The Effects of Compound Chinese Herbal Medicine on the Growth and Digestive and Immune Systems of Megalobrama amblycephala
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Preparation and Application of Compound Chinese Herbal Medicine Feed
2.3. Determination of Growth Indicators
2.4. Observation of Liver and Intestinal Tissue Sections
2.5. Determination of Serum Antioxidant and Immune-Related Enzyme Activities
2.6. Determination of Enzyme Activity Related to Intestinal Digestion
2.7. Mortality Statistics of M. amblycephala After Aeromonas hydrophila Infection
2.8. Detection of the Expression of Immune-Related Genes in M. amblycephala by qRT-PCR
2.9. Data Analysis
3. Results
3.1. Changes in Growth Indices of M. amblycephala
3.2. Changes in Intestinal Digestive Enzyme Activities
3.3. The Effect of Compound Chinese Herbal Medicine on the Intestines of M. amblycephala
3.4. The Effect of Compound Chinese Herbal Medicine on the Liver and Spleen of M. amblycephala
3.5. The Effect of Compound Chinese Herbal Medicine on the Activity of Serum Immune-Related Enzymes
3.6. The Effect of Compound Chinese Herbal Medicine on the Expression of Immune-Related Genes
3.7. The Effect of Compound Chinese Herbal Medicine on Disease Resistance of M. amblycephala
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ministry of Agriculture and Rural of the People’ Republic of China. Ministry of Agriculture and Rural of the People’ Republic of China: NO.194 [EB/OL]; Ministry of Agriculture and Rural of the People’ Republic of China: Beijing, China, 10 July 2019.
- Cai, Y.; Chen, T.; Liu, H. Application and research of Chinese herbal medicine in aquaculture. Mod. Anim. Husb. Sci. Technol. 2023, 3, 48–50. [Google Scholar] [CrossRef]
- Bi, R.R.; Zhao, Y.; Sun, Y.J. Research advances on regulating intestinal flora and their physiological functions by phytochemicals of goji berry. J. Zhejiang Univ. (Agric. Life. Sci.) 2024, 50, 25–34. [Google Scholar]
- Xiao, B.; Zhou, S.J.; Wang, Y.G.; Fu, Z.Y.; Fang, W.; Yu, G.; Ma, Z.H. Effects of fermented Astragalus membranaceus on the growth, digestion, immune function and ammonia nitrogen resistance of Epinephelus fuscoguttatus. South China Fish. Sci. 2023, 19, 161–169. [Google Scholar] [CrossRef]
- Li, C.Z.; Hu, K.; Tang, X.L.; Wu, Y.X.; Liang, C.J.; Yang, X.L. Effects of ginseng polysaccharides on growth performance and mRNA expression of antioxidaes in Sparus inacrocephalus. J. Huazhong Agric. Univ. 2015, 34, 94–100. [Google Scholar] [CrossRef]
- Rajput, S.A.; Shaukat, A.; Rajput, I.R.; Kamboh, A.A.; Iqbal, Z.; Saeed, M.; Akhtar, R.W.; Shah, S.A.H.; Raza, M.A.; Askary, A.E.L.; et al. Ginsenoside Rb1 prevents deoxynivalenol-induced immune injury via alleviating oxidative stress and apoptosis in mice. Ecotoxicol. Environ. Saf. 2021, 220, 112333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, Y.; Tian, C.; Fan, C.; Xu, N.; Xiao, J.; Zhao, X.; Lu, Z.; Cao, H.; Liu, J.; Yu, L. Sheng-Mai Yin exerts anti-inflammatory effects on RAW 264.7 cells and zebrafish. J. Ethnopharmacol. 2021, 267, 113497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.B.; Zhao, W.Y.; Pang, M.J.; Su, Y.F. Study on the hydrophilic chemical composition of reed root. Chin. Herb. Med. 2024, 55, 51–56. [Google Scholar]
- Li, J.B.; Zhang, J.; He, X.; Liu, M.; Yan, K.; Zhao, W.P. Protective effect of aqueous extract of reed root on mice with radiation lung injury. Chin. J. Pathophysiol. 2023, 39, 1282–1288. [Google Scholar]
