid Content on Growth, Body Composition and Pigmentation of Large Yellow Croaker Larimichthys croceus. Aquaculture 2014, 434, 355–361. [Google Scholar] [CrossRef] [Scilit]
- Martins, D.A.; Valente, L.M.P.; Lall, S.P. Effects of Dietary Lipid Level on Growth and Lipid Utilization by Juvenile Atlantic Halibut (Hippoglossus hippoglossus, L.). Aquaculture 2007, 263, 150–158. [Google Scholar] [CrossRef] [Scilit]
- López, L.M.; Durazo, E.; Viana, M.T.; Drawbridge, M.; Bureau, D.P. Effect of Dietary Lipid Levels on Performance, Body Composition and Fatty Acid Profile of Juvenile White Seabass, Atractoscion nobilis. Aquaculture 2009, 289, 101–105. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.-L.; Zhou, Y.-L.; Zhao, H.; Chen, W.-Y.; Chen, Y.-J.; Lin, S.-M. Effect of Dietary Lipid Level on Growth, Lipid Metabolism and Oxidative Status of Largemouth Bass, Micropterus salmoides. Aquaculture 2019, 506, 394–400. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Han, S.-L.; Li, L.-Y.; Lu, D.-L.; Mchele Limbu, S.; Li, D.-L.; Zhang, M.-L.; Du, Z.-Y. Lipophagy Is Essential for Lipid Metabolism in Fish. Sci. Bull. 2018, 63, 879–882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, H.; Wang, B.; Li, Q.-L.; Zhao, T.; Xu, P.-C.; Song, Y.-F.; Luo, Z. Dietary Lecithin Attenuates Adverse Effects of High Fat Diet on Growth Performance, Lipid Metabolism, Endoplasmic Reticulum Stress and Antioxidant Capacity in the Intestine of Largemouth Bass (Micropterus salmoides). Aquaculture 2025, 595, 741688. [Google Scholar] [CrossRef] [Scilit]
- Jia, R.; Cao, L.-P.; Du, J.-L.; He, Q.; Gu, Z.-Y.; Jeney, G.; Xu, P.; Yin, G.-J. Effects of High-Fat Diet on Antioxidative Status, Apoptosis and Inflammation in Liver of Tilapia (Oreochromis niloticus) via Nrf2, TLRs and JNK Pathways. Fish Shellfish Immunol. 2020, 104, 391–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.-L.; Wang, B.; Zheng, H.; Wu, L.-X.; Xu, P.-C.; Tan, X.-Y. The Effects of Phospholipids (PL) Addition in the High Fat Diet on Growth Performance, Oxidative Stress, Lipid and Protein Metabolism, and Muscle Development in Yellow catfish Pelteobagrus fulvidraco. Aquaculture 2025, 598, 741947. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Wang, F.; Hu, C.; Lai, J.; Xie, S.; Yu, K.; Jiang, F. Dietary High Lipid and High Plant-Protein Affected Growth Performance, Liver Health, Bile Acid Metabolism and Gut Microbiota in Groupers. Anim. Nutr. 2024, 19, 370–385. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Yang, Y.; Feng, J.; Tang, Y.; Yang, P.; Lou, F. Effects of Dietary Lipid Levels on Antioxidant Capacity, Inflammatory Response and Endoplasmic Reticulum Stress in Immune Organ of Turbot (Scophthalmus maximus L.). Aquacult. Rep. 2024, 39, 102434. [Google Scholar] [CrossRef] [Scilit]
- El-Dakar, A.Y.; Shalaby, S.M.; Salama, A.N.; Sabra, A.-R.A.; Younis, E.M.; Abdelwarith, A.A.; Davies, S.J.; Rahman, A.N.A.; Abdel-Aziz, M.F. Effects of Dietary β-Mannanase (Hemicell®) and Lavandula angustifolia on Oreochromis niloticus Fed a Low Level of Dietary Protein: Growth, Digestive Enzymes, and Hemato-Biochemical Indices. Aquacult. Rep. 2023, 30, 101604. [Google Scholar] [CrossRef] [Scilit]
- Zhu, H.; Qiang, J.; Tao, Y.; Ngoepe, T.K.; Bao, J.; Chen, D.; Xu, P. Physiological and Gut Microbiome Changes Associated with Low Dietary Protein Level in Genetically Improved Farmed Tilapia (GIFT, Oreochromis niloticus) Determined by 16S rRNA Sequence Analysis. Microbiol. Open 2020, 9, e1000. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, X.; Zhao, Z.; Yan, X.; Xie, J.; Yu, Q.; Chen, Y. Extraction Optimization of Tea Saponins from Camellia oleifera Seed Meal with Deep Eutectic Solvents: Composition Identification and Properties Evaluation. Food Chem. 2023, 427, 136681. [Google Scholar] [CrossRef] [Scilit]
