The Combination of Different Dietary Fiber Sources Improves the Growth Performance, Nutrient Digestibility and Intestinal Function in Broilers from 1 to 42 d of Age

Simple Summary

Information about the effects of different dietary fiber combinations on broilers is scarce. The present study evaluated the effects of different combinations of two fiber sources (inulin and cellulose) on growth performance, gastrointestinal tract development, nutrient utilization, and intestinal function in broilers. It contributed a novel way to reducing the frequency of intestinal diseases in broilers following antibiotic prohibition.

Abstract

This experiment was conducted to investigate the effects of combinations of different dietary fiber sources (inulin and cellulose) on broilers from 1 to 42 d of age. A total of 560 Arbor Acres male broilers were randomly divided into seven dietary treatments with eight replicates per treatment and 10 broilers per replicate. A con-soybean control (CON) diet, CON diet supplemented with antibiotics (zinc bacitracin, 50 mg/kg, AB diet), CON diet diluted with 2% of inulin (LNU), CON diet diluted with 1.5% of inulin and 0.5% of cellulose (MIX1), CON diet diluted with 1.0% of inulin and 1.0% of cellulose (MIX2), CON diet diluted with 0.5% of inulin and 1.5% of cellulose (MIX3), and CON diet diluted with 2.0% of cellulose (CEL). Results demonstrated body weight (BW) (d42) and average daily gain (ADG) (d1 to 21, d22 to 42, d1 to 42) were significantly increased (p < 0.05), and the feed-to-gain ratio (F/G) (d1 to 21, d22 to 42, d1 to 42) was markedly decreased (p < 0.01) in the MIX1 group than those in the other treatments. Compared to broilers fed CON, AB, or other diets, broilers fed with the MIX1 diet had markedly improved (p < 0.05) nutrients utilization, lactase and superoxide dismutase (SOD) activities, and mRNA expression levels of jejunal function-related genes (SGLT1, GLUT2, PepT1, GLP-2, and ZO-1), while significantly decreased (p < 0.05) intestinal pH, TNF-α content and IL-6 mRNA level in jejunum at 21 or 42 days of age. Collectively, dietary fiber was included in broiler diets at a total level of 2%, and the MIX1 combination (combining 1.5% of inulin and 0.5% of cellulose) promoted growth performance, nutrient digestibility, and intestinal function, and this diet may be a potential alternative to antibiotics.

1. Introduction

Poultry lacks endogenous enzymes to digest β-1-4, β-1-3 and β-1-6 linkages of dietary fiber (DF). Traditionally, DF has been regarded as a nutrient concentration diluent and an anti-nutritional factor affecting feed intake and nutrient digestibility [1,2]. However, increasing evidence found that DF could contribute a positive impact on poultry growth performance [3,4,5], gizzard development [6], digestive tract traits [7], intestinal morphology [8], and microbial populations [9]. Of note, when the content of DF was high, this would impair chickens’ growth performance [10], while a moderate level of DF in poultry diets could increase chyme retention time in the upper part of the gastrointestinal tract (GIT), stimulating endogenous enzyme production and gizzard development, improving the digestibility of nutrients [11].

In general terms, DF can be classified based on its solubility in water. Soluble fiber sources such as arabinoxylans from wheat and rye, pectins from fruits and sugar beet pulp, β-glucans from barley and oats, and inulin from chicory and Jerusalem artichoke increase digesta viscosity and decrease the rate of nutrient absorption [9]. In contrast, insoluble fiber is rich in sunflower hulls and oat hulls, which pass through the intestine undigested and increase the digesta passage rate [12]. It has been demonstrated that the supplementation of different fiber sources (soluble or insoluble) in the diets has beneficial effects for poultry [13]. The soluble fiber is more rapidly fermented as compared with insoluble fiber, and the addition of soluble fiber to a broiler diet drastically increased SCFA production in the ileum [13]. Additionally, several studies showed that insoluble fiber sources could improve digestive tract development and function, resulting in promoted chicken health and growth performance [14,15]. However, to our best knowledge, no previous studies have evaluated the potential effects of mixtures of soluble and insoluble fibers in different combinations that may improve poultry health and productivity. Inulin is a typical soluble fiber, which has been observed to promote a beneficial shift in the gut microbiota, leading to a reduction in pathogenic species and an increase in Lactobacillus abundance [16]. Cellulose is a typical representative of insoluble fiber; the use of diets including cellulose promotes poultry digestive organ development, especially gizzard activity, and improves bile acids and enzyme secretion [14,17]. We hypothesized that the addition of fiber sources with inulin and cellulose in an appropriate combination may be more beneficial than a single addition for broiler performance.

Therefore, the objective of this experiment was to investigate the effect of different combinations of inulin and cellulose on performance, GIT development, nutrient digestibility and intestinal function in broilers from 1 to 42 d of age. Furthermore, an antibiotic-treated group was carried out to evaluate whether the mixtures of inulin and cellulose can replace antibiotics in promoting the growth and health of broilers.

2. Materials and Methods

2.1. Animals

In total, 560 one-day-old male AA broilers with an initial body weight (BW) of 47 g ± 0.16 were obtained from a commercial farm and housed. The broilers were in a temperature and light-controlled house, and were weighed in groups and randomly assigned to seven dietary treatments with 8 replicate pens per treatment and 10 broilers per pen. Each pen (180 cm long × 120 cm wide × 60 cm high) was equipped with a single nipple drinker. Broilers were allowed ad libitum access to water and feed. The room temperature was initially set at 33 °C for the first week and gradually reduced to 24 °C by the end of the experiment.

2.2. Diets and Experimental Design

Diets were formulated to meet or exceed the nutritional recommendations NRC (1994) for broilers from 1 to 42 d [18]. All diets were administered in mash form. Inulin and cellulose are added in different combinations, with the total addition ratio being 2%. There were seven experimental diets, a con-soybean control (CON) diet, CON diet supplemented with antibiotics (zinc bacitracin, 50 mg/kg, AB diet), 2% inulin was substituted for Zeolite powder in the CON diet (INU diet), 1.5% of inulin and 0.5% of cellulose substituted for Zeolite powder in the CON diet (MIX1 diet), 1.0% of inulin and 1.0% of cellulose substituted for Zeolite powder in the CON diet (MIX2 diet), 0.5% of inulin and 1.5% of cellulose substituted for Zeolite powder in the CON diet (MIX3 diet), and 2.0% of cellulose substituted for Zeolite powder in the CON diet (CEL diet). The compositions of ingredients and the calculated nutrients of diets are presented in

Table 1. Ingredient and nutrient compositions of the experiment diets (as-fed basis; 1–21 d).

