Primary Culture and Characterization of a Crucian Carp (Carassius carassius) Osteoblast Cell Line (COBC) and the Effects of Hypoxia on Its Differentiation

Simple Summary

In this study, an osteoblast cell line was established and characterized from Chongming crucian carp (Carassius carassius), an important aquaculture species from the lower Yangtze River region. The osteoblast cells, named Chongming Carassius carassius osteoblast cells (COBCs), were isolated from vertebral tissue and cultured under optimal conditions. The cells were characterized through various methods, including chromosomal analysis, enzyme assays, and gene expression studies. The COBCs showed typical osteoblastic properties and responded to environmental stress, such as hypoxia–reoxygenation, by altering gene expression and antioxidant enzyme activity. This study provides a valuable cell model for understanding fish bone biology and the effects of environmental stress.

Abstract

In the present study, vertebral bone tissues derived from Chongming crucian carp (Carassius carassius), a dominant species during the summer and autumn seasons on Chongming Island in the lower Yangtze River, were used to establish and characterize a Carassius carassius osteoblast cell line (COBC). The established COBCs were assessed using chromosome analysis, osteocalcin enzyme-linked immunosorbent assay (ELISA), and osteogenesis-related gene expression analysis. Additionally, cellular responses to environmental stress were assessed. The results showed that COBC exhibited optimal proliferation in L-15 medium supplemented with 20% fetal bovine serum at 28 °C. The histochemical staining assay results were all positive, thereby confirming that the isolated cells display typical osteoblast characteristics. Quantitative PCR analysis revealed that osteogenic marker genes, including runx2a and runx2b, were expressed at significantly higher levels in COBCs than in fish tissues. Under hypoxic stress, COBCs exhibited morphological changes, an increase in cell death, significant alterations in gene expression, and variations in antioxidant enzyme activity. These responses facilitate adaptation to hypoxic stress. This study established the first osteoblast cell line of the Chongming crucian carp and characterized its biological properties and response to hypoxic stress. These findings offer a valuable in vitro cell model and technical support for research on fish bone tissue biology and the assessment of environmental stress effects.

1. Introduction

Teleost fish represent important vertebrate models for elucidating the developmental and regulatory mechanisms underlying skeletal formation, providing insights into both evolutionary biology and applied fields such as aquaculture and biomedicine [1]. In vitro cell lines are indispensable experimental tools and have been extensively applied in studies of fish immunology, physiology, genetics, and related disciplines [2,3]. Among them, the osteoblast-specific cell line holds significant value in elucidating the molecular mechanisms of skeletal development and bone formation. It serves as a valuable model for research on skeletal development, stress responses, and potential therapeutic applications. Fish cell culture technology originated in the 1960s, marked by the establishment of the first fish cell line, RTG-22, derived from rainbow trout (Oncorhynchus mykiss) gonadal by Wolf and Quimby [4]. Since then, continuous methodological advances have rendered fish cell culture systems fundamental to modern fish biology research. Currently, fish cell lines have been reported from various tissues and organs, including the liver, kidney, brain, fin, skin, and gonads [5,6,7,8]. Laizé et al.’s research on fish cell lines examined their availability and tissue distribution characteristics, particularly those derived from calcified tissues with osteogenic features [9]. Despite these advances, bone tissue cell lines, especially those exhibiting stable osteogenic properties, remain scarce [9,10,11,12]. Considering the significance of elucidating osteogenesis at the species-specific level, there is an urgent requirement to develop novel osteoblast cell lines from fish strains of considerable local economic and ecological value. The current study aimed to mitigate this scarcity.

The fish bone matrix is highly mineralized and collagen-rich, which complicates tissue digestion and cell isolation because efficient dissociation must be balanced against preservation of cellular integrity [13]. In addition, osteogenesis-related growth factors and signaling pathways display pronounced species specificity in fish, necessitating careful optimization of culture conditions and medium composition [14]. This species specificity is especially pronounced in cyprinid fish [15]. Maintaining osteoblastic differentiation potential and functional stability during long-term in vitro culture therefore remains a major technical challenge. To date, osteoblast culture systems have been reported for only a limited number of cyprinid species [12]. However, cell lines derived from local strains or ecotypes remain particularly scarce, making it difficult to meet the demands of in-depth studies on the molecular mechanisms of osteogenesis. The lack of a local strain-derived model for osteogenesis research highlights the critical gap that this study aims to address.

