ELAVL1 Promotes Proliferation and Inhibits Apoptosis of the Marek’s Disease Virus (MDV)-Transformed Cell Line MSB1 via the COX-2/PGE2 Pathway
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Transfection with Plasmids and siRNA
2.2. Quantitative RT-PCR (qRT-PCR)
2.3. Western Blotting Analysis
2.4. ELISA Assays
2.5. Cell Viability Assays
2.6. Cell Cycle Assay
2.7. AnnexinV-APC/7-AAD Staining
2.8. Statistical Analysis
3. Results
3.1. ELAVL1 Overexpression and Knockdown in MSB1 Cells
3.2. ELAVL1 Expression Plays a Key Role in the Cell Viability and Cycle Progression of MSB1 Cells
3.3. Overexpression of ELAVL1 Inhibits the Apoptosis of MSB1 Cells
3.4. ELAVL1 Regulates the Expression of COX-2/PGE2 in MSB1 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| MD | Marek’s disease |
| MDV | Marek’s disease virus |
| ELAVL1 | Embryonic lethal abnormal vision-like 1 |
| HuR | Human antigen R |
| RBP | RNA-binding proteins |
| DMSO | Dimethyl sulfoxide |
| FBS | Fetal bovine serum |
| TPB | Tryptose phosphate broth |
| qRT-PCR | Quantitative Real-time Polymerase Chain Reaction |
| SDS-PAGE | Sodium dodecyl sulfate polyacrylamide gel electrophoresis |
| UTR | Untranslated region |
| COX-2 | Cyclooxygenase-2 |
| PGE2 | Prostaglandin E2 |
| CDK | Cyclin-dependent kinases |
| OD | Optical density |
References
- Fang, Y.; Liu, X.; Liu, Y.; Xu, N. Insights into the Mode and Mechanism of Interactions Between RNA and RNA-Binding Proteins. Int. J. Mol. Sci. 2024, 25, 11337. [Google Scholar] [CrossRef] [PubMed]
- Pereira, B.; Billaud, M.; Almeida, R. RNA-Binding Proteins in Cancer: Old Players and New Actors. Trends Cancer 2017, 3, 506–528. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Deng, X.; Chen, J. RNA-binding proteins in regulating mRNA stability and translation: Roles and mechanisms in cancer. Semin. Cancer Biol. 2022, 86, 664–677. [Google Scholar] [CrossRef]
- Jungfleisch, J.; Gebauer, F. RNA-binding proteins as therapeutic targets in cancer. RNA Biol. 2025, 22, 1–8. [Google Scholar] [CrossRef]
- Smirnov, A. Research Progress in RNA-Binding Proteins. Int. J. Mol. Sci. 2022, 24, 58. [Google Scholar] [CrossRef]
- Abdelmohsen, K.; Lal, A.; Kim, H.H.; Gorospe, M. Posttranscriptional orchestration of an anti-apoptotic program by HuR. Cell Cycle 2007, 6, 1288–1292. [Google Scholar] [CrossRef]
- Brennan, C.M.; Steitz, J.A. HuR and mRNA stability. Cell. Mol. Life Sci. 2001, 58, 266–277. [Google Scholar] [CrossRef]
- Grammatikakis, I.; Abdelmohsen, K.; Gorospe, M. Posttranslational control of HuR function. Wiley Interdiscip. Rev. RNA 2017, 8. [Google Scholar] [CrossRef]
- Kassab, A.E. Recent advances in targeting COX-2 for cancer therapy: A review. RSC Med. Chem. 2025. [Google Scholar] [CrossRef]
- Zheng, X.; Wang, J.; OuYang, Y.; Yao, K.; Zheng, J.; Zeng, L.; Wang, J.; Chen, H.; Du, H.; Fu, D.; et al. Breaking immune evasion in breast cancer by targeting COX-2/PGE2 pathway. Mol. Cell. Endocrinol. 2025, 608, 112617. [Google Scholar] [CrossRef] [PubMed]
- Janakiraman, H.; House, R.P.; Talwar, S.; Courtney, S.M.; Hazard, E.S.; Hardiman, G.; Mehrotra, S.; Howe, P.H.; Gangaraju, V.; Palanisamy, V. Repression of caspase-3 and RNA-binding protein HuR cleavage by cyclooxygenase-2 promotes drug resistance in oral squamous cell carcinoma. Oncogene 2017, 36, 3137–3148. [Google Scholar] [CrossRef] [PubMed]