- Chaicharoenpong, C.; Petsom, A. Use of Tea (Camellia oleifera Abel.) Seeds in Human Health. In Nuts and Seeds in Health and Disease Prevention; Elsevier: Amsterdam, The Netherlands, 2011; pp. 1115–1122. [Google Scholar]
- Chen, S.; Kang, J.; Zhu, H.; Han, Z.; Wang, L.; Wang, K.; Liu, J.; Wu, Y.; He, P.; Tu, Y.; et al. Tea Seed Saponins Ameliorate Cyclophosphamide-Induced Intestinal Injury, Immune Disorder and Gut Microbial Dysbiosis in Mice. Food Biosci. 2024, 57, 103504. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Tu, Y.; Zhao, S.P.; Hao, Y.H.; Liu, J.X.; Liu, F.H.; Xiong, B.H.; Jiang, L.S. Effect of Tea Saponins on Milk Performance, Milk Fatty Acids, and Immune Function in Dairy Cow. J. Dairy Sci. 2017, 100, 8043–8052. [Google Scholar] [CrossRef] [Scilit]
- Chi, X.; Bi, S.; Xu, W.; Zhang, Y.; Liang, S.; Hu, S. Oral Administration of Tea Saponins to Relive Oxidative Stress and Immune Suppression in Chickens. Poult. Sci. 2017, 96, 3058–3067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geng, L.; Lin, C.; Pan, G.; Yang, Y.; Wang, L.; Huang, S.; Zhou, Z.; Yin, H.; Wu, X. Dietary Spermine Supplementation Enhances Growth, Protein Synthesis, and Antioxidant Capacity in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Aquaculture 2025, 602, 742360. [Google Scholar] [CrossRef] [Scilit]
- Suo, X.; Yan, X.; Tan, B.; Pan, S.; Li, T.; Liu, H.; Huang, W.; Zhang, S.; Yang, Y.; Dong, X. Frontiers|Lipid Metabolism Disorders of Hybrid Grouper (♀ Epinephelus fuscointestinestatus × ♂ E. lanceolatu) Induced by High-Lipid Diet. Front. Mar. Sci. 2022, 9, 990193. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.; Liu, H.; Yang, S.; Zhou, M.; Zhang, S.; Tan, B.; Yang, Y.; Zhang, H.; Xie, R.; Dong, X. Effects of High-Lipid Dietary Protein Ratio on Growth, Antioxidant Parameters, Histological Structure, and Expression of Antioxidant- and Immune-Related Genes of Hybrid Grouper. Animals 2023, 13, 3710. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Liang, N.; Wang, S.; Chen, T.; Feng, Y.; Zhou, Y.; Zhang, D.; Wu, Y.; Cai, Y. Effects of Mannan-Oligosaccharides on Growth Performance, Hepatic and Intestinal Morphological Structure, Lipid Accumulation, and Lipid Metabolism in Hybrid Groupers (Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀) under Short-Term High-Fat Stress. Aquacult. Int. 2025, 33, 484–508. [Google Scholar] [CrossRef] [Scilit]
- Huang, Z.; Ye, Y.; Xu, A.; Li, Z. Effects of Astragalus membranaceus Polysaccharides on Growth Performance, Physiological and Biochemical Parameters, and Expression of Genes Related to Lipid Metabolism of Spotted Sea Bass, Lateolabrax maculatus. Aquacult. Nutr. 2023, 2023, 6191330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, F.; Chen, Z.; Huang, Y.; Lin, L.; Qin, Z. Hepatoprotective Effects of Oligochitosan on Hybrid Groupers (Epinephelus lanceolatu ♂ × Epinephelus fuscoguttatus ♀) against Vibrio Harvey Infection via Suppressing Apoptosis-Related Pathways. Aquacult. Int. 2024, 32, 5833–5849. [Google Scholar] [CrossRef] [Scilit]
- Aoac International. Official Methods of Analysis of AOAC INTERNATIONAL, 21st ed.; AOAC International: Rockville, MD, USA, 2019. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Yin, Z. Application of Detoxified Camellia oleifera Meal Feed in Tilapia Culture. Feed. Ind. 2007, 28, 31–34. [Google Scholar]