Bone cells primarily include osteoblasts, osteoclasts and osteocytes. Among these cell types, osteoblasts are the principal effector cells responsible for bone matrix synthesis and mineralization, thereby playing a central role in bone formation, remodeling, and metabolic homeostasis [16,17]. Osteogenesis is tightly regulated by a complex network of transcription factors and signaling pathways and is closely associated with the cellular microenvironment [18]. Previous studies have demonstrated that bone tissue is maintained in a relatively hypoxic microenvironment, where hypoxia inducible factor-1a (hif1a) plays a crucial role in regulating osteoblast metabolism, survival, and differentiation across various species, including mice, rats, and humans [19,20,21].

Hypoxia is of considerable ecological relevance to crucian carp (Carassius carassius), as they are capable of enduring complete anoxia for several months during winter’s low-temperature conditions. This ability is attributed to physiological mechanisms, including substantial glycogen reserves, anaerobic glycolysis for ATP production, and a marked reduction in metabolism. These unique hypoxic adaptation features make crucian carp an excellent model for studying the mechanisms of hypoxia tolerance [22]. Osteoblasts are oxygen-sensitive cells that can adapt to hypoxic conditions through self-regulation [23,24]. Moreover, hypoxia can influence the early-stage differentiation of osteoblasts, hindering their ability to provide the necessary signals for matrix maturation and mineralization [25]. These findings underscore the importance of thoroughly investigating osteoblast cell responses to hypoxic conditions using in vitro models.

Crucian carp, a member of the family Cyprinidae within the order Cypriniformes, is one of the most economically important aquaculture species in China [26]. This species is highly valued because of its rapid growth rate, strong environmental adaptability, and relatively stable genetic background [27]. The Chongming crucian carp, a distinctive strain originating from the lower Yangtze River region, possesses considerable value for genetic resource conservation and applied biological research. However, to date, no studies have reported the establishment of a cell line from Chongming crucian carp. Consequently, this study represents the first documented effort to establish and characterize an osteoblast cell line from this locally important strain, thereby addressing a critical gap in available in vitro models. The resulting cell line, designated Carassius carassius osteoblast cell (COBC), was characterized in terms of morphology, chromosomal karyotype, biological characteristics, and the expression of osteogenesis-related genes. Furthermore, hypoxia treatment experiments were conducted to evaluate the applicability of COBC as an in vitro model for environmental stress studies. Overall, this study establishes a novel in vitro osteoblast cell model and provides a robust experimental platform for investigating skeletal development and osteogenic regulatory mechanisms in fish.

2. Materials and Methods

2.1. Ethics Statement

All animal experiments were approved by the Institutional Animal Care and Use Ethics Committee of Shanghai Ocean University (SHOU-DW-2024-054). All efforts were made to minimize the suffering of the animals. All experiments were performed in accordance with relevant guidelines and regulations.