- Mitsunari, K.; Miyata, Y.; Asai, A.; Matsuo, T.; Shida, Y.; Hakariya, T.; Sakai, H. Human antigen R is positively associated with malignant aggressiveness via upregulation of cell proliferation, migration, and vascular endothelial growth factors and cyclooxygenase-2 in prostate cancer. Transl. Res. 2016, 175, 116–128. [Google Scholar] [CrossRef] [PubMed]
- Giaginis, C.; Alexandrou, P.; Delladetsima, I.; Karavokyros, I.; Danas, E.; Giagini, A.; Patsouris, E.; Theocharis, S. Clinical Significance of Hu-Antigen Receptor (HuR) and Cyclooxygenase-2 (COX-2) Expression in Human Malignant and Benign Thyroid Lesions. Pathol. Oncol. Res. 2016, 22, 189–196. [Google Scholar] [CrossRef] [PubMed]
- Aguado, A.; Rodríguez, C.; Martínez-Revelles, S.; Avendaño, M.S.; Zhenyukh, O.; Orriols, M.; Martínez-González, J.; Alonso, M.J.; Briones, A.M.; Dixon, D.A.; et al. HuR mediates the synergistic effects of angiotensin II and IL-1β on vascular COX-2 expression and cell migration. Br. J. Pharmacol. 2015, 172, 3028–3042. [Google Scholar] [CrossRef]
- Kurosu, T.; Ohga, N.; Hida, Y.; Maishi, N.; Akiyama, K.; Kakuguchi, W.; Kuroshima, T.; Kondo, M.; Akino, T.; Totsuka, Y.; et al. HuR keeps an angiogenic switch on by stabilising mRNA of VEGF and COX-2 in tumour endothelium. Br. J. Cancer 2011, 104, 819–829. [Google Scholar] [CrossRef]
- Li, X.; Zhu, X.; Diba, P.; Shi, X.; Vrieling, F.; Jansen, F.A.C.; Balvers, M.G.J.; de Bus, I.; Levasseur, P.R.; Sattler, A.; et al. Tumor-derived cyclooxygenase-2 fuels hypothalamic inflammation. Brain Behav. Immun. 2025, 123, 886–902. [Google Scholar] [CrossRef]
- Li, X.; Zhu, Y.; Zhao, T.; Zhang, X.; Qian, H.; Wang, J.; Miao, X.; Zhou, L.; Li, N.; Ye, L. Role of COX-2/PGE2 signaling pathway in the apoptosis of rat ovarian granulosa cells induced by MEHP. Ecotoxicol. Environ. Saf. 2023, 254, 114717. [Google Scholar] [CrossRef]
- Parvathareddy, S.K.; Siraj, A.K.; Annaiyappanaidu, P.; Al-Sobhi, S.S.; Al-Dayel, F.; Al-Kuraya, K.S. Prognostic Significance of COX-2 Overexpression in BRAF-Mutated Middle Eastern Papillary Thyroid Carcinoma. Int. J. Mol. Sci. 2020, 21, 9498. [Google Scholar] [CrossRef]
- Husain, M.A.; Smith, R.; Sorge, R.E.; Kaimari, A.; Si, Y.; Hassan, A.Z.; Guha, A.; Smith, K.A.; Cardozo, C.P.; DeBerry, J.J.; et al. Inhibition of the RNA Regulator HuR Mitigates Spinal Cord Injury by Potently Suppressing Post-Injury Neuroinflammation. FASEB J. 2025, 39, e70588. [Google Scholar] [CrossRef]
- Matsuo, T.; Miyata, Y.; Asai, A.; Sagara, Y.; Furusato, B.; Fukuoka, J.; Sakai, H. Green Tea Polyphenol Induces Changes in Cancer-Related Factors in an Animal Model of Bladder Cancer. PLoS ONE 2017, 12, e0171091. [Google Scholar] [CrossRef]
- Ohnishi, M.; Yukawa, R.; Akagi, M.; Ohsugi, Y.; Inoue, A. Bradykinin and interleukin-1β synergistically increase the expression of cyclooxygenase-2 through the RNA-binding protein HuR in rat dorsal root ganglion cells. Neurosci. Lett. 2019, 694, 215–219. [Google Scholar] [CrossRef] [PubMed]
- Tompkins, V.S.; Valverde, D.P.; Moss, W.N. Human regulatory proteins associate with non-coding RNAs from the EBV IR1 region. Bmc Res. Notes 2018, 11, 139. [Google Scholar] [CrossRef] [PubMed]
