Rapid Point-of-Care Detection of Dirofilaria immitis and Dirofilaria repens in Canine Blood Using Two Direct Closed-Tube LAMP Assays
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. LAMP Primer Design
2.2. Preliminary Tests of the Designed Primer Sets
2.3. Direct LAMP Assays Using EDTA Whole Blood
2.4. Validation Study
3. Results
3.1. Selection of Primer Sets
3.2. Direct Amplification from EDTA Whole Blood
3.3. Visual Detection and Relative Diagnostic Performance
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BIP | Backward inner primer |
| BLAST | Basic Local Alignment Search Tool |
| COI | Cytochrome c oxidase subunit I |
| Ct | Cycle threshold |
| D. | Dirofilaria |
| DNA | Deoxyribonucleic acid |
| EDTA | Ethylenediaminetetraacetic acid |
| FIP | Forward inner primer |
| FN | False negative |
| FP | False positive |
| F3 | Forward outer primer |
| B3 | Backward outer primer |
| LAMP | Loop-mediated isothermal amplification |
| LF | Loop forward primer |
| LB | Loop backward primer |
| MEGA | Molecular Evolutionary Genetics Analysis |
| NaCl | Sodium chloride |
| NaOH | Sodium hydroxide |
| NCBI | National Center for Biotechnology Information |
| ND/ND5 | NADH dehydrogenase (subunit 5) |
| NTC | Non-template control |
| PCR | Polymerase chain reaction |
| POC | Point-of-care |
| qPCR | Quantitative real-time polymerase chain reaction |
| TN | True negative |
| TP | True positive |
References
- Genchi, C.; Kramer, L.H.; Rivasi, F. Dirofilarial Infections in Europe. Vector Borne Zoonotic Dis. 2011, 11, 1307–1317. [Google Scholar] [CrossRef]
- Morchón, R.; Carretón, E.; González-Miguel, J.; Mellado-Hernández, I. Heartworm Disease (Dirofilaria immitis) and Their Vectors in Europe—New Distribution Trends. Front. Physiol. 2012, 3, 196. [Google Scholar] [CrossRef]
- Farkas, R.; Mag, V.; Gyurkovszky, M.; Takács, N.; Vörös, K.; Solymosi, N. The Current Situation of Canine Dirofilariosis in Hungary. Parasitol. Res. 2020, 119, 129–135. [Google Scholar] [CrossRef]
- Fuehrer, H.P.; Morelli, S.; Unterköfler, M.S.; Bajer, A.; Bakran-Lebl, K.; Dwużnik-Szarek, D.; Farkas, R.; Grandi, G.; Heddergott, M.; Jokelainen, P.; et al. Dirofilaria spp. and Angiostrongylus vasorum: Current Risk of Spreading in Central and Northern Europe. Pathogens 2021, 10, 1268. [Google Scholar] [CrossRef]
- Karancsi, Z.; Mazzag, B.; Bársony, G.; Szántó, M.; Jerzsele, A. A szívférgesség megelőzésének és kezelésének helyzete a magyarországi állatorvosi praxisokban. Magy. Allatorvosok Lapja 2024, 146, 23–35. [Google Scholar] [CrossRef]
- Boros, G.; Janisch, M.; Sebestyén, G. Dirofilaria immitis kutyában. Magy. Allatorvosok Lapja 1982, 37, 313–316. [Google Scholar]
- Jacsó, O.; Mándoki, M.; Majoros, G.; Pétsch, M.; Mortarino, M.; Genchi, C.; Fok, É. First Autochthonous Dirofilaria immitis (Leidy, 1856) Infection in a Dog in Hungary. Helminthologia 2009, 46, 159–161. [Google Scholar] [CrossRef]
- Vörös, K.; Kiss, G.; Baska, F.; Bagdi, N.; Széll, Z. Szívférgesség kutyában. Magy. Allatorvosok Lapja 2000, 122, 707–716. [Google Scholar]
- Farkas, R.; Gyurkovszky, M.; Lukács, Z.; Aladics, B.; Solymosi, N. Seroprevalence of Some Vector-Borne Infections of Dogs in Hungary. Vector Borne Zoonotic Dis. 2014, 14, 256–260. [Google Scholar] [CrossRef] [PubMed]
- Vörös, K.; Farkas, R. A kutyák szívférgessége. Kamarai Állatorvos 2015, 3, 22–33. [Google Scholar]
- Jerzsele, Á.; Kovács, D.; Fábián, P.; Fehérvári, P.; Paszerbovics, B.; Bali, K.; Kaszab, E.; Mayer, N.; Karancsi, Z. New Insights into the Prevalence of Dirofilaria immitis in Hungary. Animals 2025, 15, 1198. [Google Scholar] [CrossRef]