- Li, H.; Yin, Z.; Li, Q.; Deng, G. Application of Camellia oleifera Meal Feed in the Cultivation of Gibel Carp (Carassius auratus gibelio). Feed. Ind. 2005, 26, 23–25. [Google Scholar]
- Fan, Z.; Wang, L.; Li, J.; Wu, D.; Li, C.; Zheng, X.; Zhang, H.; Miao, L.; Ge, X. Momordica charantia Saponins Administration in Low-Protein-High-Carbohydrate Diet Improves Growth, Blood Biochemical, Intestinal Health and Microflora Composition of Juvenile Common Carp (Cyprinus carpio). Fish Shellfish Immunol. 2023, 140, 108980. [Google Scholar] [CrossRef] [Scilit]
- Francis, G.; Makkar, H.P.S.; Becker, K. Effects of Quillaja Saponins on Growth, Metabolism, Egg Production and Muscle Cholesterol in Individually Reared Nile Tilapia (Oreochromis niloticus). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2001, 129, 105–114. [Google Scholar] [CrossRef] [Scilit]
- Gu, M.; Jia, Q.; Zhang, Z.; Bai, N.; Xu, X.; Xu, B. Soya-Saponins Induce Intestinal Inflammation and Barrier Dysfunction in Juvenile Turbot (Scophthalmus maximus). Fish Shellfish Immunol. 2018, 77, 264–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Ai, Q.; Mai, K.; Xu, W.; Liufu, Z.; Zhang, W.; Cai, Y. Effects of Dietary Soybean Saponins on Feed Intake, Growth Performance, Digestibility and Intestinal Structure in Juvenile Japanese Flounder (Paralichthys olivaceus). Aquaculture 2011, 318, 95–100. [Google Scholar] [CrossRef] [Scilit]
- Krogdahl, Å.; Bakke-McKellep, A.M.; Baeverfjord, G. Effects of Graded Levels of Standard Soybean Meal on Intestinal Structure, Mucosal Enzyme Activities, and Pancreatic Response in Atlantic Salmon (Salmo salar L.): Dose-Dependent Response to Dietary SBM in Salmon. Aquacult. Nutr. 2003, 9, 361–371. [Google Scholar] [CrossRef] [Scilit]
- Cai, W.; Huang, W.; Fu, G.; Song, H.; Liu, H.; Zhou, M.; Li, B.; Lu, B.; Liu, Y.; Tan, B.; et al. Effects of Dietary Protein Levels on Lipid Metabolism and Intestinal Health of Hybrid Grouper (♀ Epinephelus fuscoguttatus × ♂ Epinephelus lanceolatus) Fed High-Lipid Diets. Aquacult. Rep. 2025, 45, 103233. [Google Scholar] [CrossRef] [Scilit]
- Shen, Y.; Li, X.; Bao, Y.; Zhu, T.; Wu, Z.; Yang, B.; Jiao, L.; Zhou, Q.; Jin, M. Lipid Metabolic Disorders and Physiological Stress Caused by a High-Fat Diet Have Lipid Source-Dependent Effects in Juvenile Black Seabream Acanthopagrus schlegelii. Fish Physiol. Biochem. 2022, 48, 955–971. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.-Q.; Jiang, W.-D.; Wu, P.; Liu, Y.; Ren, H.-M.; Tang, L.; Li, S.-W.; Zhong, C.-B.; Zhang, R.-N.; Feng, L.; et al. Improvement of Flesh Quality, Muscle Growth and Protein Deposition in Adult Grass Carp (Ctenopharyngodon idella): The Role of Tryptophan. Aquaculture 2023, 577, 740005. [Google Scholar] [CrossRef] [Scilit]
- Zeng, X.; Zhou, X.-Q.; Jiang, W.-D.; Wu, P.; Liu, Y.; Ma, Y.-B.; Tang, L.; Li, S.-W.; Kuang, S.-Y.; Feng, L. Histidine Is Effective in Promoting Muscle Growth and Protein Deposition: In Vivo and in Vitro Experimental Models of Grass Carp (Ctenopharyngodon idella). Food Biosci. 2024, 62, 105537. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Wu, P.; Jiang, W.-D.; Liu, Y.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; Zhang, Y.-A.; Zhou, X.-Q.; et al. Optimal Dietary Protein Level Improved Growth, Disease Resistance, Intestinal Immune and Physical Barrier Function of Young Grass Carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2016, 55, 64–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, G.; Ma, L.; Yan, Z.; Zhu, Q.; Cai, J.; Wang, S.; Yuan, Y.; Chen, Y.; Deng, S. Extraction of Oils and Phytochemicals from Camellia oleifera Seeds: Trends, Challenges, and Innovations. Processes 2022, 10, 1489. [Google Scholar] [CrossRef] [Scilit]