2.2. Primary Culture and Subculture

The Chongming crucian carp (18–20 g) used in this study were obtained from Chongming District, Shanghai. Osteoblast cells were cultured using a tissue explant culture method. The 4-month-old fish, which had acclimated to indoor water quality conditions for 48 h, were disinfected by immersion in 0.01% potassium permanganate for 20 min. The fish were subsequently anesthetized with 100 mg/L MS-222 for 5 min and transferred to a sterile operating platform, where the body surface was further disinfected with 75% ethanol. Using a sterile scalpel, the caudal fin was removed, and the tail was excised posterior to the cloacal region. The skin, muscle, and associated soft tissues were carefully removed with sterile forceps, retaining only the vertebral column and adjacent connective tissues. After washing the tissue blocks 3–5 times with phosphate-buffered saline (PBS, Beyotime, Shanghai, China), the samples were chopped into approximately 2 mm³ fragments using ophthalmic scissors. This size facilitates effective cell migration and promotes optimal cell viability [28,29]. The minced tissues were moistened with fetal bovine serum (FBS, Gibco, Billings, MT, USA) and transferred into 25 cm² culture flask (Thermo Scientific, Waltham, MA, USA, USA), with roughly 20 fragments placed per flask. Cell information, including tissue source, date, and passage number, was labeled on the side of each flask. To promote initial attachment, the culture flasks were briefly inverted and incubated at 28 °C for 3–4 h, allowing the tissue fragments to remain in close contact with the inner culture surface and preventing displacement during the early attachment phase. Subsequently, the culture flasks were gently inverted [30]. One milliliter of Leibovitz’s L-15 complete medium (L-15, Gibco, Waltham, MA, USA), containing 1% penicillin–streptomycin, 20% FBS, 25 ng/mL epidermal growth factor (EGF), and 25 ng/mL basic fibroblast growth factor (bFGF), was added to support the continued culture of Chongming crucian carp cells. Cell adhesion and proliferation were monitored daily. The medium was refreshed every 2–3 days by replacing one-third of the volume, and cells were designated as the P0 generation once they reached approximately 80% confluence.

Once the primary cells had migrated from the explants and reached ≥80% confluence, subculture procedures were initiated. The cultures were gently rinsed twice with 2 mL of PBS to remove residual medium. Subsequently, 0.5 mL of 0.25% trypsin (Thermo Scientific, Waltham, MA, USA) was added to digest the cells for approximately 5 min. This concentration and time were optimized for efficient cell detachment while preserving cell viability. An equal volume of fresh culture medium was then added to terminate the trypsin digestion, and the cells were centrifuged at 300 × g for 5 min. The resulting cell pellet was resuspended and seeded into two new culture flasks to generate the P1 cell population. Cell morphology was assessed daily, and the medium was renewed every other day. Upon formation of a confluent monolayer, cellular morphology was documented using an inverted fluorescence microscope (DMi3000, Leica, Wetzlar, Germany). The COBCs employed in the present experiment achieved an adequate number of cells following cultivation, thereby rendering them applicable for subsequent biological characterization and other related experimental procedures.

2.3. Cryopreservation and Recovery of Cells

Proliferating cells were treated with trypsin to resuspend them, and an appropriate volume of serum-free cell cryopreservation solution (10% DMSO, CELLSAVING^TM, NCM Biotech, Suzhou, China) was added. The resulting suspension was gently pipetted to achieve homogeneity, transferred into pre-labeled cryovials, and promptly sealed. The cryovials were first cooled at −80 °C overnight and subsequently transferred to liquid nitrogen for long-term preservation. For recovery, the cryovial was removed from liquid nitrogen and rapidly thawed in a 37 °C water bath with gentle agitation to facilitate uniform thawing. The thawed cell suspension was immediately transferred into L-15 medium and gently mixed. The cells were centrifuged at 300× g for 5 min, after which the pellet was resuspended in 2 mL of fresh complete medium. Medium replacement was performed after 24 h once cell adhesion was confirmed.

2.4. Investigation of Optimal Growth Conditions for COBCs

To determine the optimal culture conditions for COBCs, a Cell Counting Kit-8 assay (CCK-8, Sigma-Aldrich, St. Louis, MO, USA) was employed to assess the effects of different medium components on the proliferation of P10 cells. In 96-well plates, 2 × 10³ cells were seeded per well, with the experiment arranged using 3 technical replicates and 3 biological replicates. To ensure smooth adaptation to varying FBS concentrations and minimize potential negative reactions caused by changes in FBS levels, the COBCs were gradually acclimated to different concentrations. Initially, they were cultured in L-15 medium with 5% FBS, and after the adaptation period, they were transferred to L-15 medium with 10% and 15% FBS, respectively. The effects of 5%, 10%, 15%, and 20% FBS supplementation in M-199 and L-15 complete media were evaluated, and all cultures were maintained at 28 °C in a 5% CO₂ incubator. Notably, L-15 medium does not require a CO₂-dependent buffering system. CCK-8 absorbance values were determined at 24, 48, 72, and 96 h to assess cell proliferation.