- Zhang, Y.; Bian, Y.Y.; Cui, Q.M.; Yuan, C.Y.; Lin, Y.T.; Li, J.Y.; Meng, P.R. Effect of dietary complex Chinese herbal medicine on growth performance, digestive enzyme activities in tissues and expression of genes involved in the digestive enzymes and antioxidant enzymes and bacterial challenge in Litopenaeus vannamei. Aquacult Res. 2021, 52, 6741–6750. [Google Scholar] [CrossRef] [Scilit]
- Hou, T.L.; Liu, H.R.; Li, C.T. Traditional Chinese herb formulas in diet enhance the non-specific immune responses of yellow catfish (Pelteobagrus fulvidraco) and resistance against Aeromonas hydrophila. Fish. Shellfish. Immunol. 2022, 131, 631–636. [Google Scholar] [CrossRef] [Scilit]
- Yin, X.; Liu, W.; Chen, H.; Qi, C.; Chen, H.; Niu, H.; Yang, J.; Kwok, K.W.H.; Dong, W. Effects of ferulic acid on muscle development and intestinal microbiota of zebrafish. J. Anim. Physiol. Anim. Nutr. 2022, 106, 429–440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Xiao, J.; Guo, Z.; Zhong, H.; Luo, Y.; Wang, J.; Tang, Z.; Huang, T.; Li, M.; Zhu, J.; et al. Transcriptomics integrated with metabolomics reveals the effect of Lycium barbarum polysaccharide on apoptosis in Nile tilapia (Oreochromis niloticus). Genomics 2022, 114, 229–240. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.H.; Wang, Y.C.; Yu, J.; Li, J.; Wu, Q.H.; Bao, S.S.; Jiang, J.; Liu, B. Effects of dietary fermented Chinese herbal medicines on growth performance, digestive enzyme activity, liver antioxidant capacity, and intestinal inflammatory gene expression of juvenile largemouth bass (Micropterus salmoides). Aquacult. Rep. 2022, 25, 101269. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.N.; Zhao, J.P.; Ma, Y.F.; Li, J.; Chen, X.H. The effective components of herbal medicines used for prevention and control of fish diseases. Fish. Shellfish. Immunol. 2022, 126, 73–83. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.L.; Cai, H.M.; Li, H.; You, F.; Jiang, A.X.; Hu, W.P.; Li, K.K.; Zhang, X.D.; Zhang, Y.M.; Chang, X.L.; et al. Clostridium butyricum-fermented Chinese herbal medicine enhances the immunity by modulating the intestinal microflora of largemouth bass (Micropterus salmoides). Aquaculture 2023, 562, 738768. [Google Scholar] [CrossRef] [Scilit]
- Tang, E.Q.; Huang, Y.Y.; Sang, X.S. Discussion on the prescription theory of the Huangdi Neijing. J. Anhui Univ. Chin. Med. 2012, 31, 1–3. [Google Scholar] [CrossRef]
- Teng, T.; Xi, B.W.; Fei, X.N.; Xie, J.; Xu, P. Acute toxicity of nitrite on Megalobrama amblycephala and effect on serum methemoglobin. J. Aquat. Ecol. 2018, 39, 99–106. [Google Scholar] [CrossRef]
- Zhang, J.; Wei, X.L.; Chen, L.P.; Chen, N.; Li, Y.H.; Wang, W.M.; Wang, H.L. Sequence analysis and expression differentiation of chemokine receptor CXCR4b among three populations of Megalobrama amblycephala. Dev. Comp. Immunol. 2013, 40, 195–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, R.; Dodd, A.; Lai, D.; Mcnabb, W.C.; Love, D.R. Validation of Zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochim. Biophys. Sin. 2007, 39, 384–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, H.; Liu, L.G.; Zhou, W.; Ding, C.; Liu, H.M.; Lei, T.; Chen, F.Y.; Liu, S.H.; Yu, J.; Yang, P.H.; et al. Immune response to Aeromonas hydrophila and molecular characterization of polymeric immunoglobulin receptor in juvenile Megalobrama amblycephala. Fish. Shellfish. Immun. 2024, 153, 109821. [Google Scholar] [CrossRef] [Scilit]