- Tian, J.; Wang, K.; Wang, X.; Wen, H.; Zhou, H.; Liu, C.; Mai, K.; He, G. Soybean Saponin Modulates Nutrient Sensing Pathways and Metabolism in Zebrafish. Gen. Comp. Endocrinol. 2018, 257, 246–254. [Google Scholar] [CrossRef] [Scilit]
- Liang, P.; Wang, Y.; Wu, L.; Qin, Z.; Lai, M.; Lin, J.; Shao, J.; Zhang, D. Optimal Dietary Lipid Requirement of Spinibarbus caldwelli: Comprehensive Characterization of Growth Performance, Feed Utilization, Serum Biochemical and Immune Parameters, Hepatic Lipid Metabolism and Health Maintenance. Aquaculture 2025, 598, 742072. [Google Scholar] [CrossRef] [Scilit]
- Lu, K.-L.; Wang, L.-N.; Zhang, D.-D.; Liu, W.-B.; Xu, W.-N. Berberine Attenuates Oxidative Stress and Hepatocytes Apoptosis via Protecting Mitochondria in Blunt Snout Bream Megalobrama amblycephala Fed High-Fat Diets. Fish Physiol. Biochem. 2017, 43, 65–76. [Google Scholar] [CrossRef] [Scilit]
- Sun, S.; Wu, Y.; Yu, H.; Su, Y.; Ren, M.; Zhu, J.; Ge, X. Serum Biochemistry, Liver Histology and Transcriptome Profiling of Bighead Carp Aristichthys nobilis Following Different Dietary Protein Levels. Fish Shellfish Immunol. 2019, 86, 832–839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, W.; Zhu, R.; Huan, D.; Li, X.; Leng, X. Effects of Macleaya cordata Extract Supplementation in Low-Protein, Low-Fishmeal Diets on Growth, Hematology, Intestinal Histology, and Microbiota in Largemouth Bass (Micropterus salmoides). Aquacult. Rep. 2025, 40, 102618. [Google Scholar] [CrossRef] [Scilit]
- Wu, P.; Su, Y.; Feng, L.; Jiang, W.; Kuang, S.; Tang, L.; Jiang, J.; Liu, Y.; Zhou, X. Optimal DL-Methionyl-DL-Methionine Supplementation Improved Intestinal Physical Barrier Function by Changing Antioxidant Capacity, Apoptosis and Tight Junction Proteins in the Intestine of Juvenile Grass Carp (Ctenopharyngodon idella). Antioxidants 2022, 11, 1652. [Google Scholar] [CrossRef] [Scilit]
- Gu, D.; Mao, X.; Abouel Azm, F.R.; Zhu, W.; Huang, T.; Wang, X.; Ni, X.; Zhou, M.; Shen, J.; Tan, Q. Optimal Dietary Zinc Inclusion Improved Growth Performance, Serum Antioxidant Capacity, Immune Status, and Liver Lipid and Glucose Metabolism of Largemouth Bass (Micropterus salmoides). Fish Shellfish Immunol. 2024, 144, 109233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; Kong, Y.; Lai, Y.; Wu, X.; Zhang, J.; Niu, X.; Wang, G. The Effects of Dietary Supplementation of α-Lipoic Acid on the Growth Performance, Antioxidant Capacity, Immune Response, and Disease Resistance of Northern Snakehead, Channa argus. Fish Shellfish Immunol. 2022, 126, 57–72. [Google Scholar] [CrossRef] [Scilit]
- Li, T.; Zhang, H.; Wu, C. Screening of Antioxidant and Antitumor Activities of Major Ingredients from Defatted Camellia oleifera Seeds. Food Sci. Biotechnol. 2014, 23, 873–880. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Zhai, B.; Sun, J.; Fan, Y.; Zou, J.; Cheng, J.; Zhang, X.; Shi, Y.; Guo, D. Antioxidant, Anti-Aging and Organ Protective Effects of Total Saponins from Aralia taibaiensis. Drug Des. Dev. Ther. 2021, 15, 4025–4042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deponte, M. Glutathione Catalysis and the Reaction Mechanisms of Glutathione-Dependent Enzymes. Biochim. Biophys. Acta (BBA)-Gen. Subj. 2013, 1830, 3217–3266. [Google Scholar] [CrossRef] [Scilit]