Ingredients, %	Control Group	Inulin and Cellulose Combination Group
Corn	54.40	54.40
Soybean meal	28.00	28.00
Corn gluten meal	8.00	8.00
Soybean oil	2.80	2.80
Limestone	1.50	1.50
Calcium hydrogen phosphate	2.20	2.20
L-lysine, 78%	0.23	0.23
DL-Methionine, 99%	0.12	0.12
Zeolite powder	2.00	—
Inulin/Cellulose	—	2.00
Mineral premix 1	0.25	0.25
Vitamin premix 2	0.05	0.05
NaCl	0.30	0.30
Choline Chloride, 50%	0.15	0.15
Total	100.00	100.00
Calculated nutrient level
CP, %	22.00
ME, MJ/kg	12.40
Lys, %	1.15
Met, %	0.50
Thr, %	0.80
Trp, %	0.22
Ca, %	1.14
AP, %	0.45

¹ Supplemented following per kilogram of diet: Cu (CuSO₄·5H₂O), 8 mg; Fe (FeSO₄·7H₂O), 80 mg; Zn (ZnSO₄·7H₂O), 40 mg; Mn (MnSO₄·H₂O), 60 mg; Se (NaSeO₃), 0.15 mg; iodine (KI), 0.35 mg. ² Provided the following per kilogram of diet: 1500.00 IU vitamin A (Retinyl acetate), 200.00 IU vitamin D3, 10.00 IU vitamin E (all-rac-a-tocopheryl acetate), 0.50 mg vitamin K3, 1.80 mg vitamin B1, 3.60 mg vitamin B2, 3.50 mg vitamin B6, 0.01 mg vitamin B12, 0.15 mg biotin, 0.55 mg folate, 35.00 mg nicotinic acid, 10.00 mg pantothenic acid.

and

Table 2. Ingredient and nutrient compositions of the experiment diets (as-fed basis; 22–42 d).

Ingredients, %	Control Group	Inulin and Cellulose Combination Group
Corn	59.30	59.30
Soybean meal	22.70	22.70
Corn gluten meal	8.00	8.00
Soybean oil	4.00	4.00
Limestone	1.20	1.20
Calcium hydrogen phosphate	1.70	1.70
L-lysine, 78%	0.23	0.23
DL-Methionine, 99%	0.12	0.12
Zeolite powder	2.00	—
Inulin/Cellulose	—	2.00
Mineral premix 1	0.25	0.25
Vitamin premix 2	0.05	0.05
NaCl	0.30	0.30
Choline Chloride, 50%	0.15	0.15
Total	100.00	100.00
Calculated nutrient level
CP, %	20.00
ME, MJ/kg	13.00
Lys, %	1.02
Met, %	0.48
Thr, %	0.73
Trp, %	0.19
Ca, %	0.91
AP, %	0.36

¹ Provided the following per kilogram of diet: Cu (CuSO₄·5H₂O), 8 mg; Fe (FeSO₄·7H₂O), 80 mg; Zn (ZnSO₄·7H₂O), 90 mg; Mn (MnSO₄·H₂O), 70 mg; Se (NaSeO₃), 0.15 mg; iodine (KI), 0.4 mg. ² Supplemented following per kilogram of diet: 1500.00 IU vitamin A (Retinyl acetate), 200.00 IU vitamin D3, 10.00 IU vitamin E (all-rac-a-tocopheryl acetate), 0.50 mg vitamin K3, 1.80 mg vitamin B1, 3.60 mg vitamin B2, 3.50 mg vitamin B6, 0.01 mg vitamin B12, 0.15 mg biotin, 0.55 mg folate, 35.00 mg nicotinic acid, 10.00 mg pantothenic acid.

. The purity of inulin (the degree of polymerization of 2–60, and an average of 12) and cellulose was 85% and 99% respectively, and were purchased from VILOF Group Co., Ltd. (Beijing, China) and Tianli Medical Supplements Co., Ltd. (Qufu, China), respectively.

2.3. Growth Performance

The broilers were determined at d 1, 21, and 42 of age, and feed intake per pen was measured daily to calculate average daily feed intake (ADFI), average daily weight gain (ADG), and the ratio of feed-to-gain (F/G).

2.4. Gastrointestinal Traits

At 21 and 42 days of age, one bird with the average BW of each pen was selected, slaughtered by CO₂ asphyxiation, and individually weighed. The length of the duodenum, jejunum, and ileum was measured, and the relative length of each intestine was calculated according to the following equations: relative length = intestinal length (cm)/body weight (kg). The pH of the proventriculus, gizzard, duodenum, jejunum, ileum, cecum and rectum contents was detected using a digital pH meter (model PHS-3C, Leici Instruments, Shanghai, China).

2.5. Apparent Digestibility

From 17 to 21 days and 38 to 42 days, feces were collected from each pen, added with 10% hydrochloric acid to fix excreta nitrogen after collection, and were dried in a forced-air oven (65 °C) for 72 h. The apparent total tract digestibility was measured using acid-insoluble Ash (AIA) as a digestibility marker. AIA in feces and feed was determined by the method of the Chinese National Standard (GB/T 23742) [19]. Chemical analysis of fecal and feed samples was conducted as follows. DM (method 930.15), Ash (method 942.05), EE (method 945.16), and CP (method 990.03) were assessed according to the procedures of AOAC (2000) [20]. The digestibility was calculated by the following formula: apparent digestibility (%) = (100 − A1/A2 × F2/F1 × 100), in which F1 represents the nutrient content of the feed; F2 represents the nutrient content of the feces; A1 represents the AIA content of the feed; A2 represents the AIA content of the feces.