2.5. Chromosome Analysis of COBCs

COBCs at the 15th passage were cultured for 24 h following subculture. Subsequently, 2 mL of fresh medium containing 1 μg/mL colchicine (Beyotime) was added, and the cells were incubated for 12 h to arrest them in metaphase, inhibit spindle formation, and ensure proper chromosome condensation [31]. After aspirating the culture medium, the cells were trypsinized and then centrifuged at 300× g for 5 min. The cells were resuspended in 5 mL of 0.075 mol/L KCl solution and subjected to hypotonic treatment at 37 °C for 30 min to induce controlled cell swelling for chromosome spreading. Pre-chilled methanol-acetic acid fixative (3:1) was added, and the mixture was gently agitated, with fixation performed three times for 15 min each. Chromosome spreads were prepared using the cold drop method. After the slides naturally air-dried, they were stained with 1× Giemsa stain (Beyotime) for 25 min, after which the stain was discarded, and the slides were rinsed with slow-flowing water on the reverse side. The slides were allowed to air dry at room temperature. Finally, chromosomes were observed under an optical microscope (Nikon, Shinagawa City, Japan) with a 100× oil immersion objective, and images were captured with a Nikon Digital Sight 50M camera.

2.6. Biological Characterization of COBCs

At passage 20 (P20), the cells were observed to have reached a stable and actively proliferating phase, with a sufficient cell number for reliable assessment of their biological characteristics. The COBCs were seeded in a 12-well plate, and when the cell confluence reached approximately 80%, alkaline phosphatase (ALP) staining (Beyotime), Alizarin Red S staining (Sigma-Aldrich, St. Louis, MO, USA), Von Kossa mineralization assay (Beyotime), and Giemsa staining (Solarbio, Beijing, China) were performed for cell staining and imaging. Cells were washed twice with PBS and fixed with 4% paraformaldehyde (PFA, Beyotime) before staining. ALP staining was then conducted according to the manufacturer’s instructions. Briefly, the cells were incubated with ALP staining solution at room temperature in the dark for 10 min. The reaction was stopped by washing twice with distilled water, and the cells were subsequently observed. After adding the mixture (10 mM β-glycerophosphate, 4 mM calcium chloride, and 50 μg/mL L-ascorbic acid) to the culture medium to induce extracellular matrix mineralization in COBCs, Alizarin Red and Von Kossa staining were carried out [12,32]. For Alizarin Red S staining, cells were fixed in 95% ethanol, followed by washing with distilled water. A 1% Alizarin Red S solution was added to the cells and incubated for 20 min, then washed with water to remove non-specific staining. Finally, the cells were observed under a microscope, and mineralized nodules were recorded. For Von Kossa staining, cells were fixed with 4% PFA and washed three times with PBS. According to the instructions, the cells were incubated in 5% silver nitrate solution in the dark for 45 min, followed by exposure to strong light for 15 min. The cells were then washed with distilled water, air-dried, and observed.

To quantify osteocalcin levels in P16 cells, a fish osteocalcin ELISA kit (Shanghai win-win Biotechnology Co., Ltd., Shanghai, China) was employed. Following the color development of the antibody–antigen–enzyme complex, absorbance at 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Varioskan™ LUX, Vantaa, Finland), and the osteocalcin content was determined based on a standard curve.

2.7. Hypoxic Stress in COBCs

P20 COBCs were seeded into culture dishes and exposed to hypoxic conditions for subsequent analyses. Based on preliminary experiments and previous reports, cells were incubated under hypoxic conditions (1% O₂ and 99% N₂) for 0, 12, and 24 h, followed by a 24 h reoxygenation period (r24 h) [32,33,34]. A 1% oxygen concentration is commonly used to simulate moderate hypoxia for fish cells, which mirrors the hypoxic water conditions encountered by many teleosts in their natural habitat [35]. All experiments were performed in triplicate. Samples were collected for morphological observation, gene expression profiling, and enzyme activity determination. Samples designated for gene expression and enzyme activity analyses were immediately snap-frozen in liquid nitrogen and stored at −80 °C until use.