- Széll, Z.; Sréter, T.; Csikós, K.; Kátai, Z.; Dobos-Kovács, M.; Vetési, F.; Varga, I. Autochton Dirofilaria repens fertőzöttség kutyákban. Magy. Állatorvosok Lapja 1999, 121, 100–104. [Google Scholar]
- Jacsó, O.; Fok, É. A kutyák és macskák Dirofilaria repens fertőzöttségének kimutatása laboratóriumi módszerekkel. Magy. Allatorvosok Lapja 2006, 128, 683–690. [Google Scholar]
- Simón, F.; Siles-Lucas, M.; Morchón, R.; González-Miguel, J.; Mellado, I.; Carretón, E.; Montoya-Alonso, J.A. Human and Animal Dirofilariasis: The Emergence of a Zoonotic Mosaic. Clin. Microbiol. Rev. 2012, 25, 507–544. [Google Scholar] [CrossRef]
- Kemenesi, G.; Kurucz, K.; Kepner, A.; Dallos, B.; Oldal, M.; Herczeg, R.; Vajdovics, P.; Bányai, K.; Jakab, F. Circulation of Dirofilaria repens, Setaria tundra, and Onchocercidae Species in Hungary during the Period 2011–2013. Vet. Parasitol. 2015, 214, 108–113. [Google Scholar] [CrossRef] [PubMed]
- Raele, D.A.; Pugliese, N.; Galante, D.; Latorre, L.M.; Cafiero, M.A. Development and Application of a Loop-Mediated Isothermal Amplification (LAMP) Approach for the Rapid Detection of Dirofilaria repens from Biological Samples. PLoS Negl. Trop. Dis. 2016, 10, e0004789. [Google Scholar] [CrossRef]
- Vörös, K. Állatorvosi belgyógyászat I.—A Kutyák és Macskák Betegségei; Magyar Állatorvosi Kamara: Budapest, Hungary, 2019. [Google Scholar]
- Komáromi, R.G. Kutya Szívférgesség Előfordulásának Retrospektív Vizsgálata Egy Állatorvosi Rendelőben. Doctoral Dissertation, Állatorvostudományi Egyetem Budapest, Budapest, Hungary, 2022. [Google Scholar]
- Genchi, C.; Kramer, L. Subcutaneous Dirofilariosis (Dirofilaria repens): An Infection Spreading throughout the Old World. Parasit. Vectors 2017, 10, 517. [Google Scholar] [CrossRef] [PubMed]
- Gabrielli, S.; Mendoza-Roldan, J.A.; Napoli, E.; De Benedetto, G.; Liapis, D.D.; Cascio, A.; Basile, A.; Iatta, R.; Perles, L.; Pombi, M.; et al. Human Exposure to Dirofilaria immitis Following a Canine Heartworm Disease Elimination Program in Linosa Island (Sicily, Italy). Acta Trop. 2025, 271, 107838. [Google Scholar] [CrossRef]
- Schatz, C.; Füßl, M.; Caf, Y.; Schmitz, K.; Kresse, D.; Ludwig, W.; Walochnik, J.; Knabl, L. A Rare Case Report of a Human Dirofilaria repens Infection. Microorganisms 2025, 13, 476. [Google Scholar] [CrossRef]
- Nelson, C.T.; McCall, J.W.; Jones, S.; Moorhead, A. Highlights of the Current Canine Guidelines for the Prevention, Diagnosis, and Management of Heartworm (Dirofilaria immitis) Infection in Dogs; American Heartworm Society: Wilmington, DE, USA, 2020. [Google Scholar]
- Bowman, D.; Atkins, C. Heartworm Biology, Treatment, and Control. Vet. Clin. N. Am. Small Anim. Pract. 2009, 39, 1127–1158. [Google Scholar] [CrossRef]
- Becker, Z.; Holló, N.; Farkas, R.; Gyurkovszky, M.; Reiczigel, J.; Olaszy, K.; Vári, Z.; Vörös, K. Serodiagnostic Difficulties and Possibilities of Heartworm Disease in Regions Where Both Dirofilaria immitis and Dirofilaria repens Infections Occur. Acta Vet. Hung. 2022, 70, 92–99. [Google Scholar] [CrossRef]
- Aththanayaka, A.M.M.T.B.; Dayananda, B.S.W.M.T.B.; Ranasinghe, H.A.K.; Amarasinghe, L.D. Evolution of Dirofilariasis Diagnostic Techniques from Traditional Morphological Analysis to Molecular-Based Techniques: A Comprehensive Review. Front. Parasitol. 2024, 3, 1427449. [Google Scholar] [CrossRef]