2.6. Histological Analysis

The villus height and crypt depth were determined according to Touchette et al. (2002) [21]. The jejunum, duodenum, and ileum were washed with cold sterile saline and fixed with 4% paraformaldehyde solution. Then, they were dehydrated and embedded in paraffin wax before transverse sections were cut. The preserved samples were stained with hematoxylin and eosin. Twelve well-oriented parts of the height villi and their adjacent crypts per sample were detected by a NIKON DS-U3 image processing and analyzing system (NIKON ECLIPE CI, Tokyo, Japan) at 40× magnification. The villi height divided by the crypt depth gave the V/C ratio.

2.7. Determination of Enzyme Activity and Cytokine

For the digestive enzyme activity measurement, about 1 g frozen sample of jejunum mucosa was homogenized in ice-cold saline solution (1:9, w/v), centrifuged at 3500× g for 10 min at 4 °C, and stored at −80 °C for further analysis. The content of total protein was determined using the Bradford brilliant blue method. The activities of maltase, sucrase, lactase, lipase, Total antioxidant capacity (T-AOC), Total superoxide dismutase (T-SOD), and Catalase (CAT) were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. The tumor necrosis factor α (TNF-α) and interleukin-10 (IL-10) concentrations in the jejunum were measured using commercial enzyme-linked immunosorbent assay kits (Meimian Co., Ltd., Yancheng, China) according to the manufacturer’s instructions. Each index was tested in triplicate simultaneously on the same plate. In addition, the differences among parallels should be small (the coefficient of variation was less than 10%) to guarantee the repeatability of repeated assessments.

2.8. Gene Expression Related to Intestinal Function

Total RNA was isolated from the frozen jejunum using Trizol reagent (TaKaRa, Kyoto, Japan), following the manufacturer’s procedures. The concentration and purity of the RNA were detected using a NanoDrop ND-2000 spectrophotometer (NanoDrop, Waltham, MA, USA). The OD260/OD280 ratios ranging from 1.8 to 2.0 in all samples were considered suitable for further measurement. The integrity of RNA was measured by agarose gel electrophoresis, and the 28S:18S ribosomal RNA band ratio was evaluated to be ≥1.8. RNA was reverse transcribed into cDNA by the PrimeScriptTM RT reagent kit (TaKaRa, Kyoto, Japan), according to the manufacturer’s methods. Nt kit (TaKaRa, Kyoto, Japan) according to the manufacturer’s guidelines. Expression abundances of intestinal absorption (SGLT-1, sodium/glucose cotransporter 1; GLUT-2, glucose transporter type 2; FATP4, fatty acid transport protein 4; PepT1, peptide transporters 1; EAAT3, excitatory amino acid transporters 3; B0AT, system B0 neutral amino acid transporter), barrier function (ZO-1, zonula occludens 1; Occludin; MUC1, mucin 1; Claudin-1), inflammatory cytokines (TNF-α, tumor necrosis factor α; IL-6, interleukin-6 and IL-10), and growth factors (GLP-2, glucagon-like peptide-2; TGF-β, transforming growth factor-β; IGF-1, insulin-like growth factor-1)-related genes were measured by the Opticon DNA Engine (Bio-Rad, Hercules, CA, USA) and SYBR Green polymerase chain reaction (PCR) reagents (TaKaRa). Primers for the associated genes (

Table 3. Primer sequences used for real-time quantitative PCR.

Target Gene 1	Forward Primer, 5′–3′	Reverse Primer, 5′–3′	Accession Number.	Product Length, bp
β-actin	F: GATTTCGAGCAGGAGATGGC	R: GCCAATGGTGATGACCTGAC	L08165.1	199
GLUT2	F: CACACTATGGGCGCATGCT	R: ATTGTGCCTGGAGGTGTTGGT	NM_207178	113
SGLT1	F: GCCATGGCCAGGGCTTA	R: CAATAACCTGATCTGTGCACCAGTA	NM_001293240.1	141
FATP4	F: GACTCAGGGCTTCCTTCTCCT	R: CATCACCATCTCCAACTCCAAG	FJ868804	126
PepT1	F: CCCCTGAGGAGGATCACTGTT	R: CAAAAGAGCAGCAGCAACGA	NM_204365.1	167
EAAT3	F: TGCTGCTTTGGATTCCAGTGT	R: AGCAATGACTGTAGTGCAGAAGTAATATATG	XM_424930.5	171
B0AT	F: GGGTTTTGTGTTGGCTTAGGAA	R: TCCATGGCTCTGGCAGAGAT	XM_419056.4	167
TGF-β	F: TCATCACCAGGACAGCGTTA	R: TGTGATGGAGCCATTCATGT	NM_001031045.3	177
IGF-1	F: CACCTAAATCTGCACGCT	R: CTTGTGGATGGCATGATCT	NM_001004384.2	140
GLP-2	F: AAGCTTCCCAGTCTGAACCA	R: ATCCTGAGCTCGTCTGCTGT	NM_205260.4	149
MUC1	F: CAGAGATGTGGTGGCAAAAGC	R: CCCTTATCACCACTTGCAGGAA	XM_430395	120
Occludin	F: CCTCATCGTCATCCTGCTCT	R: GGTCCCAGTAGATGTTGGCT	NM_205128.1	113
Claudin-1	F: AAGTGCATGGAGGATGACCA	R: GCCACTCTGTTGCCATACCA	NM_001013611.2	119
ZO-1	F: TATGAAGATCGTGCGCCTCC	R: GAGGTCTGCCATCGTAGCTC	XM_015278981.1	131
TNF-α	F: GGACAGCCTATGCCAACAAG	R: CGCTCCTGACTCATAGCAGA	AY765397.1	226
IL-10	F: CTCTGAGCACAGTCGTTTGG	R: TCGTCTGGTGTTTGCAGTTG	NM_001004414.4	150
IL-6	F: ACAGTCTGACAGAACGGTGT	R: GCTGTTGCCATTGCTGAAAC	NM_204628.2	112

¹ GLUT-2, glucose transporter type 2; SGLT-1, sodium/glucose cotransporter 1; FATP4, fatty acid transport protein 4; PepT1, peptide transporters 1; EAAT3, excitatory amino acid transporters 3; B0AT, system B0 neutral amino acid transporter; TGF-β, transforming growth factor-β; IGF-1, insulin-like growth factor-1; GLP-2, glucagon-like peptide-2; MUC1, mucin 1; ZO-1, zonula occludens 1; TNF-α, tumor necrosis factor α; IL-10, interleukin-10.