- Zimmerman, A.M.; Moustafa, F.M.; Romanowski, K.E.; Steiner, L.A. Zebrafish immunoglobulin IgD: Unusual exon usage and quantitative expression profiles with IgM and IgZ/T heavy chain isotypes. Mol. Immunol. 2011, 48, 2220–2223. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.W.; Liu, L.H.; Chen, Q.; Li, W.J.; Li, Z.B. Effects of compound Chinese herbs on growth performance, nonspecific immunity, and intestinal digestive enzyme activity of Acanthopagrus schlegelii. Mar. Sci. 2024, 48, 56–67. [Google Scholar]
- Yang, Z.G. Effects of Compound Chinese Herbal Medicine on Growth, Intestinal Flora, Immune Function and Serum Metabolomics of Gentian Grouper. Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2022. [Google Scholar] [CrossRef]
- Wu, B. Effects of Dietary Skullcap, Honeysuckle, Radix lsatidis, Astragalus on Growth and Immune Performance of Juvenile Tilapia (Oreochromis niloticus). Master’s Thesis, Guangxi University, Nanning, China, 2015. [Google Scholar] [CrossRef]
- Shi, H.R.; He, Q.; Lǚ, Q.J.; Peng, J.G.; Liang, T.F.; Chen, Y.B.; Liu, X.C.; Yang, Y.Q.; Liu, S.; Zhang, H.F.; et al. Effect of compound Chinese medicine and nucleotide additives on growth and immunity of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Chin. J. Fish. 2019, 32, 41–47. [Google Scholar]
- Lu, J.J.; Guo, R.; Qi, G.S.; Li, X.H.; Jia, G.W.; Xia, H.; Yang, P.X.; Wang, X.D. Effects of Chinese herbal medicine compounds on growth and non-specific immunity of turbot Scophthalmus maximus. J. Dalian. Ocean. Univ. 2018, 33, 722–728. [Google Scholar] [CrossRef]
- Wu, G. Functional amino acids in nutrition and health. Amino Acids 2013, 45, 407–411. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.J.; Song, Y.; Cao, Y.; Xia, C.; Zeng, X.D.; Zhong, Z.D. The effects of compound Chinese herbal medicine on the histology of blood and liver of Acipenser schrenckii. Feed. China 2011, 16, 38–39. [Google Scholar] [CrossRef]
- Li, X.; Ma, C.Y.; Li, Y.J.; Jiang, Z.Q.; Wang, B.; Yao, Y.; Kong, X.T. Effect of Chinese herbal medicine on immunity of flounder Paralichthys olivaceus. J. Northeast. Agric. Univ. 2011, 42, 60–67. [Google Scholar] [CrossRef]
- Salinas, I.; Zhang, Y.A.; Sunyer, J.O. Mucosal immunoglobulins and B cells of teleost fish. Dev. Com. Immunol. 2011, 35, 1346–1365. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y. In Vitro Bacteriostatis Chinese Herb Compound Selection for Acute Hepatopancreas Necrosis Syndrome in Litopenaeus vannamei. Master’s Thesis, Dalian Ocean University, Dalian, China, 2016. [Google Scholar] [CrossRef]
- Chen, F.Y.; Ouyang, X.H.; Li, J.B.; Huang, C.L.; Li, D.L.; Lei, A.Y.; Huang, T.; Li, M.; Liang, W.W. Effects of zymosan-Chinese herbal compound preparation on growth, non-specific immunity and intestinal structure of tilapia. Southwest. J. Agric. Sci. 2019, 32, 2712–2718. [Google Scholar]
- Awad, E.; Awaad, A. Role of medicinal plants on growth performance and immune status in fish. Fish. Shellfish. Immunol. 2017, 67, 40–54. [Google Scholar] [CrossRef] [Scilit]
- Xu, A.L.; Li, Z.B.; Shangguan, J.B.; Hu, X.W.; Huang, Y.C.; Lin, M.S.; Lin, Z.B. Effects of compound Chinese herbal medicine on growth, non-specific immunity and digestive enzyme activities of pearl gentian grouper. Acta Oceanol. Sin. Chin. 2018, 40, 49–57. [Google Scholar] [CrossRef]
- He, L.B.; Yang, Q.H.; Li, H.Y.; Luo, H.Y.; Zheng, L.Y. Effects of a Chinese herbal compound on nonspecific immunity, digestive enzyme activities, and extermination of the parasite Cryptocaryon irritans from Amphiprion frenatus. Mar. Sci. 2024, 48, 32–42. Available online: https://link.cnki.net/urlid/37.1151.P.20240405.1527.008 (accessed on 12 March 2026).