- Pietrzak, D.; Łuczak, J.; Wiśniewski, M. Detecting Dirofilaria immitis: Current Practices and Novel Diagnostic Methods. Pathogens 2024, 13, 950. [Google Scholar] [CrossRef] [PubMed]
- Venco, L.; Manzocchi, S.; Genchi, M.; Kramer, L.H. Heat Treatment and False-Positive Heartworm Antigen Testing in Ex Vivo Parasites and Dogs Naturally Infected by Dirofilaria repens and Angiostrongylus vasorum. Parasit. Vectors 2017, 10, 476. [Google Scholar] [CrossRef] [PubMed]
- Laidoudi, Y.; Davoust, B.; Varloud, M.; Niang, E.H.A.; Fenollar, F.; Mediannikov, O. Development of a Multiplex QPCR-Based Approach for the Diagnosis of Dirofilaria immitis, D. repens and Acanthocheilonema reconditum. Parasit. Vectors 2020, 13, 319. [Google Scholar] [CrossRef]
- Jaratsing, P.; Viseshakul, N.; Areekit, S.; Chansiri, K. Comparative Studies on Nucleic Acid Based Biosensors for Identification of Filarial Nematode. J. Med. Assoc. Thail. 2016, 99, S216–S221. [Google Scholar]
- Tahir, D.; Bittar, F.; Barré-Cardi, H.; Sow, D.; Dahmani, M.; Mediannikov, O.; Raoult, D.; Davoust, B.; Parola, P. Molecular Survey of Dirofilaria immitis and Dirofilaria repens by New Real-Time TaqMan® PCR Assay in Dogs and Mosquitoes (Diptera: Culicidae) in Corsica (France). Vet. Parasitol. 2017, 235, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Kumar, B.; Maharana, B.R.; Brahmbhatt, N.N.; Thakre, B.J.; Parmar, V.L. Development of a Loop-Mediated Isothermal Amplification Assay Based on RoTat1.2 Gene for Detection of Trypanosoma evansi in Domesticated Animals. Parasitol. Res. 2021, 120, 1873–1882. [Google Scholar] [CrossRef]
- Raele, D.A.; Pugliese, N.; La Bella, G.; Calvario, A.; Scarasciulli, M.; Vasco, I.; La Salandra, G.; Cafiero, M.A. Case Report: Molecular Detection of Dirofilaria repens in an Italian Patient after a Stay in Tanzania. Am. J. Trop. Med. Hyg. 2021, 104, 2042–2045. [Google Scholar] [CrossRef]
- Smith, R.; Tomlinson, T.; Bowles, J.; Starkey, L. Comparative Performance Analysis of Different Microfilaria Testing Methods for Dirofilaria immitis in Canine Blood. Parasit. Vectors 2024, 17, 460. [Google Scholar] [CrossRef]
- Cho, J.; Jeong, S.-Y.; Kim, M.-S.; Cho, W.S.; Kim, D.-W.; Park, C. Loop-Mediated Isothermal Amplification Polymerase Chain Reaction in Place of a Modified Knott Test in Screening Dogs for Heartworm (Dirofilaria immitis) Infection Combined with Antigen Detection Test. Am. J. Vet. Res. 2024, 85, ajvr.24.02.0027. [Google Scholar] [CrossRef]
- Mori, Y.; Kanda, H.; Notomi, T. Loop-Mediated Isothermal Amplification (LAMP): Recent Progress in Research and Development. J. Infect. Chemother. 2013, 19, 404–411. [Google Scholar] [CrossRef] [PubMed]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
- Mbithi, A.; Kusza, S.; Bagi, Z. A Review of Loop Mediated Isothermal Amplification in Pathogen Detection: Pros and Cons. Állatteny. takarm. 2024, 73, 250–268. [Google Scholar]
- Zhou, D.; Guo, J.; Xu, L.; Gao, S.; Lin, Q.; Wu, Q.; Wu, L.; Que, Y. Establishment and Application of a Loop-Mediated Isothermal Amplification (LAMP) System for Detection of Cry1Ac Transgenic Sugarcane. Sci. Rep. 2014, 4, 4912. [Google Scholar] [CrossRef]
- Khamlor, T.; Pongpiachan, P.; Parnpai, R.; Punyawai, K.; Sangsritavong, S.; Chokesajjawatee, N. Bovine Embryo Sex Determination by Multiplex Loop-Mediated Isothermal Amplification. Theriogenology 2015, 83, 891–896. [Google Scholar] [CrossRef]
- Dini, P.; Van Poucke, M.; Herrera, C.; Peelman, L.; Daels, P. Preimplantation Gender Determination on Equine Embryos Using LAMP. J. Equine Vet. Sci. 2016, 41, 75. [Google Scholar] [CrossRef]