) were designed by Primer 6 software (PREMIER Biosoft International, Palo Alto, CA, USA) and commercially synthesized by Sangon Biotech Ltd. (Shanghai, China). The quantitative real-time PCR was detected on an ABI Prism 7000 detection system in a two-step protocol with SYBR Green (Applied Biosystems, Foster City, CA, USA). Each reaction was contained in a volume of 1 μL cDNA, 0.4 μL of each forward and reverse primer, 0.2 μL ROX reference dye (50×), 5 μL SYBR Premix Ex Taq TM (2×), and 3 μL PCR-grade water. The PCR conditions were the initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s, then annealing at 60 °C for 25 s, and a 72 °C extension step for 5 min. A melting curve analysis was performed following each quantitative real-time PCR determination to verify the specificity of the reactions. The housekeeping gene β-actin was chosen as the reference gene to normalize the mRNA expression of target genes. Gene expression data of replicate samples were computed by the 2^−ΔΔCT method [22]. The relative level of the target genes in the CON group was treated as to be 1.0. Each sample was determined in triplicate.

2.9. Statistical Analysis

The effect of dietary treatments on these parameters was analyzed by one-way analysis of variance (ANOVA) using SAS 9.4 (SAS Institute, Inc.; Cary, NC, USA) and Tukey’s tests were used to analyze these experimental data. For data on growth performance and nutrient digestibility, the pen was defined as an experimental unit for the trial. For other indicators, each broiler was regarded as the statistical unit. The results were presented as means and standard error of the mean (SEM). Statistical significance was considered significant as p < 0.05, and trends were considered at 0.05 ≤ p < 0.10.

3. Results

3.1. Growth Performance

The effect of different DF combinations on the growth performance of broilers is shown in

Table 4. Effects of different combinations of inulin and cellulose on the growth performance of broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
BW d 0	0.47	0.47	0.47	0.46	0.47	0.47	0.47	0.02	0.94
BW d 21	0.56 ab	0.55 ab	0.57 a	0.56 ab	0.52 c	0.54 bc	0.56 ab	0.01	<0.01
BW d 42	2.11 ab	2.03 b	2.14 ab	2.21 a	2.07 b	2.08 ab	2.09 ab	0.04	0.01
1–21 d
ADFI (g/d)	38.34	37.60	38.51	37.60	36.75	37.21	38.01	0.61	0.41
ADG (g/d)	24.61 a	24.28 ab	24.99 a	24.55 a	22.45 b	23.65 a	24.52 a	0.43	<0.01
F/G (g/g)	1.56 b	1.55 b	1.54 b	1.53 b	1.64 a	1.57 b	1.55 b	0.01	<0.01
22–42 d
ADFI (g/d)	124.95	122.09	126.99	130.06	130.42	129.98	129.76	2.44	0.15
ADG (g/d)	72.03 ab	68.62 b	72.62 ab	78.30 a	75.03 ab	73.07 ab	72.85 ab	1.70	0.02
F/G (g/g)	1.73 ab	1.79 a	1.75 a	1.66 b	1.74 ab	1.78 a	1.78 a	0.02	<0.01
1–42 d
ADFI (g/d)	82.65	80.30	83.77	84.36	82.23	83.47	83.60	1.22	0.16
ADG (g/d)	49.12 ab	47.25 b	49.73 ab	51.40 a	48.12 b	48.56 ab	48.67 ab	0.86	0.01
F/G (g/g)	1.68 ab	1.70 a	1.69 ab	1.64 b	1.71 a	1.72 a	1.72 a	0.01	<0.01

a–c Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

. At day 21, the BW of both the INU and MIX1 groups was significantly higher than that of the MIX2 group (p < 0.01). At day 42, the BW of the MIX1 group was the highest and significantly higher than that in the AB and MIX2 groups (p < 0.05). The ADG of the MIX1 group from day 1 to 21 was significantly higher than that of the MIX2 group (p < 0.01), and the F/G of the MIX1 group was the lowest and significantly lower than that of the MIX2 group (p < 0.01). The ADG of the MIX1 group from day 22 to 42 and from day 1 to 42 was the highest and significantly higher than those in the AB and MIX2 groups (p < 0.05). Additionally, the F/G of the MIX1 group from day 22 to 42 and from day 1 to 42 was the lowest and significantly lower than those in the AB, INU, MIX2, MIX3, and CEL groups (p < 0.01).

3.2. Gastrointestinal Tract Development

As shown in

Table 5. Effects of different combinations of inulin and cellulose on the relative length of the small intestine in broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
Relative length, cm/kg 21 d
Small intestine	199.61	210.44	215.81	208.87	228.00	216.23	215.02	7.08	0.21
Duodenum	37.68	38.24	40.56	41.02	40.61	37.62	39.66	1.79	0.31
Jejunum	82.34	82.91	88.59	83.45	92.95	88.72	91.14	3.39	0.18
Ileum	79.59	85.29	86.66	84.39	92.45	89.90	84.22	3.20	0.15
Relative length, cm/kg 42 d
Small intestine	70.08	72.08	66.00	70.65	73.57	72.86	76.74	2.56	0.15
Duodenum	13.77	13.70	12.69	13.45	13.18	13.61	13.44	0.65	0.91
Jejunum	29.61	31.04	27.31	29.78	30.78	30.66	32.46	1.29	0.20
Ileum	26.70	27.34	26.01	27.42	29.61	28.59	30.84	1.28	0.13

¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

, at day 21, the relative length of the duodenum in the MIX1 group was the highest among all treatments. Compared with the CEL group, the pH of the jejunum in the MIX1 group at d 21 was significantly decreased (p < 0.05), and the pH of the ileum in the MIX1 group at d 21 was also significantly lower than that in the MIX3 group (p < 0.05) (