- Hanawa, N.; Shinohara, M.; Saberi, B.; Gaarde, W.A.; Han, D.; Kaplowitz, N. Role of JNK Translocation to Mitochondria Leading to Inhibition of Mitochondria Bioenergetics in Acetaminophen-Induced Liver Injury. J. Biol. Chem. 2008, 283, 13565–13577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, D.; Liao, Z.; Feng, B.; Wang, T.; Shan, B.; Zeng, Q.; Song, J.; Song, Y. Pulsatilla chinensis Saponins Cause Liver Injury through Interfering Ceramide/Sphingomyelin Balance That Promotes Lipid Metabolism Dysregulation and Apoptosis. Phytomedicine 2020, 76, 153265. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Wei, L.; Dong, Z.; Meng, F.; Wang, G.; Zhou, S.; Lan, X.; Liao, Z.; Chen, M. Pterocephin a, a Novel Triterpenoid Saponin from Pterocephalus hookeri Induced Liver Injury by Activation of Necroptosis. Phytomedicine 2021, 85, 153548. [Google Scholar] [CrossRef] [Scilit]
- Boran, H.; Ciftci, C.; Er, A.; Kose, O.; Kurtoglu, I.Z.; Kayis, S. Evaluation of Antibacterial Activity of Green Tea (Camellia sinensis L.) Seeds Against Some Fish Pathogens in Rainbow Trout (Oncorhynchus mykiss, Walbaum). Turk. J. Fish. Aquat. Sci. 2015, 15, 49–57. [Google Scholar] [CrossRef]
- Wang, Y.; Meng, X.; Guan, Y.; Zhao, Z.; Tao, L.; Gong, J.; Liu, X.; Zhao, Y.; Shan, X. The Effects of Dietary Supplementation of Ginseng Stem and Leaf Saponins on the Antioxidant Capacity, Immune Response, and Disease Resistance of Crucian Carp, Carassius auratus. Fish Physiol. Biochem. 2022, 50, 1915–1930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Y.; Yan, L.-C.; Xiao, W.-W.; Feng, L.; Jiang, W.-D.; Wu, P.; Liu, Y.; Kuang, S.-Y.; Tang, L.; Zhou, X.-Q. Enzyme-Treated Soy Protein Supplementation in Low Protein Diet Enhanced Immune Function of Immune Organs in on-Growing Grass Carp. Fish Shellfish Immunol. 2020, 106, 318–331. [Google Scholar] [CrossRef] [Scilit]
- Mu, H.; Liu, N.; Yang, C.; Yan, J.; Chen, S.; Li, N.; Zhang, Z.; Yan, B.; Gao, H.; Wei, C. β-Hydroxy-β-Methylbutyrate Supplementation in a Low Protein Diet: Implications on Hemolymph Parameters, Immunity, Endoplasmic Reticulum Stress and Hepatopancreas Histology of Kuruma Shrimp (Penaeus japonicus). Aquacult. Rep. 2025, 42, 102844. [Google Scholar] [CrossRef] [Scilit]
- Dai, Z.; Wang, H.; Liu, J.; Zhang, H.; Li, Q.; Yu, X.; Zhang, R.; Yang, C. Comparison of the Effects of Yucca Saponin, Yucca Schidigera, and Quillaja Saponaria on Growth Performance, Immunity, Antioxidant Capability, and Intestinal Flora in Broilers. Animals 2023, 13, 1447. [Google Scholar] [CrossRef] [Scilit]
- Ming, J.; Ye, J.; Zhang, Y.; Xu, Q.; Yang, X.; Shao, X.; Qiang, J.; Xu, P. Optimal Dietary Curcumin Improved Growth Performance, and Modulated Innate Immunity, Antioxidant Capacity and Related Genes Expression of NF-κB and Nrf2 Signaling Pathways in Grass Carp (Ctenopharyngodon idella) after Infection with Aeromonas hydrophila. Fish Shellfish Immunol. 2020, 97, 540–553. [Google Scholar] [CrossRef] [Scilit]
- Calabrese, E.J. Biphasic Dose Responses in Biology, Toxicology and Medicine: Accounting for Their Generalizability and Quantitative Features. Environ. Pollut. 2013, 182, 452–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawsar, M.A.; Adikari, D.; Zhang, Y. Autophagy in Aquatic Animals: Mechanisms, Implications, and Future Directions. Front. Immunol. 2025, 16, 1612178. [Google Scholar] [CrossRef] [Scilit]