- Wang, G.J.; Xie, J.; Hu, Y.C.; Yu, D.G. Study of Chinese herbal additives on the growth and non-specific immune response of Japanese eel, Anguilla japonica. Freshw. Fish. 2008, 38, 38–41. [Google Scholar] [CrossRef]
- Wang, Y.H.; Xu, X.Z.; Wang, H.C.; Chen, J.; Zhang, K.; Ni, X.Y. Effects of astragalus polysaccharide on growth performance, immunity, antioxidant capability and disease resistance of hybrid snakehead. Chin. J. Anim. Nutr. 2018, 30, 1447–1456. [Google Scholar] [CrossRef]
- Qu, M.; Huang, C.; Zhang, B.L.; Cheng, Z.Y.; Bai, D.Q.; Jia, L.Y.; Zhai, S.L. Effects of compound Chinese traditional drug on the growth performance, muscle quality and complement C3, complement C4 content in serum of Pelteobagrus fulvidraco. China Feed. 2018, 19, 74–79. [Google Scholar] [CrossRef]
- Wang, F.; Li, C.G.; Ma, Y.W.; Liu, F.; Zheng, Y.T.; Ge, X.Y.; Li, J.Y.; Zhang, M.Y.; Niu, Y.L.; Meng, X.J. Effects of Chinese herbal compound on growth performance and non-specific immunity in rainbow trout (Oncorhynchus mykiss). J. Fish. Sci. 2021, 34, 8–14. [Google Scholar] [CrossRef]
- Zhang, J.M.; Zhang, D.Z.; Tian, T.; Shu, D.B. Effect of compound Chinese herbal medicine on immunity, antioxidant and disease resistance of juvenile Acipenser dabryanus. Feed. Res. 2023, 46, 49–54. [Google Scholar]
- Pan, Y.C.; Huang, J.Q.; Li, Y.J.; Wu, S.J.; Zhao, L.; Lei, M.Q.; Sun, T.Z.; Wang, X.L. Effects of compound Chinese herbal medicine on non-specific immunity parameters and immune-related gene expressions in spleen of rainbow trout (Oncorhynchus mykiss). J. Agric. Biotechnol. 2022, 30, 1580–1593. [Google Scholar]
- Yuan, C.; Pan, X.; Gong, Y.; Xia, A.; Wu, G.; Tang, J.; Han, X. Effects of astragalus polysaccharides (APS) on the expression of immune response genes in head kidney, gill and spleen of the common carp, Cyprinus carpio L. Int. Immunopharmacol. 2008, 8, 51–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, L.P.; Ding, W.D.; Zhang, L.; Galina, J.; Xu, P.; Yin, G.J. Effects of the activation of immunological cells and the expression of interleukin-1β in the Cyprinus carpio after stimulation by lentinan and astragalus polysaccharides. J. Fish. China 2008, 04, 628–635. [Google Scholar]
- Sherif, A.H.; Toulan, A.E.; El-Kalamwi, N.; Farag, E.A.H.; Mahmoud, A.E. Silymarin enhances the response to oxytetracycline treatment in Oreochromis niloticus experimentally infected with Aeromonas hydrophila. Sci. Rep. 2023, 13, 16235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.M. Effects of a Traditional Compound Chinese Medicine on the Expression of Immune Related Genes in GITF Strain of Nile Tilapia (Oreochromis niloticus). Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2011. [Google Scholar]
- Sheng, Z.M.; Huang, W.; Zhang, Y.J.; Yang, H.L.; Ma, L.M.; Xu, X.L.; Xia, L. Effect of complex Chinese herbs on non-specific immune function and disease resistance in yellow catfish (Pelteobagrus fulvidraco R.) by oral administration. J. Huazhong. Agric. Univ. 2012, 31, 243–246. [Google Scholar] [CrossRef]
- Sun, Y.L.; Wang, D.; Liu, H.B. Effects of compound Chinese herbal medicine on non-specific immunity of Amur Sturgeon. Chin. Agric. Sci. Bull. 2015, 31, 45–49. [Google Scholar] [CrossRef]







| Astragalus membranaceus | Panax ginseng | Lycium barbarum | Phragmitis rhizoma | Compound Chinese Herbal Medicine | |
|---|---|---|---|---|---|
| Additive amount (%) | 45 | 15 | 30 | 10 | 100 |
| Crude Protein (%) | 14.9 | 12.3 | 13.9 | 13 | 14.02 |