Table 6. Effect of different combinations of inulin and cellulose on the gastrointestinal pH of broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
Proventriculus	2.99	3.89	2.94	3.78	3.13	3.24	3.04	0.38	0.39
Gizzard	2.62	3.26	2.83	3.17	2.81	2.80	2.71	0.24	0.47
Duodenum	6.17	6.17	6.14	6.21	6.17	6.02	6.13	0.07	0.53
Jejunum	6.17 ab	6.52 ab	6.59 ab	6.04 b	6.39 ab	6.59 ab	6.66 a	0.14	0.02
Ileum	7.00 ab	7.16 ab	6.70 ab	6.52 b	6.99 ab	7.39 a	7.02 ab	0.17	0.02
Cecum	6.66	6.84	6.29	6.43	6.67	6.87	6.63	0.15	0.12
Rectum	6.78	7.17	7.07	6.93	6.97	7.30	7.19	0.16	0.28
42 d
Proventriculus	2.48	3.13	3.38	2.76	2.82	3.30	2.78	0.31	0.37
Gizzard	2.70	2.68	3.31	2.69	2.71	2.89	2.60	0.21	0.52
Duodenum	6.08	6.18	6.21	6.15	5.99	6.23	6.35	0.10	0.28
Jejunum	6.23	6.26	6.24	6.16	6.15	6.29	6.23	0.08	0.86
Ileum	6.55	6.41	6.43	6.10	6.27	6.47	6.38	0.13	0.31
Cecum	6.38	6.55	6.25	6.52	6.53	6.19	6.52	0.12	0.21
Rectum	6.45	6.43	6.50	6.35	6.42	6.40	6.37	0.13	0.99

a, b Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

).

3.3. Nutrient Digestibility

As presented in

Table 7. Effects of different combinations of inulin and cellulose on the nutrients’ apparent digestibility in broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
DM (%)	67.50 ab	66.71 b	70.14 ab	71.11 a	67.06 b	67.71 ab	70.13 ab	0.91	<0.01
Ash (%)	16.75 c	18.47 c	30.43 ab	33.20 a	22.69 bc	24.43 bc	31.09 ab	1.89	<0.01
EE (%)	66.28 a	65.87 a	68.03 a	69.07 a	57.16 b	64.65 ab	69.83 a	1.83	<0.01
CP (%)	55.19 ab	56.03 ab	59.82 ab	59.49 ab	54.07 b	55.10 ab	62.03 a	1.70	0.02
42 d
DM (%)	70.51 bc	69.22 c	75.31 a	72.48 abc	75.18 a	72.52 abc	74.01 ab	0.84	<0.01
Ash (%)	26.63 bc	25.81 c	36.57 a	35.77 a	35.72 a	32.28 ab	34.78 a	1.45	<0.01
EE (%)	81.69	77.58	80.09	82.04	80.76	81.05	79.79	1.24	0.22
CP (%)	58.28 b	56.83 b	64.48 a	64.60 a	64.16 a	60.71 ab	64.11 a	1.16	<0.01

a–c Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

, at d 21, the apparent digestibility of DM and Ash in the MIX1 group was significantly higher than that in the AB group (p < 0.05), and the apparent digestibility of EE in the MIX1 group was significantly higher than that in the MIX2 group (p < 0.05). Compared with the CON and AB groups, the apparent digestibility of CP and Ash in the MIX1 group at d 42 was significantly increased (p < 0.05), and the apparent digestibility of EE in the MIX1 group at d 42 was the highest among all the treatments.

3.4. Intestinal Morphology

The effect of different DF combinations on the intestinal morphology of broilers is shown in

Table 8. Effects of different combinations of inulin and cellulose on the histomorphology of small intestinal in 21-day broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
Duodenum
Villus height, μm	1548.48	1592.38	1589.31	1615.22	1556.75	1592.80	1476.36	63.79	0.78
Crypt depth, μm	125.51	134.04	122.53	132.62	127.91	118.37	130.04	5.32	0.38
Villus height:crypt depth	12.36	12.04	13.11	12.28	12.23	13.49	11.68	0.68	0.54
Jejunum
Villus height, μm	1328.63	1459.09	1452.41	1497.28	1479.59	1477.17	1413.71	61.72	0.53
Crypt depth, μm	110.63	113.26	109.78	120.04	121.07	118.66	113.95	4.01	0.28
Villus height:crypt depth	12.11	11.60	13.38	12.50	12.04	12.61	12.50	0.73	0.73
Ileum
Villus height, μm	666.91	595.55	609.11	634.31	622.72	672.27	628.22	24.75	0.28
Crypt depth, μm	99.90	96.40	105.81	108.67	103.62	92.90	103.42	8.13	0.83
Villus height:crypt depth	6.61	6.22	5.80	5.98	6.04	7.03	6.33	0.41	0.41

¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

and

Table 9. Effects of different combinations of inulin and cellulose on the histomorphology of small intestinal in 42-day broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
Duodenum
Villus height, μm	1569.56	1514.90	1392.13	1353.44	1450.43	1577.77	1580.12	64.44	0.08
Crypt depth, μm	177.87	137.60	137.25	150.57	161.73	163.78	148.18	11.92	0.19
Villus height:crypt depth	9.09	11.17	10.30	9.38	9.12	10.17	10.77	0.81	0.41
Jejunum
Villus height, μm	1237.08	1339.33	1292.72	1215.52	1337.22	1389.52	1244.21	48.35	0.13
Crypt depth, μm	151.46 ab	158.28 a	131.36 bc	121.51 c	158.97 a	148.04 ab	122.13 c	5.14	<0.01
Villus height:crypt depth	9.58	9.15	9.94	9.94	9.22	9.42	10.61	0.52	0.45
Ileum
Villus height, μm	1046.26	995.23	979.53	1069.37	909.42	979.97	954.07	66.83	0.68
Crypt depth, μm	120.45	98.97	99.05	100.46	108.97	103.72	93.29	7.57	0.25
Villus height:crypt depth	8.77	10.12	10.01	10.90	8.91	9.54	10.19	0.83	0.55

a–c Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

. At day 21, the VH of the duodenum and jejunum in the MIX1 group was the highest among all the treatments. At day 42, compared with the CON, AB, MIX1, and MIX3 groups, the crypt depth of the jejunum was significantly decreased in the MIX1 and CEL groups (p < 0.01).