- Wong, Y.-P.; Othman, S.; Lau, Y.-L.; Radu, S.; Chee, H.-Y. Loop-mediated Isothermal Amplification (LAMP): A Versatile Technique for Detection of Micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Liao, M.; Jiao, P.; Luo, K.; Zhang, H.; Ren, T.; Zhang, G.; Xu, C.; Xin, C.; Cao, W. Development of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Subgroup J Avian Leukosis Virus. J. Clin. Microbiol. 2010, 48, 2116–2121. [Google Scholar] [CrossRef]
- Tran, D.H.; Tran, H.T.; Vo, B.; Than, T.T.; Nguyen, V.T.; Le, V.P.; Phung, H. Enhancing Classical Swine Fever Virus Identification: The Advantages of Field-LAMP Testing. Aust. Vet. J. 2024, 102, 67–73. [Google Scholar] [CrossRef]
- Longhi, S.A.; García Casares, L.J.; Muñoz-Calderón, A.A.; Alonso-Padilla, J.; Schijman, A.G. Combination of Ultra-Rapid DNA Purification (PURE) and Loop-Mediated Isothermal Amplification (LAMP) for Rapid Detection of Trypanosoma cruzi DNA in Dried Blood Spots. PLoS Negl. Trop. Dis. 2023, 17, e0011290. [Google Scholar] [CrossRef]
- Rako, L.; Agarwal, A.; Semeraro, L.; Broadley, A.; Rodoni, B.C.; Blacket, M.J. A LAMP (Loop-mediated Isothermal Amplification) Test for Rapid Identification of Khapra Beetle (Trogoderma granarium). Pest Manag. Sci. 2021, 77, 5509–5521. [Google Scholar] [CrossRef] [PubMed]
- Lai, M.-Y.; Abdul Hamid, M.H.; Jelip, J.; Mudin, R.N.; Lau, Y.-L. Evaluation of A Simple DNA Extraction Method and Its Combination with Loop-Mediated Isothermal Amplification Assays for Rapid Plasmodium Knowlesi Diagnosis. Trop. Med. Infect. Dis. 2023, 8, 389. [Google Scholar] [CrossRef] [PubMed]
- Bhadra, S.; Pothukuchy, A.; Shroff, R.; Cole, A.W.; Byrom, M.; Ellefson, J.W.; Gollihar, J.D.; Ellington, A.D. Cellular Reagents for Diagnostics and Synthetic Biology. PLoS ONE 2018, 13, e0201681. [Google Scholar] [CrossRef]
- Quoc, N.B.; Phuong, N.D.N.; Chau, N.N.B.; Linh, D.T.P. Closed Tube Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Hepatitis B Virus in Human Blood. Heliyon 2018, 4, e00561. [Google Scholar] [CrossRef]
- Kumar, T.S.; Radhika, K.; Joseph Sahaya Rajan, J.; Makesh, M.; Alavandi, S.V.; Vijayan, K.K. Closed-Tube Field-Deployable Loop-Mediated Isothermal Amplification (LAMP) Assay Based on Spore Wall Protein (SWP) for the Visual Detection of Enterocytozoon hepatopenaei (EHP). J. Invertebr. Pathol. 2021, 183, 107624. [Google Scholar] [CrossRef]
- Centeno-Cuadros, A.; Abbasi, I.; Nathan, R. Sex Determination in the Wild: A Field Application of Loop-Mediated Isothermal Amplification Successfully Determines Sex across Three Raptor Species. Mol. Ecol. Resour. 2017, 17, 153–160. [Google Scholar] [CrossRef]
- Lee, P.L.M. DNA Amplification in the Field: Move over PCR, Here Comes LAMP. Mol. Ecol. Resour. 2017, 17, 138–141. [Google Scholar] [CrossRef] [PubMed]
- Khangembam, R.; Tóth, M.; Vass, N.; Várady, M.; Czeglédi, L.; Farkas, R.; Antonopoulos, A. Point of Care Colourimetric and Lateral Flow LAMP Assay for the Detection of Haemonchus Contortus in Ruminant Faecal Samples. Parasite 2021, 28, 82. [Google Scholar] [CrossRef]
- Moehling, T.; Choi, G.; Dugan, L.; Salit, M.; Meagher, R. LAMP Diagnostics at the Point-of-Care: Emerging Trends and Perspectives for the Developer Community. Expert Rev. Mol. Diagn. 2021, 21, 43–61. [Google Scholar] [CrossRef]
- Park, J.W. Principles and Applications of Loop-Mediated Isothermal Amplification to Point-of-Care Tests. Biosensors 2022, 12, 857. [Google Scholar] [CrossRef] [PubMed]