- Yoo, J.; Kang, J.; Lee, H.N.; Aguilar, B.; Kafka, D.; Lee, S.; Choi, I.; Lee, J.; Ramu, S.; Haas, J.; et al. Kaposin-B enhances the PROX1 mRNA stability during lymphatic reprogramming of vascular endothelial cells by Kaposi’s sarcoma herpes virus. PLoS Pathog. 2010, 6, e1001046. [Google Scholar] [CrossRef] [PubMed]
- Kamble, N.; Gurung, A.; Kaufer, B.B.; Pathan, A.A.; Behboudi, S. Marek’s Disease Virus Modulates T Cell Proliferation via Activation of Cyclooxygenase 2-Dependent Prostaglandin E2. Front. Immunol. 2021, 12, 801781. [Google Scholar] [CrossRef]
- Lee, S.Y.; Choi, H.K.; Lee, K.J.; Jung, J.Y.; Hur, G.Y.; Jung, K.H.; Kim, J.H.; Shin, C.; Shim, J.J.; In, K.H.; et al. The immune tolerance of cancer is mediated by IDO that is inhibited by COX-2 inhibitors through regulatory T cells. J. Immunother. 2009, 32, 22–28. [Google Scholar] [CrossRef]
- Cha, J.D.; Li, S.; Cha, I.H. Association between expression of embryonic lethal abnormal vision-like protein HuR and cyclooxygenase-2 in oral squamous cell carcinoma. Head Neck 2011, 33, 627–637. [Google Scholar] [CrossRef]
- Lim, S.J.; Lee, S.H.; Joo, S.H.; Song, J.Y.; Choi, S.I. Cytoplasmic expression of HuR is related to cyclooxygenase-2 expression in colon cancer. Cancer Res. Treat. 2009, 41, 87–92. [Google Scholar] [CrossRef]
- Lim, S.J.; Kim, H.J.; Kim, J.Y.; Park, K.; Lee, C.M. Expression of HuR is associated with increased cyclooxygenase-2 expression in uterine cervical carcinoma. Int. J. Gynecol. Pathol. 2007, 26, 229–234. [Google Scholar] [CrossRef]
- Sengupta, S.; Jang, B.C.; Wu, M.T.; Paik, J.H.; Furneaux, H.; Hla, T. The RNA-binding protein HuR regulates the expression of cyclooxygenase-2. J. Biol. Chem. 2003, 278, 25227–25233. [Google Scholar] [CrossRef]
- Johann, A.M.; Weigert, A.; Eberhardt, W.; Kuhn, A.M.; Barra, V.; von Knethen, A.; Pfeilschifter, J.M.; Brüne, B. Apoptotic cell-derived sphingosine-1-phosphate promotes HuR-dependent cyclooxygenase-2 mRNA stabilization and protein expression. J. Immunol. 2008, 180, 1239–1248. [Google Scholar] [CrossRef]
- Hsiao, Y.W.; Li, C.F.; Chi, J.Y.; Tseng, J.T.; Chang, Y.; Hsu, L.J.; Lee, C.H.; Chang, T.H.; Wang, S.M.; Wang, D.D.; et al. CCAAT/enhancer binding protein δ in macrophages contributes to immunosuppression and inhibits phagocytosis in nasopharyngeal carcinoma. Sci Signal. 2013, 6, ra59. [Google Scholar] [CrossRef] [PubMed]
- Ding, K.; Yu, Z.H.; Yu, C.; Jia, Y.Y.; He, L.; Liao, C.S.; Li, J.; Zhang, C.J.; Li, Y.J.; Wu, T.C.; et al. Effect of gga-miR-155 on cell proliferation, apoptosis and invasion of Marek’s disease virus (MDV) transformed cell line MSB1 by targeting RORA. BMC Vet Res. 2020, 16, 23. [Google Scholar] [CrossRef] [PubMed]
- Finan, J.M.; Sutton, T.L.; Dixon, D.A.; Brody, J.R. Targeting the RNA-Binding Protein HuR in Cancer. Cancer Res. 2023, 83, 3507–3516. [Google Scholar] [CrossRef] [PubMed]
- Schultz, C.W.; Preet, R.; Dhir, T.; Dixon, D.A.; Brody, J.R. Understanding and targeting the disease-related RNA binding protein human antigen R (HuR). Wiley Interdiscip. Rev. RNA 2020, 11, e1581. [Google Scholar] [CrossRef]
- Majumder, M.; Chakraborty, P.; Mohan, S.; Mehrotra, S.; Palanisamy, V. HuR as a molecular target for cancer therapeutics and immune-related disorders. Adv. Drug Deliv. Rev. 2022, 188, 114442. [Google Scholar] [CrossRef]