- He, L.; Liang, Y.; Yu, X.; Peng, W.; He, J.; Fu, L.; Lin, H.; Zhang, Y.; Lu, D. Vibrio parahaemolyticus Flagellin Induces Cytokines Expression via Toll-like Receptor 5 Pathway in Orange-Spotted Grouper, Epinephelus coioides. Fish Shellfish Immunol. 2019, 87, 573–581. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Akira, S. Signaling to NF-κB by Toll-like Receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.; Ren, H.; Wang, J.; Xiao, X.; Zhu, L.; Wang, Y.; Yang, L. CHAC1: A Master Regulator of Oxidative Stress and Ferroptosis in Human Diseases and Cancers. Front. Cell Dev. Biol. 2024, 12, 1458716. [Google Scholar] [CrossRef] [Scilit]
- Smith, W.S.; Baker, E.J.; Holmes, S.E.; Koster, G.; Hunt, A.N.; Johnston, D.A.; Flavell, S.U.; Flavell, D.J. Membrane Cholesterol Is Essential for Triterpenoid Saponin Augmentation of a Saporin-Based Immunotoxin Directed against CD19 on Human Lymphoma Cells. Biochim. Biophys. Acta (BBA)-Biomembr. 2017, 1859, 993–1007. [Google Scholar] [CrossRef] [Scilit]
- De Groot, C.; Müller-Goymann, C.C. Saponin Interactions with Model Membrane Systems—Langmuir Monolayer Studies, Hemolysis and Formation of ISCOMs. Planta Med. 2016, 82, 1496–1512. [Google Scholar] [CrossRef] [Scilit]
- Böttger, S.; Melzig, M.F. The Influence of Saponins on Cell Membrane Cholesterol. Bioorg. Med. Chem. 2013, 21, 7118–7124. [Google Scholar] [CrossRef] [Scilit]
- Iwashita, Y.; Suzuki, N.; Matsunari, H.; Furuita, H.; Sugita, T.; Amano, S.; Yamamoto, T. Influence of Cholestyramine Supplemented to a Casein-Based Semi-Purified Diet and Soya Saponin and Soya Isoflavone Supplemented to a Soy Protein Concentrate-Based Diet on Liver Morphology of Fingerling Rainbow Trout Oncorhynchus mykiss. Aquac. Sci. 2010, 58, 411–419. [Google Scholar] [CrossRef]
- Wang, X.; Wen, J.; Hou, X.; Wu, H.; Zhou, Q.; Fu, X.; Cui, C.; Lin, S.; Chen, Y.; Luo, L.; et al. Effects of Dietary Soya-Saponins on Growth Performance and Intestinal Health in Juvenile Largemouth Bass (Micropterus salmoides). Aquacult. Rep. 2025, 45, 103142. [Google Scholar] [CrossRef] [Scilit]
- Yagi, T.; Asada, R.; Kanekura, K.; Eesmaa, A.; Lindahl, M.; Saarma, M.; Urano, F. Neuroplastin Modulates Anti-Inflammatory Effects of MANF. Iscience 2020, 23, 101810. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, J.; Cao, C.; Su, H.; Yang, X.; Wei, Z.; Du, L. Evidence of Gastro-Intestinal System as an Active and Toxic Target of Sasanqua Saponins Extract. Exp. Toxicol. Pathol. 2008, 60, 43–49. [Google Scholar] [CrossRef] [Scilit]









| Ingredient (%) | Groups | ||||
|---|---|---|---|---|---|
| T0 | T5 | T10 | T15 | T20 | |
| Fish meal | 30.00 | 30.00 | 30.00 | 30.00 | 30.00 |
| Soybean meal | 8.00 | 8.00 | 8.00 | 8.00 | 8.00 |
| Clostridium autoethanogenum protein | 17.00 | 17.00 | 17.00 | 17.00 | 17.00 |
| Wheat flour | 18.00 | 18.00 | 18.00 | 18.00 | 18.00 |
| Pregelatinized starch | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Phospholipid | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 |
| Fish oil | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 |
| Corn oil | 7.00 | 7.00 | 7.00 | 7.00 | 7.00 |
| Premix a | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Vitamin C | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
| Monocalcium phosphate | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 |
| Antioxidant | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
| Attractant | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 |
| Choline chloride | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Microcrystalline cellulose | 7.20 | 7.15 | 7.10 | 7.05 | 7.00 |