2.8. Antioxidant Enzyme Activity

Collected cell samples were homogenized in stroke-physiological saline solution (SPSS, Beyotime) at 60 Hz using an automatic sample grinder (Shanghai Jingxin Industrial Development Co., Ltd., Shanghai, China) for 120 s. This frequency effectively disrupts the cell structure while maintaining the integrity of the intracellular components. The homogenates were centrifuged at 320× g for 5 min, and the resulting supernatants from each experimental group were collected for subsequent enzyme activity assays. Superoxide dismutase (SOD), catalase (CAT), and lactate dehydrogenase (LDH) activities, as well as glutathione (GSH) levels were quantified using commercial assay kits (Nanjing Jiancheng Biochemical Company, Nanjing, China) and measured with a microplate reader. The absorbance of each detection reaction was measured at a specific wavelength.

2.9. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted from COBCs and fish tissues, including muscle, intermuscular bones, and vertebral bones, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA concentration and purity were determined using a NanoDrop 2000 (Thermo Fisher Scientific). The cDNA was synthesized using the PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Kyoto, Japan), with actb serving as the internal reference gene. Previous studies have demonstrated that the expression of actb remains stable under various experimental conditions in fish [36,37,38]. The primers were designed based on crucian carp cDNA sequences using Primer Premier 5.0 (Premier Biosoft, Palo Alto, CA, USA) and synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China) (

Table 1. Quantitative real-time PCR primers for genes.

Gene	Accession No	Primer Sequence (5′-3′)	Annealing Temperature (°C)
runx2a	XM_026286723.1	F: GCATCCCGGTAGATCCGAG	60.5
		R: GCACCGAGCACAGAAAGTTG
runx2b	XM_026290314.1	F: GCCACTTACCACAGAGCCAT	55.0
		R: CCTCGGGCTCCTACCAGTTC
alp	XM_026261314.1	F: CTGCAAAACGGTGGCTTGAT	61.0
		R: GGCAATATTCCTGTTGAGGTCTT
bglap	XM_059557410.1	F: GAGCGCAGGTCTTCCTGACA	59.0
		R: TCACAGGCCAGGTTTGCTTC
sp7	XM_026212939.1	F: GGGACGGGTTTGGGTTTGTA	60.0
		R: TCAAACGTCCCTCAACCCTC
casp3	XM_026266756.1	F: AAGAGGACGGCATGGTTGAG	57.0
		R: TACCCTGGAGATGTGGCGTA
bcl2	XM_059535005.1	F: ACCGTCAATAAAGGAGTCGAGG	61.5
		R: AGGCATTCAGAGTCATTCCCCC
hif1a	XM_059498850.1	F: CCCTCAAGCAGCAAGAAGTTG	60.0
		R: TCTAGTTTGGTCAGGACTGGGG
actb	XM_059552143.1	F: GCTCTTCCCCATGCAATCCT	58.0
		R: AAAGTCCAGGGCCACATAGC

Notes: F: forward primer, R: reverse primer.

).

The amplification efficiency of all primer pairs ranged from 90% to 110%, which meets the quality criteria for qRT-PCR. The qRT-PCR was performed using SYBR Premix Ex Taq™ II (TaKaRa, Kyoto, Japan) in a total reaction volume of 20 μL, containing 10 μL SYBR Premix, 0.8 μL each of forward (F) and reverse (R) primers (final concentration 0.4 μM), 1 μL cDNA template, and 7.4 μL nuclease-free water. The amplification protocol consisted of an initial denaturation at 94 °C for 30 s, followed by 40 cycles of denaturation at 94 °C for 10 s, annealing at primer-specific temperature (Table 1) for 30 s, and extension at 72 °C for 30 s. All reactions were conducted using a CFX96 Touch real-time PCR fluorescence quantification instrument (Bio-Rad, Hercules, CA, USA). Relative gene expression levels were calculated using the 2^−ΔΔCT method following normalization to actb. The amplification efficiency of all primers was found to be comparable, ensuring the accurate application of the 2^−ΔΔCT method.