- Wu, M.; Tong, C.W.S.; Yan, W.; To, K.K.W.; Cho, W.C.S. The RNA Binding Protein HuR: A Promising Drug Target for Anticancer Therapy. Curr. Cancer Drug Targets 2019, 19, 382–399. [Google Scholar] [CrossRef]
- Xiao, H.; Ye, X.; Vishwakarma, V.; Preet, R. Dixon DACRC-derived exosomes containing the RNAbinding protein HuRpromote lung cell proliferation by stabilizing c-Myc, m.R.N.A. Cancer Biol. Ther. 2022, 23, 139–149. [Google Scholar] [CrossRef]
- Ma, Q.; Xu, C.; Han, X.; Wang, X.; Zhang, W.; Liu, Z.; Wu, R.; Wu, F.; Liu, X.; Zhang, T.; et al. The effects of modified RNA-binding proteins HuR on the biological behavior of the bladder cancer T24 cell line. Transl. Androl. Urol. 2022, 11, 348–357. [Google Scholar] [CrossRef]
- Majumder, M.; Janakiraman, H.; Chakraborty, P.; Vijayakumar, A.; Mayhue, S.; Yu, H.; Dincman, T.; Martin, R.; O’Quinn, E.; Mehrotra, S.; et al. RNA-binding protein HuR reprograms immune T cells and promotes oral squamous cell carcinoma. Oral Oncol. Rep. 2024, 10, 100296. [Google Scholar] [CrossRef]
- Ye, X.; Fu, Q.; Xiao, H. The Role of RNA-Binding Protein HuR in Lung Cancer by RNA Sequencing Analysis. Front. Genet. 2022, 13, 813268. [Google Scholar] [CrossRef]
- Weiße, J.; Rosemann, J.; Krauspe, V.; Kappler, M.; Eckert, A.W.; Haemmerle, M.; Gutschner, T. RNA-Binding Proteins as Regulators of Migration, Invasion and Metastasis in Oral Squamous Cell Carcinoma. Int. J. Mol. Sci. 2020, 21, 6835. [Google Scholar] [CrossRef]
- Raguraman, R.; Shanmugarama, S.; Mehta, M.; Elle Peterson, J.; Zhao, Y.D.; Munshi, A.; Ramesh, R. Drug delivery approaches for HuR-targeted therapy for lung cancer. Adv. Drug Deliv. Rev. 2022, 180, 114068. [Google Scholar] [CrossRef] [PubMed]
- Goutas, D.; Pergaris, A.; Giaginis, C.; Theocharis, S. HuR as Therapeutic Target in Cancer: What the Future Holds. Curr. Med. Chem. 2022, 29, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Peng, J.; Quan, J.; Wang, X. Integrated pan-cancer analysis of RNA binding protein HuR investigates its biomarker potential in prognosis, immunotherapy, and drug sensitivity. PLoS Comput. Biol. 2025, 21, e1013374. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Kim, S.H.; Armaly, A.M.; Aubé, J.; Xu, L.; Wu, X. RNA-binding protein HuR inhibition induces multiple programmed cell death in breast and prostate cancer. Cell Commun. Signal. 2024, 22, 580. [Google Scholar] [CrossRef]
- Almalki, S.G. The pathophysiology of the cell cycle in cancer and treatment strategies using various cell cycle checkpoint inhibitors. Pathol. Res. Pract. 2023, 251, 154854. [Google Scholar] [CrossRef]
- Ghosh, U.; Adhya, S. Posttranscriptional regulation of cyclin D1 by ARE-binding proteins AUF1 and HuR in cycling myoblasts. J. Biosci. 2018, 43, 685–691. [Google Scholar] [CrossRef]
- Jia, M.Y.; Wu, C.; Fu, Z.; Xu, W.B.; Liu, J.; Wu, C.Y.; Zeng, X.Y.; Wu, Y.L.; Yan, H. Targeting the HuR/E2F7 axis synergizes with bortezomib against multiple myeloma. Acta Pharmacol. Sin. 2025, 46, 2296–2309. [Google Scholar] [CrossRef]
- Zhang, Z.; Huang, A.; Zhang, A.; Zhou, C. HuR promotes breast cancer cell proliferation and survival via binding to CDK3 mRNA. Biomed. Pharmacother. 2017, 91, 788–795. [Google Scholar] [CrossRef]