| Tea saponin | 0.00 | 0.05 | 0.10 | 0.15 | 0.20 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Proximate composition b (%) | |||||
| Crude protein | 42.47 | 42.02 | 42.31 | 42.77 | 42.23 |
| Crude lipid | 16.07 | 16.22 | 15.90 | 16.36 | 16.43 |
| Primer Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Accession No. |
|---|---|---|---|
| cat | GCAAGTTCCACTACAAGACTG | GCATAATCTGGGTTGCTGGA | XM_049573567.1 |
| gpx | TCCTCTGTGGAAGTGGCTGA | TCATCCAGGGGTCCGTATCT | XM_033622197.1 |
| sod | CAGTGGGACCGTGTATTTTGAG | CAGTCACATTTCCCAGGTCTCC | XM_049593128.1 |
| hsp70 | ATCAATCCAGACGAGGCA | TACCCAGGGACAGAGGC | XM_049561556.1 |
| hsp90 | AACGACAAGGCTGTGAAGGAC | TTCTGTAGATGCGGTTGGAGTG | XM_049590777.1 |
| il6 | CAATCCCAGCACCTTCCAC | CCTGACAGCCAGACTTCCTCT | XM_049603149.1 |
| il8 | TGTGGCACTCCTGGTTCTCC | GGGTTCACCTCCACCTGTCC | XM_049572727.1 |
| keap1 | TCCACAAACCCACCAAAGTAA | TCCACCAACAGCGTAGAAAAG | XM_033623805.1 |
| il10 | CGGAGTGACGGAGGATACCA | AACCTTTACCCTCCATCTGAGT | XM_049580695.1 |
| tgfβ | CCGCTTCATCACCAACGAG | CCGCTCATCCTCATTTCCTT | XM_049576571.1 |
| nrf2 | TATGGAGATGGGTCCTTTGGTG | GCTTCTTTTCCTGCGTCTGTTG | XM_033617942.1 |
| β-actin | GGCTACTCCTTCACCACCACA | TCTGGGCAACGGAACCTCT | XM_033645256.1 |
| Parameters | Groups | ||||
|---|---|---|---|---|---|
| T0 | T5 | T10 | T15 | T20 | |
| IAW (g) | 17.48 ± 0.01 | 17.53 ± 0.00 | 17.54 ± 0.02 | 17.52 ± 0.02 | 17.50 ± 0.02 |
| FAW (g) | 41.76 ± 1.05 b | 46.70 ± 1.33 a | 42.25 ± 0.71 ab | 38.55 ± 1.25 b | 32.56 ± 0.58 c |
| WGR (%) | 138.87 ± 6.14 ab | 166.38 ± 7.63 a | 140.97 ± 4.09 ab | 120.11 ± 7.24 b | 86.10 ± 3.39 c |
| SGR (%/d) | 3.11 ± 0.09 ab | 3.50 ± 0.10 a | 3.14 ± 0.06 ab | 2.81 ± 0.12 b | 2.22 ± 0.07 c |
| FCR (%) | 1.17 ± 0.01 bc | 1.09 ± 0.02 c | 1.11 ± 0.01 bc | 1.19 ± 0.03 b | 1.30 ± 0.03 a |
| Sample | Clean Reads | Clean Bases (bp) | GC Content (%) | Q20 (%) | Q30 (%) | Mapped Reads |
|---|---|---|---|---|---|---|
| T0a | 22,378,015 | 6,666,660,478 | 48.94 | 97.74 | 94.33 | 33,134,847 (74.03%) |
| T0b | 22,129,577 | 6,575,286,554 | 47.27 | 97.73 | 94.46 | 29,369,241 (66.36%) |
| T0c | 21,637,091 | 6,447,423,232 | 48.28 | 97.88 | 94.70 | 29,762,760 (68.78%) |
| T5a | 21,601,200 | 6,428,501,174 | 49.13 | 97.92 | 94.82 | 31,326,955 (72.51%) |
| T5b | 22,466,820 | 6,692,240,965 | 48.85 | 97.65 | 94.13 | 32,924,424 (73.27%) |
| T5c | 21,642,623 | 6,453,927,172 | 48.98 | 97.87 | 94.70 | 32,406,611 (74.87%) |
| T20a | 22,344,568 | 6,671,387,541 | 47.76 | 97.70 | 94.31 | 30,541,937 (68.34%) |
| T20b | 21,882,123 | 6,525,852,537 | 48.39 | 97.82 | 94.48 | 31,463,062 (71.89%) |
| T20c | 21,557,839 | 6,430,366,288 | 47.95 | 97.89 | 94.76 | 30,463,912 (70.66%) |
| Gene ID | Gene Description | T0 vs. T5 | T5 vs. T20 | T0 vs. T20 |
|---|---|---|---|---|
| 117249054 | il1rl1; interleukin-1 receptor type 1 | down | up | normal |
| 117268475 | map3k14a; mitogen-activated protein kinase kinase kinase 14a | down | up | normal |
| 117263212 | psmb9a; proteasome 20S subunit beta 9a | down | up | normal |
| 117268736 | jmjd8; jumonji domain containing 8 | down | up | normal |
| 117248633 | eif2ak2; uncharacterized LOC117248633 | down | up | normal |
| 117253731 | ifi44l; interferon-induced protein 44-like | down | up | normal |
| 117261215 | magt1; magnesium transporter 1 | down | up | normal |
| 117251812 | inhbb; inhibin subunit beta B | down | up | normal |
| 117268097 | noxo1a; NADPH oxidase organizer 1a | down | up | normal |
| 117272819 | txnb; thioredoxin b | down | up | normal |
| 117270274 | mpv17; mitochondrial inner membrane protein MPV17 | down | up | normal |