2.10. Statistical Analysis

The results are reported as mean ± standard deviation (Mean ± SD). After assessing the normality and homogeneity of variance assumptions using SPSS 25.0, one-way analysis of variance (ANOVA) followed by Duncan’s post hoc test were applied to the experimental data. p < 0.05 was considered statistically significant. Graphics were created using GraphPad Prism 9.5 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Primary Culture and Subculture Observation of COBCs

The growth dynamics of COBCs were monitored under an inverted microscope (Figure 1). At approximately 3 days after primary culture, cells began to migrate outward from the margins of the tissue, displaying predominantly spindle-shaped or polygonal morphologies. By day 7, a distinct proliferative halo had developed around the tissues (Figure 1A). Following subculture, the cells exhibited an increased proliferation rate while maintaining stable morphology (Figure 1B). Subculturing was performed every 2–3 days, and the COBC has since been stably propagated to P37 (Figure 1C). Following cryopreservation and thawing, most cells recovered and returned to normal morphology (Figure S1).

3.2. Effects of Culture Medium Components on the Growth of COBCs

The CCK-8 assay indicated that COBC proliferation differed significantly among the tested FBS concentrations (20%, 15%, 10%, and 5%) in both M-199 and L-15 media (Figure 2). At 72 h, cultures supplemented with 20% FBS showed significantly higher absorbance values than those supplemented with 15%, 10%, or 5% FBS (p < 0.05). In both media, the growth kinetics of COBCs were comparable, with cell numbers reaching a maximum at 72 h and subsequently declining slightly yet remaining above baseline levels (Figure 2). Notably, under the same serum concentration, cell abundance was consistently higher in L-15 medium than in M-199 medium (Table S1).

3.3. Chromosome Analysis

After colchicine treatment, chromosome spreads were prepared from P10 COBCs and examined. Among the 100 metaphase cells analyzed, chromosome numbers ranged from 84 to 102 (Figure 3A). Notably, 56% of the metaphase cells exhibited 100 chromosomes, indicating that the COBCs originate from diploid Chongming crucian carp and possess a modal chromosome number of 100 (Figure 3B).

3.4. Biological Characterization of the COBCs

Giemsa staining showed dark nuclei with visible nucleoli, which were predominantly located in the central region of the cells (Figure 4A). Alizarin Red S staining revealed red-stained mineralized nodules in P20 COBCs, with focal aggregates observed in localized areas (Figure 4B). ALP staining showed cytoplasmic precipitates in positive cells (Figure 4C). Von Kossa staining further demonstrated black precipitates in mineralized regions (Figure 4D).

For the fish osteocalcin ELISA, absorbance at 450 nm was measured to generate a standard curve (Figure S2). Based on this curve, the average osteocalcin content was 36,884 ng/L.

3.5. Gene Expression Analysis

The qPCR analysis demonstrated that all five genes—runx2a, runx2b, alp, bglap, and sp7—were detectable in COBCs. Gene expression in COBCs was significantly higher than in the fish tissues of Chongming crucian carp (p < 0.01, Figure 5).

3.6. Effects of Hypoxic Stress on COBCs

Compared to the normoxic control group (0 h) (Figure 6A), COBCs exhibited a significant reduction in cell number and an increase in cell death after 12 h of hypoxic exposure, with the extent of cell death further increasing after 24 h of hypoxia (Figure 6B,C). After 24 h of reoxygenation, cell morphology and density partially recovered, with fibroblast-like cells becoming the predominant cell type compared to the hypoxic group (Figure 6D).