3.5. The Enzyme Activity and Inflammatory Markers in Jejunum

As shown in

Table 10. Effects of different combinations of inulin and cellulose on the jejunal digestive enzymes of broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
Sucrase (U/mg prot)	76.53 ab	71.38 ab	76.29 ab	83.84 a	73.64 ab	50.37 b	51.61 ab	7.49	0.02
Lactase (U/mg prot)	1.60 b	2.00 ab	2.85 a	2.95 a	1.97 ab	1.35 b	1.51 b	0.24	<0.01
Maltase (U/mg prot)	528.56	516.15	571.70	464.30	400.63	492.17	399.97	62.45	0.40
Lipase (U/g prot)	2.30	1.98	2.75	3.30	1.96	2.08	2.87	0.44	0.25
42 d
Sucrase (U/mg prot)	58.20	60.07	62.25	57.44	54.62	54.01	53.77	2.75	0.24
Lactase (U/mg prot)	1.41 b	1.77 ab	2.17 ab	2.29 a	2.06 ab	2.18 ab	1.50 ab	0.19	<0.01
Maltase (U/mg prot)	288.03	252.99	297.00	346.88	235.86	288.63	289.26	38.50	0.55
Lipase (U/g prot)	1.02	1.02	1.11	1.06	1.06	0.91	1.06	0.09	0.78

a, b Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8.

, compared with the CON group, the MIX1 group significantly increased the lactase activity in the jejunum of broilers at d 21 and 42 (p < 0.05). Compared with the MIX3 group, the MIX1 group significantly elevated jejunal sucrase activity in broilers at d 21 (p < 0.05). Compared with the MIX3 and CEL groups, the MIX1 group significantly increased the T-SOD activity in the jejunum of broilers at d 42 (p < 0.05). Compared with other fiber combinations, the MIX1 and MIX2 groups significantly reduced the TNF-α levels in the jejunum of 42-day-old broilers (p < 0.05) (

Table 11. Effects of different combinations of inulin and cellulose on the antioxidant and inflammatory indicators in the jejunum of broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
T-AOC (mM)	0.30	0.30	0.36	0.30	0.27	0.27	0.28	0.04	0.69
T-SOD (U/mg prot)	515.89	494.24	505.89	551.99	520.02	415.17	436.13	33.93	0.08
CAT (U/g prot)	23.21	26.38	24.44	20.35	20.87	25.00	22.25	2.45	0.56
TNF-α (ng/L)	93.24	89.08	87.81	81.87	88.98	86.24	88.81	4.76	0.78
IL-10 (ng/L)	60.88	57.07	55.29	56.42	59.86	64.78	63.00	3.84	0.54
42 d
T-AOC (mM)	0.33	0.28	0.25	0.27	0.29	0.26	0.28	0.04	0.78
T-SOD (U/mg prot)	560.12 ab	564.04 a	555.01 abc	608.67 a	597.55 a	438.54 c	443.70 bc	26.43	<0.01
CAT (U/g prot)	43.00	45.17	36.17	41.06	37.94	33.64	36.35	3.81	0.33
TNF-α (ng/L)	108.94 ab	108.03 ab	116.79 a	103.55 b	99.12 b	114.84 a	118.16 a	2.40	<0.01
IL-10 (ng/L)	72.37	69.59	73.48	70.09	72.81	72.11	77.50	2.28	0.28

a–c Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8. T-AOC, Total antioxidant capacity; T-SOD, Total superoxide dismutase; CAT, Catalase; TNF-α, tumor necrosis factor α; IL-10, interleukin-10.

).

3.6. Gene Expression Related to Intestinal Function

Compared with the MIX3 and CEL groups, the MIX1 group significantly upregulated the expression of SGLT1 in the jejunum of broilers at d 21 (p < 0.05), and the expression of GLUT2 in the MIX1 group was significantly greater than that in the INU, MIX2, MIX3, and CEL groups (p < 0.05). Compared with the INU group, the MIX1 group significantly increased the expression of PepT1 in the jejunum of broilers at d 42 (p < 0.05) (

Table 12. Effects of different combinations of inulin and cellulose on the mRNA expression of jejunal nutrient transporters in broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
GLUT2	1.00 a	0.70 ab	0.49 b	1.13 a	0.56 b	0.51 b	0.56 b	0.10	<0.01
SGLT1	1.00 ab	0.74 ab	0.67 ab	1.12 a	0.67 ab	0.62 b	0.56 b	0.10	<0.01
FATP4	1.00	0.71	0.72	0.71	0.70	0.72	0.66	0.09	0.14
PepT1	1.00	1.06	1.02	1.14	1.07	1.04	1.06	0.22	0.89
EAAT3	1.00	0.58	0.66	0.70	0.55	0.68	0.51	0.13	0.19
B0AT	1.00	0.48	0.40	0.72	0.62	0.85	0.62	0.14	0.06
42 d
GLUT2	1.00	0.98	0.88	1.02	0.79	0.68	0.86	0.14	0.60
SGLT1	1.00	0.86	0.75	0.70	0.94	0.85	0.73	0.09	0.19
FATP4	1.00	0.96	0.82	0.93	0.82	0.82	0.82	0.08	0.46
PepT1	1.00 ab	1.04 ab	0.88 b	1.75 a	1.00 ab	1.37 ab	1.08 ab	0.17	0.02
EAAT3	1.00	1.00	0.78	0.95	0.79	0.85	0.83	0.13	0.79
B0AT	1.00	0.79	0.80	1.35	0.79	0.88	0.89	0.14	0.08

a, b Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8. GLUT-2, glucose transporter type 2; SGLT-1, sodium/glucose cotransporter 1; FATP4, fatty acid transport protein 4; PepT1, peptide transporters 1; EAAT3, excitatory amino acid transporters 3; B⁰AT, system B⁰ neutral amino acid transporter.