| Crude fat (%) | 1.1 | 0.1 | 5 | 2.3 | 2.24 |
| Crude Ash (%) | 5 | 5 | 6 | 3 | 5.1 |
| Carbohydrate (%) | 33.4 | 58.6 | 45 | 78 | 45.12 |
| Cellulose (%) | 42.1 | 17.1 | 16.9 | 1.4 | 26.72 |
| Total energy (KJ/g) | 9.8 | 13.20 | 13.14 | 17.6 | 12.1 |
| Ingredient | Experimental Groups | |||
|---|---|---|---|---|
| Control Group | T1 | T2 | T3 | |
| Soybean meal (g) | 200 | 200 | 200 | 200 |
| Rapeseed meal (g) | 400 | 400 | 400 | 400 |
| Fish meal (g) | 110 | 110 | 110 | 110 |
| Wheat flour (g) | 175 | 165 | 155 | 135 |
| Compound Chinese herbal medicine (g) | 0 | 10 | 20 | 40 |
| Soybean oil (g) | 60 | 60 | 60 | 60 |
| Compound feed premixes (g) | 30 | 30 | 30 | 30 |
| Bentonite (g) | 23 | 23 | 23 | 23 |
| Choline chloride (g) | 1.7 | 1.7 | 1.7 | 1.7 |
| Preservative (g) | 0.1 | 0.1 | 0.1 | 0.1 |
| Antioxidant (g) | 0.2 | 0.2 | 0.2 | 0.2 |
| Total (g) | 1000 | 1000 | 1000 | 1000 |
| Nutrient level | ||||
| Crude protein (%) | 33.97 | 33.98 | 33.99 | 34.01 |
| Crude fat (%) | 8.85 | 8.86 | 8.86 | 8.88 |
| Crude ash (%) | 5.56 | 5.58 | 5.59 | 5.68 |
| Calcium (%) | 1.2 | 1.2 | 1.2 | 1.2 |
| Carbohydrate (%) | 29.83 | 29.59 | 29.35 | 28.88 |
| Total phosphorus (%) | 0.5 | 0.5 | 0.5 | 0.5 |
| Crude fiber (%) | 6.24 | 6.48 | 6.73 | 7.22 |
| Total energy (MJ/kg) | 16.75 | 16.71 | 16.68 | 16.60 |
| Primer Name | Sequence (5′–3′) | Accession Number | PCR Amplification Efficiency (%) | Slope | R2 | Amplicon Size (bp) |
|---|---|---|---|---|---|---|
| il-1βF | ACCCACATGAAAACCTCCTGTT | MN294974.1 | 96 | −3.483 | 0.996 | 215 |
| il-1βR | GATCTGTTGTTTGTCCTCCAGC | |||||
| tnf-αF | CCGCTGCTGTCTGCTTCA | KU976426.1 | 95 | −3.453 | 0.997 | 223 |
| tnf-αR | GCCTGGTCCTGGTTCACTCT | |||||
| c3-F | ATGGACTTTCACTCGATCCAACA | MK165094.1 | 95 | −3.476 | 0.994 | 258 |
| c3-R | AACTGCTTCTCCATCTTCACACT | |||||
| igm-F | GGAGCAACGGCACAGTAT | KC894945 | 96 | −3.481 | 0.995 | 221 |
| igm-R | ATCAGCAAGCCAAGACAC | |||||
| β-actin-F | ACCCACACCGTGCCCATCTA | AY170122.2 | 95 | −3.488 | 0.997 | 236 |
| β-actin-R | CGGACAATTTCTCTTTCGGCTG | |||||
| 18S rRNA-F | CGGAGGTTCGAAGACGATCA | AB860215.1 | 92 | −3.450 | 0.991 | 247 |
| 18S rRNA-R | GGGTCGGCATCGTTTACG | |||||
| EF1a-F | CTTCTCAGGCTGACTGTGC | XM_048201754.1 | 90 | −3.580 | 0.993 | 218 |
| EF1a-R | CCGCTAGCATTACCCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ye, X.; Zhang, Y.; Xia, H.; Fan, H.; Hu, J.; Gong, Y.; Fu, R.; Chen, F.; Liu, L. The Effects of Compound Chinese Herbal Medicine on the Growth and Digestive and Immune Systems of Megalobrama amblycephala. Animals 2026, 16, 925. https://doi.org/10.3390/ani16060925
Ye X, Zhang Y, Xia H, Fan H, Hu J, Gong Y, Fu R, Chen F, Liu L. The Effects of Compound Chinese Herbal Medicine on the Growth and Digestive and Immune Systems of Megalobrama amblycephala. Animals. 2026; 16(6):925. https://doi.org/10.3390/ani16060925
Chicago/Turabian StyleYe, Xijing, Yunsheng Zhang, Hu Xia, Huangjie Fan, Jiahui Hu, Yanan Gong, Rurou Fu, Fuyan Chen, and Liangguo Liu. 2026. "The Effects of Compound Chinese Herbal Medicine on the Growth and Digestive and Immune Systems of Megalobrama amblycephala" Animals 16, no. 6: 925. https://doi.org/10.3390/ani16060925
APA StyleYe, X., Zhang, Y., Xia, H., Fan, H., Hu, J., Gong, Y., Fu, R., Chen, F., & Liu, L. (2026). The Effects of Compound Chinese Herbal Medicine on the Growth and Digestive and Immune Systems of Megalobrama amblycephala. Animals, 16(6), 925. https://doi.org/10.3390/ani16060925