3.7. Gene Expression Responses of COBCs Under Hypoxia and Reoxygenation

The mRNA expression levels of osteogenesis-related genes runx2a, runx2b, and sp7 in COBCs were significantly downregulated under acute hypoxic conditions compared with the normoxic control at all time points. The lowest expression levels were observed after 24 h of hypoxia (p < 0.001). After 24 h of reoxygenation, the expression of these genes showed partial recovery but remained significantly lower than control levels (p < 0.05, p < 0.01; Figure 7A–C).

The hypoxia-related gene bcl2 displayed a similar expression pattern, characterized by suppression under hypoxia and partial recovery following reoxygenation (Figure 7E). In contrast, the expression levels of casp3 and hif1a increased progressively with prolonged hypoxic exposure (p < 0.001; Figure 7D,F). After 24 h of reoxygenation, casp3 expression returned to baseline levels comparable to the normoxic control (p > 0.05; Figure 7D), whereas hif1a expression remained significantly elevated (Figure 7F).

3.8. Enzyme Activity of COBCs

Enzyme activity assays demonstrated that the activities of SOD and CAT in COBCs decreased progressively with increasing hypoxia duration compared with the normoxic control (p < 0.05). Following 24 h of reoxygenation, SOD and CAT activities recovered to levels that were not significantly different from those of the normoxic group (p > 0.05; Figure 8A,B). The GSH content and LDH activity reached their highest levels after 12 h of hypoxic exposure and subsequently declined after 24 h of reoxygenation, ultimately returning to values comparable to those observed under normoxic conditions (Figure 8C,D).

4. Discussion

In this study, COBC was characterized in terms of cellular morphology, proliferative behavior, osteogenic marker expression, and responses to hypoxia–reoxygenation stress. The tissue explant culture method was applied to establish COBC. This method creates a relatively stable microenvironment for cell migration and adhesion, thereby promoting efficient monolayer formation [13]. Previous studies have demonstrated that long-term in vitro culture of fish cells may lead to chromosomal instability, as a consequence of culture stress and environmental influences [39]. Additionally, during sample preparation, factors such as slight mechanical damage or incomplete chromosome spreading may result in the loss of some chromosomes, leading to cells with varying chromosome numbers. Consequently, the number of COBC chromosomes reported in this study remained within a certain range and was generally consistent with the chromosome number reported for crucian carp somatic cells [40]. However, we did not assess chromosome morphology integrity, and further analysis will be required in the future. The composition of the culture medium and the concentration of serum are widely recognized as critical determinants of fish cell proliferation and growth in vitro [41]. L-15 medium, with its optimized osmotic balance and nutrient composition, is particularly suitable for cells derived from poikilothermic vertebrates [42]. The observed decline in cell proliferative capacity may result from the depletion of essential nutrients (e.g., amino acids and growth factors) in the medium after 72 h of culture. Additionally, the accumulation of metabolic byproducts may disrupt the homeostatic microenvironment required for continued COBC proliferation.

During the early phase of osteoblast differentiation, ALP plays a critical role in extracellular matrix maturation. With further osteogenic maturation, matrix mineralization is subsequently initiated. During the late differentiation stage, the expression of mineralization-related markers, including osteocalcin and osteopontin, is upregulated [43]. Consequently, extracellular matrix calcification and mineralized nodule formation are widely recognized as key indicators of osteoblast functional status and differentiation stage [44]. In the present study, COBCs exhibited positive ALP staining, as well as positive Alizarin Red S and von Kossa staining, indicating mineralized matrix deposition. These histochemical findings are consistent with osteoblastic characteristics [45]. However, additional mineralization assays are warranted in future investigations to further strengthen the functional evaluation of osteogenic capacity. Osteocalcin, a well-recognized marker of late-stage osteoblast differentiation and bone matrix maturation, is selectively secreted by osteoblasts and plays a critical role in regulating bone metabolism [46]. It should be noted that the ELISA kit used in this study does not distinguish between the paralogous genes bglap and bglapl. Therefore, the measured protein content represents the combined osteocalcin levels derived from both gene products.