). Compared with the CEL group, the expression of GLP-2 in the jejunum of broilers at d 21 was significantly upregulated in the MIX1 group (p < 0.05), and the MIX1 group significantly decreased the expression of IL-6 in the jejunum of broilers at d 21 relative to the CON group (p < 0.05) (

Table 13. Effects of different combinations of inulin and cellulose on the mRNA expression of jejunal growth factors and inflammatory cytokines in broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
TGF-β	1.00	0.38	0.81	0.86	0.56	0.59	0.60	0.16	0.13
IGF-1	1.00	0.25	0.41	0.57	0.32	0.61	0.27	0.20	0.14
GLP-2	1.00 ab	0.78 ab	0.71 ab	1.27 a	1.07 ab	1.42 a	0.34 b	0.19	0.01
TNF-α	1.00	0.98	0.89	0.95	1.09	1.13	1.00	0.14	0.89
IL-10	1.00	0.68	0.83	0.50	0.90	0.55	0.70	0.20	0.54
IL-6	1.00 a	0.46 b	1.01 a	0.29 b	0.44 b	0.38 b	0.36 b	0.11	<0.01
42 d
TGF-β	1.00	0.85	0.73	0.87	0.78	0.86	0.79	0.15	0.91
IGF-1	1.00	0.86	1.03	1.35	1.13	1.08	0.94	0.32	0.96
GLP-2	1.00	1.39	1.76	1.13	2.02	2.08	1.41	0.41	0.41
TNF-α	1.00	1.22	1.16	1.27	1.41	1.52	1.29	0.13	0.19
IL-10	1.00	0.33	0.37	0.40	0.42	0.49	0.41	0.25	0.55
IL-6	1.00	0.84	0.77	0.59	0.84	0.95	0.89	0.17	0.72

a, b Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8. TGF-β, transforming growth factor-β; IGF-1, insulin-like growth factor-1; GLP-2, glucagon-like peptide-2; TNF-α, tumor necrosis factor α; IL-10, interleukin-10.

). The expression of ZO-1 in the jejunum of the MIX1 group at d 21 and d 42 was significantly higher than that in the AB and MIX2 groups, respectively (p < 0.05) (

Table 14. Effects of different combinations of inulin and cellulose on the mRNA expression related to jejunal barrier function in broilers ¹.

Items	CON	AB	Different Combinations of Inulin and Cellulose					SEM 2	p-Value
			INU	MIX1	MIX2	MIX3	CEL
21 d
MUC1	1.00	0.38	0.78	0.45	0.32	0.55	0.40	0.24	0.41
Occludin	1.00	0.59	0.68	0.89	0.76	0.67	0.71	0.13	0.39
Claudin-1	1.00	0.60	0.69	1.10	0.83	0.88	0.69	0.20	0.54
ZO-1	1.00 a	0.33 bc	0.79 ab	1.08 a	0.47 bc	0.40 bc	0.28 c	0.10	<0.01
42 d
MUC1	1.00	0.46	0.55	0.67	0.66	0.65	0.69	0.21	0.71
Occludin	1.00	0.85	1.04	0.92	0.79	0.98	0.71	0.12	0.39
Claudin-1	1.00	1.44	1.08	1.30	1.29	1.14	1.18	0.25	0.90
ZO-1	1.00 ab	1.25 ab	1.41 ab	1.76 a	0.75 b	1.02 ab	1.17 ab	0.18	0.02

a–c Means in the same row not sharing a common letter differ (p < 0.05). ¹ CON: control group; AB: Antibiotic group; INU: 2% of inulin group; MIX1: 1.5% of inulin and 0.5% of cellulose group; MIX2: 1.0% of inulin and 1.0% of cellulose group; MIX3: 0.5% of inulin and 1.5% of cellulose group; CEL: 2.0% of cellulose group. ² SEM: standard error of mean. n = 8. MUC1, mucin 1; ZO-1, zonula occludens 1.

).

4. Discussion

DF has been explored as a nutritional strategy to reduce the incidence of poultry GIT-related problems [11]. Indeed, feeding a moderate level of fiber in diets has been reported to improve nutrient digestibility and growth performance due to its role in the development of the GIT and to modify the characteristics of the intestinal contents [23]. Of note, previous studies indicate that supplementation of either soluble or insoluble fiber in the diets is beneficial to the health of poultry [13]. Notably, the information about the appropriate DF combination for broilers is poorly understood. As we know, inulin and cellulose are the typical soluble and insoluble fibers, respectively. Therefore, the current study was conducted to reveal the effects of different combinations of inulin and cellulose on the growth performance, nutrient digestibility, and intestinal function, and to establish an appropriate DF combination for broilers. In the present work, we obtained that the F/G of broilers in the MIX1 group was the lowest among all groups during days 1–21, days 22–42, and days 1–42. As F/G was the most important indicator for evaluating the growth of broilers, and considering F/G, we assessed that the diet of inulin/cellulose (1.5%:0.5%) was the best combination. Similarly, previous work indicated that 0.75% soluble fiber +0.25% insoluble fiber-fed piglets had a lower F/G in the whole period [24]. It is suggested that soluble fiber might be more preferable than insoluble fiber to promote the growth performance in broilers. Indeed, we observed that the BW of broilers in the INU group (inulin/cellulose 2.0%:0.0%) was the highest at 21 days of age and significantly higher than that in the MIX2 group (inulin/cellulose 1.0%:1.0%). Interestingly, Sadeghi et al. (2015) reported that supplementing soluble and insoluble fiber in an equal (1.5%:1.5%) ratio impaired growth performance in broilers [2]. In corroboration, we found that the ADG and F/G declined with the MIX2 diet for broilers. Meanwhile, diets containing a pectin/cellulose ratio 2%:1% decreased growth performance at 14 days of age in broilers [25]. This is likely a result of the solubility and fermentative ability of soluble and insoluble fibers. Moreover, the sources, types, and levels of addition of soluble and insoluble fibers may also be the reasons for the differences in the above results. Hence, further research on the appropriate DF combinations for broilers is warranted.