| 117262168 | kras; v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog | down | up | normal |
| 117262185 | hsp90b1; heat shock protein 90, beta (grp94), member 1 | down | up | normal |
| 117253366 | calr; calreticulin | down | up | normal |
| 117260791 | canx; calnexin | down | up | normal |
| 117262795 | pdia3; protein disulfide isomerase family A, member 3 | down | up | normal |
| 117264692 | pdia4; protein disulfide isomerase family A, member 4 | down | up | normal |
| 117256474 | fkbp11; FKBP prolyl isomerase 11 | down | up | normal |
| 117252654 | sdf2l1; stromal cell-derived factor 2-like 1 | down | up | normal |
| 117252974 | polyubiquitin-like | down | up | normal |
| 117269594 | c7b; complement component C7 | normal | up | up |
| 117268525 | gimap7; GTPase IMAP family member 7 | normal | up | up |
| 117258187 | tfe3a; transcription factor binding to IGHM enhancer 3a | normal | up | up |
| 117246806 | ddit4; DNA-damage-inducible transcript 4 | normal | up | up |
| 117260013 | vmp1; vacuole membrane protein 1 | normal | up | up |
| 117257312 | manf; mesencephalic astrocyte-derived neurotrophic factor | normal | up | up |
| 117251091 | dnajc3a; DnaJ (Hsp40) homolog, subfamily C, member 3a | normal | up | up |
| 117262523 | herpud1; homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 | normal | up | up |
| 117260672 | sil1; SIL1 nucleotide exchange factor | normal | up | up |
| 117271251 | pdia6; protein disulfide isomerase family A, member 6 | normal | up | up |
| 117270621 | tlr5; toll-like receptor 5 | up | up | up |
| 117271294 | atf3; activating transcription factor 3 | up | up | up |
| 117267770 | junbb; JunB proto-oncogene, AP-1 transcription factor subunit b | up | up | up |
| 117251422 | fosl1a; FOS like 1, AP-1 transcription factor subunit a | up | up | up |
| 117267250 | fosl2; FOS like 2, AP-1 transcription factor subunit | up | up | up |
| 117256987 | ddit3; DNA-damage-inducible transcript 3 | up | up | up |
| 117270409 | chac1; ChaC, cation transport regulator homolog 1 | up | up | up |
| 117247618 | maff; v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F | up | up | up |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Guo, S.; Yu, J.; Shi, L.; Tan, B.; Zhang, S.; Yan, X. Tea Saponin Exerts Dose-Dependent Dual Effects on Growth and Hepatic Health in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) Fed a High-Lipid, Low-Protein Diet via Redox-Immune Regulation. Animals 2026, 16, 1408. https://doi.org/10.3390/ani16091408
Guo S, Yu J, Shi L, Tan B, Zhang S, Yan X. Tea Saponin Exerts Dose-Dependent Dual Effects on Growth and Hepatic Health in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) Fed a High-Lipid, Low-Protein Diet via Redox-Immune Regulation. Animals. 2026; 16(9):1408. https://doi.org/10.3390/ani16091408
Chicago/Turabian StyleGuo, Shengrong, Jun Yu, Lili Shi, Beiping Tan, Shuang Zhang, and Xiaobo Yan. 2026. "Tea Saponin Exerts Dose-Dependent Dual Effects on Growth and Hepatic Health in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) Fed a High-Lipid, Low-Protein Diet via Redox-Immune Regulation" Animals 16, no. 9: 1408. https://doi.org/10.3390/ani16091408
APA StyleGuo, S., Yu, J., Shi, L., Tan, B., Zhang, S., & Yan, X. (2026). Tea Saponin Exerts Dose-Dependent Dual Effects on Growth and Hepatic Health in Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) Fed a High-Lipid, Low-Protein Diet via Redox-Immune Regulation. Animals, 16(9), 1408. https://doi.org/10.3390/ani16091408