Runx2 is widely regarded as the master transcriptional regulator of osteoblast differentiation, and in teleost fish, it exists as two isoforms, runx2a and runx2b. These isoforms exert distinct and stage-specific regulatory roles across different tissues and developmental stages [47]. Runx2 protein directly activates the transcription of multiple osteogenic genes by binding to osteoblast-specific cis-acting elements (OSEs), including osteocalcin, osteopontin (Opn), bone sialoprotein (Bsp), and type I collagen [48,49]. Acting downstream of Runx2, Sp7 protein is an indispensable transcription factor required for osteoblast lineage commitment, and loss of its function results in a complete failure of bone formation [50]. The bglap gene is widely recognized as a molecular marker of late-stage osteoblast maturation and mineral deposition [51]. Compared with the corresponding fish tissues, osteogenesis-related genes in COBCs, including sp7 and bglap, were significantly upregulated. This elevated expression may reflect activation of osteogenic transcriptional programs under in vitro culture conditions [52,53].

Oxygen deprivation profoundly alters cellular gene expression profiles and energy metabolism [54,55]. In the present study, hypoxic treatment was applied to proliferating COBCs under standard culture conditions rather than to cells undergoing mineralization induction. Therefore, the observed suppression of osteogenesis-related genes (e.g., runx2a, runx2b, and sp7) likely reflects altered osteoblast-like cellular responses to hypoxic stress rather than direct evidence of impaired osteoblast differentiation [56]. Furthermore, the upregulation of hif1a and casp3 suggests activation of hypoxia-responsive and apoptosis-related pathways [57]. The increase in apoptosis may partially account for the reduced expression of osteogenic markers. However, additional experiments are warranted to distinguish direct hypoxic regulation from secondary effects associated with cell death. Comparable hypoxia-induced apoptotic responses have been reported in multiple fish cell types, including osteoclasts and gill cells [34]. Following reoxygenation, COBCs exhibited fibroblast-like morphology. This morphological alteration may represent a stress-associated phenotypic adaptation rather than the emergence of a distinct cell population. Although hypoxia has been reported to induce epithelial-to-mesenchymal transition (EMT) in certain cell systems [58], COBCs are osteoblast-like cells, and whether a comparable process occurs in osteoblasts remains to be elucidated through detailed mechanistic studies.

GSH is a critical intracellular antioxidant that plays a pivotal role in maintaining cellular oxidative homeostasis. GSH content increased after 12 h of hypoxic stress, potentially reflecting an acute compensatory response to elevated reactive oxygen species (ROS) production [59,60]. In contrast, the activities of the antioxidant enzymes SOD and CAT progressively declined with prolonged hypoxia duration, suggesting impairment of the enzymatic antioxidant defense system under sustained oxidative stress [61,62]. The concomitant increase in LDH activity indicates membrane damage and metabolic disruption, which are commonly associated with hypoxia-induced oxidative injury [63]. Collectively, these results suggest that hypoxic stress in COBCs induces a transient antioxidant response (elevated GSH content), followed by a decline in enzymatic antioxidant capacity (reduced SOD and CAT activities) and exacerbated cellular damage (increased LDH activity), indicating progressive disruption of intracellular redox homeostasis under sustained hypoxic conditions. The recovery of SOD and CAT activities following reoxygenation further supports the reversibility of hypoxia-induced oxidative imbalance and suggests a partial restoration of cellular redox equilibrium [64].

5. Conclusions

In summary, COBCs exhibited sustained proliferative capacity under in vitro culture conditions. Positive Alizarin Red S and von Kossa staining indicated mineralized matrix deposition, consistent with an osteoblast-like phenotype. Under hypoxia–reoxygenation treatment, COBCs displayed altered gene expression patterns and changes in oxidative stress-related enzyme activities. These findings suggest that COBCs respond to oxygen fluctuations at both the molecular and cellular levels, supporting their potential utility as an in vitro model for investigating osteoblast-related cellular responses under hypoxic conditions. Nevertheless, additional experiments are warranted to systematically assess their functional stability. Future investigations should incorporate quantitative mineralization assays (e.g., calcium content determination), ALP activity measurements, and integrated analyses of stress responses to clarify the long-term stability of the osteogenic properties of COBCs.