Digestibility is a critical parameter reflecting the degree of nutrient digestion and the growth performance of animals. Improving nutrient digestibility is beneficial for increasing production efficiency. Previous studies observed that compared to the basal diet, the diet with a fiber source could promote the nutrient digestibility in broilers [26,27]. The current study is consistent with the results of those reports; the addition of 2% fiber in the basal diet could increase nutrient digestibility in broilers. In addition, diets containing MIX1 (inulin/cellulose 1.5%:0.5%) increased DM, Ash, and EE digestibility at day 21 and enhanced Ash and CP digestibility at day 42 in broilers. This result corroborates the growth performance of the MIX1 group broilers in the current experiment. Noteworthy, the soluble fiber may increase intestinal viscosity and reduce the rate of feed passage, which in turn decreases the nutrient digestibility and has an influence on the growth performance of poultry [28]. A moderate value of insoluble fiber in poultry diets may increase chyme retention time in the GIT, stimulating endogenous enzyme production, improving the digestibility of starch and lipids [11]. Nevertheless, the EE digestibility of the MIX2 group was not higher than the MIX1 group. The reason may be affected by the interaction between soluble and insoluble fibers. Moreover, fiber can substantially influence hindgut fermentation, which may confound total tract estimates, especially for crude protein. In the future, the apparent nutrient digestibility should be directly measured using ileal digesta collected from the broilers, so as to avoid the influence of cecal microbiota.

The development of the GIT could reflect the digestive function of the body. Adding fiber ingredients, especially insoluble fiber, could modulate the size of the small intestine and cecum [29]. However, we found that the relative length of the small intestine in the MIX1 group at days 21 and 42 was no different from the other groups. The exogenous fiber added in this experiment was 2%, which is below the levels reported in other studies [1,30], and this may be the reason for the insignificant GIT development. Notably, the jejunum and ileum pH of broilers in the MIX1 group at 21 days of age was significantly lower than that in the CEL and MIX3 groups. This result agrees well with previous research reported that both soluble and insoluble DF supplementation resulted in a decrease in intestinal pH of broilers [31,32]. In addition, compared with the CON broilers, the MIX1 group significantly increased the activity of lactase in the jejunum of broilers at 21 and 42 days of age. The greater activity of digestive enzymes is vital for nutrient absorption and body growth [33]. On the other hand, the mRNA expressions of SGLT1, GLUT2, and PepT1 in the jejunum of the MIX1 group were upregulated compared to other treatments. Peptide transport (PepT1), which is H+-dependent, is one of the routes of amino acid assimilation via the enterocyte [34]. Increasing the expression of Na+/glucose co-transporter 1 (SGLT1) and glucose transporter 2 (GLUT2) in the jejunum suggests this could improve nutrient absorption in animals (Zhang et al., 2016 [35]). These indicated that the MIX1 (inulin/cellulose 1.5%:0.5%) diet may improve the intestinal digestive and absorptive function of broilers.

Increasing the villus height in the intestine suggested an improvement of surface area capable of greater absorption of nutrients [36]. The function of intestinal crypts is to secrete digestive juices; crypt depth became shallow, indicating that the maturation rate of cells and the secretion function increased [37]. DF addition has been reported to be beneficial to the intestinal function of poultry [1]. Studies have shown that supplementing with soybean hulls could significantly decrease the crypt depth and increase the villus height of the duodenum, jejunum and ileum in broilers [29,38]. Similar to the above results, in the present study, the crypt depth of the jejunum of broilers in the MIX1 group was significantly lower than that in the CON, AB, MIX2, and MIX3 groups. However, no difference in intestinal villus height was observed using higher, equal, or lower ratios of soluble to insoluble fibers, which is in agreement with a previous report [25]. GLP-2 plays an important role in enhancing protein synthesis and villus height of the small intestine, increasing nutrient digestion and absorption, and improving intestinal development [39]. The result of the current study showed that the mRNA expression level of GLP-2 in the MIX1 group was higher than that in the CEL group. The above results were consistent with the greater nutrient digestibility of broilers in the MIX1group. The tight junction proteins (ZO1) maintain the intestinal barrier function by efficiently preventing the diffusion of antigens and other bacteria through the epithelium [40]. We have found that mRNA expression of ZO1 in the jejunum of the MIX1 group at 21 and 42 days of age was markedly higher than that of the AB and MIX2 groups, indicating that the MIX1 diet may be beneficial for intestinal barrier function. The increase in ZO-1 mRNA level might be caused by the content of soluble fiber, since the ratio of inulin/cellulose in the MIX1 diet was higher than that in the MIX2 diet. Indeed, the expression of ZO-1 mRNA in the INU group was both higher than that in the MIX2, MIX3, and CEL groups at days 21 and 42. In contrast, the soluble fibers also tend to result in viscous conditions in the digestive tract, which may adversely affect intestinal health [13]. More research needs to examine the effect of different combinations of soluble and insoluble fibers on intestinal function in broilers. The anti-inflammatory cytokines (transforming growth factor TGF-β and IL-10) and pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) expressed via enterocytes are the constitutive components of the host innate immune response toward the environment [41]. In the present study, we found that the expression of IL-6 mRNA in the jejunum of broilers at 21 days of age in the MIX1 group was significantly reduced compared to the CON group. Meanwhile, at 42 days of age, the content of TNF-α in the jejunum of broilers in the MIX1 group was significantly lower than that in the other treatments. It suggests that the MIX1 diet might promote the intestinal immune function of broilers. However, Sadeghi et al. (2015) observed that sugar beet pulp and rice hull inclusion in an equal combination (1.5%:1.5%) improved the immunity of broilers [2]. It may be related to the different types of fiber that differ in solubility, structure, viscosity, bulking capacity, water holding capacity, and other physicochemical properties. Thus, the interaction between soluble and insoluble fiber in the diet requires further investigation. The abnormal activity of SOD is an important marker of oxidative stress [42], as SOD has been regarded as the first line of prevention of the deleterious effects of oxyradicals on the cell [43]. In our study, compared with the MIX3 and CEL groups, the MIX1 group significantly increased the T-SOD activity in the jejunum of broilers at 42 days of age. Hence, it may indicate a protective effect of the MIX1 diet on oxidative stress in broilers.

5. Conclusions

The present study demonstrated that 2% dietary supplementation of a mixture of soluble fiber (inulin) with insoluble fiber (cellulose) at a ratio of 1.5%:0.5% improved the growth performance of broilers. Based on the current results on growth performance, nutrient utilization, GIT development, and intestinal function, we concluded that the appropriate combination of inulin and cellulose in diet for broilers from 1 to 42 d of age is the MIX1 diet (inulin/cellulose in a ratio: 1.5%:0.5%), and the fiber combination represents a promising or potential alternative to antibiotics under the low-challenge condition. Moreover, further investigation would be needed to clarify the appropriate combination of inulin and cellulose under different levels and ratios.