- Huang, Z.; Luo, Y.; Chen, C.; Zhou, C.; Su, Z.; Cai, C.; Li, X.; Wu, W. miR-325-3p Reduces Proliferation Promotes Apoptosis of Gastric Cancer Cells by Inhibiting Human Antigen. R. Can. J. Gastroenterol. Hepatol. 2023, 2023, 6882851. [Google Scholar] [CrossRef]
- Jin, K.; Qian, C.; Lin, J.; Liu, B. Cyclooxygenase-2-Prostaglandin E2 pathway: A key player in tumor-associated immune cells. Front. Oncol. 2023, 13, 1099811. [Google Scholar] [CrossRef]
- Denkert, C.; Koch, I.; von Keyserlingk, N.; Noske, A.; Niesporek, S.; Dietel, M.; Weichert, W. Expression of the ELAV-like protein HuR in human colon cancer: Association with tumor stage and cyclooxygenase-2. Mod. Pathol. 2006, 19, 1261–1269. [Google Scholar] [CrossRef]
- Young, L.E.; Moore, A.E.; Sokol, L.; Meisner-Kober, N.; Dixon, D.A. The mRNA stability factor HuR inhibits microRNA-16 targeting of COX-2. Mol. Cancer Res. 2012, 10, 167–180. [Google Scholar] [CrossRef]
- Karpisheh, V.; Nikkhoo, A.; Hojjat-Farsangi, M.; Namdar, A.; Azizi, G.; Ghalamfarsa, G.; Sabz, G.; Yousefi, M.; Yousefi, B.; Jadidi-Niaragh, F. Prostaglandin E2 as a potent therapeutic target for treatment of colon cancer. Prostaglandins Other Lipid Mediat. 2019, 144, 106338. [Google Scholar] [CrossRef]
- Cai, S.; Gao, Z. Atorvastatin inhibits proliferation and promotes apoptosis of colon cancer cells via COX-2/PGE2/β-Catenin Pathway. J. Buon 2021, 26, 1219–1225. [Google Scholar]





| Name | Primer Sequences (5′ → 3′) | Size (bp) |
|---|---|---|
| gga β-actin Forward primer | TCAACACCCCAGCCATGTAT | 244 |
| gga β-actin Reverse primer | ATTTCTCTCTCGGCTGTGGT | |
| ELAVL1 Forward primer | TACCTCCCCCAGAACATGAC | 220 |
| ELAVL1 Reverse primer | TTGGACGAGCATAGGAAACC | |
| COX-2 Forward primer | GAACCATCCTACCCGCTATTGT | 246 |
| COX-2 Reverse primer | CTATGGGGATTACAATGCGATG | |
| PGE2 Forward primer | CAACAAGTTCAGCCAGAGCGA | 200 |
| PGE2 Reverse primer | CCAGCTTTGTTTTTGCAGAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
He, L.; Zhan, D.-M.; Peng, H.; Gao, M.-R.; Chen, J.; Jia, Y.-Y.; Liao, C.-S.; Chen, S.-B.; Ding, K.; Yu, Z.-H. ELAVL1 Promotes Proliferation and Inhibits Apoptosis of the Marek’s Disease Virus (MDV)-Transformed Cell Line MSB1 via the COX-2/PGE2 Pathway. Animals 2026, 16, 843. https://doi.org/10.3390/ani16050843
He L, Zhan D-M, Peng H, Gao M-R, Chen J, Jia Y-Y, Liao C-S, Chen S-B, Ding K, Yu Z-H. ELAVL1 Promotes Proliferation and Inhibits Apoptosis of the Marek’s Disease Virus (MDV)-Transformed Cell Line MSB1 via the COX-2/PGE2 Pathway. Animals. 2026; 16(5):843. https://doi.org/10.3390/ani16050843
Chicago/Turabian StyleHe, Lei, Dong-Mei Zhan, Hui Peng, Meng-Ru Gao, Jian Chen, Yan-Yan Jia, Cheng-Shui Liao, Song-Biao Chen, Ke Ding, and Zu-Hua Yu. 2026. "ELAVL1 Promotes Proliferation and Inhibits Apoptosis of the Marek’s Disease Virus (MDV)-Transformed Cell Line MSB1 via the COX-2/PGE2 Pathway" Animals 16, no. 5: 843. https://doi.org/10.3390/ani16050843
APA StyleHe, L., Zhan, D.-M., Peng, H., Gao, M.-R., Chen, J., Jia, Y.-Y., Liao, C.-S., Chen, S.-B., Ding, K., & Yu, Z.-H. (2026). ELAVL1 Promotes Proliferation and Inhibits Apoptosis of the Marek’s Disease Virus (MDV)-Transformed Cell Line MSB1 via the COX-2/PGE2 Pathway. Animals, 16(5), 843. https://doi.org/10.3390/ani16050843