- Bujtor, Z.K.; Zenke, P. A LAMP- (hurok által közvetített izotermikus sokszorosítás) technika tesztelése kutyák szívférgességének (Dirofilaria immitis) kimutatására = Testing the LAMP (loop-mediated isothermal amplification) technique for the detection of heartworm disease (Dirofilaria immitis) in dogs. Magy. Állatorvosok Lapja 2026, 148, 175–182. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
- Samal, K.; Sahoo, J.; Behera, L.; Dash, T. Understanding the BLAST (Basic Local Alignment Search Tool) Program and a Step-by-Step Guide for Its Use in Life Science Research. Bhartiya Krishi Anusandhan Patrika 2021, 36, 55–61. [Google Scholar] [CrossRef]
- Clopper, C.J.; Pearson, E.S. The use of confidence or fiducial limits illustrated in the case of binomial. Biometrika 1934, 26, 404–413. [Google Scholar] [CrossRef]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated Reaction by Loop-Mediated Isothermal Amplification Using Loop Primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-Mediated Isothermal Amplification (LAMP) of Gene Sequences and Simple Visual Detection of Products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef]
- Parida, M.; Sannarangaiah, S.; Dash, P.K.; Rao, P.V.L.; Morita, K. Loop Mediated Isothermal Amplification (LAMP): A New Generation of Innovative Gene Amplification Technique; Perspectives in Clinical Diagnosis of Infectious Diseases. Rev. Med. Virol. 2008, 18, 407–421. [Google Scholar] [CrossRef]
- Njiru, Z.K. Loop-Mediated Isothermal Amplification Technology: Towards Point of Care Diagnostics. PLoS Negl. Trop. Dis. 2012, 6, e1572. [Google Scholar] [CrossRef] [PubMed]
- Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of Loop-Mediated Isothermal Amplification Reaction by Turbidity Derived from Magnesium Pyrophosphate Formation. Biochem. Biophys. Res. Commun. 2001, 289, 150–154. [Google Scholar] [CrossRef]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.-I. Colorimetric Detection of Loop-Mediated Isothermal Amplification Reaction by Using Hydroxy Naphthol Blue. BioTechniques 2009, 46, 167–172. [Google Scholar] [CrossRef]
- Tanner, N.A.; Zhang, Y.; Evans, T.C. Visual Detection of Isothermal Nucleic Acid Amplification Using PH-Sensitive Dyes. BioTechniques 2015, 58, 59–68. [Google Scholar] [CrossRef]
- Hayashida, K.; Kajino, K.; Hachaambwa, L.; Namangala, B.; Sugimoto, C. Direct Blood Dry LAMP: A Rapid, Stable, and Easy Diagnostic Tool for Human African Trypanosomiasis. PLoS Negl. Trop. Dis. 2015, 9, e0003578. [Google Scholar] [CrossRef]
- Mgawe, C.; Shilluli, C.; Nyanjom, S.; Odari, E.; Linnes, J.C.; Kanoi, B.N.; Gitaka, J.; Ochola, L. Application of Multiple Binding Sites for LAMP Primers across P. falciparum Genome Improves Detection of the Parasite from Whole Blood Samples. Front. Malar. 2023, 1, 1303980. [Google Scholar] [CrossRef]
- Sriworarat, C.; Phumee, A.; Mungthin, M.; Leelayoova, S.; Siriyasatien, P. Development of Loop-Mediated Isothermal Amplification (LAMP) for Simple Detection of Leishmania Infection. Parasit. Vectors 2015, 8, 591. [Google Scholar] [CrossRef]
- Gummery, L.; Jallow, S.; Raftery, A.G.; Bennet, E.; Rodgers, J.; Sutton, D.G.M. Comparison of Loop-Mediated Isothermal Amplification (LAMP) and PCR for the Diagnosis of Infection with Trypanosoma brucei ssp. in Equids in The Gambia. PLoS ONE 2020, 15, e0237187. [Google Scholar] [CrossRef]
- Aydin-Schmidt, B.; Xu, W.; González, I.J.; Polley, S.D.; Bell, D.; Shakely, D.; Msellem, M.I.; Björkman, A.; Mårtensson, A. Loop Mediated Isothermal Amplification (LAMP) Accurately Detects Malaria DNA from Filter Paper Blood Samples of Low Density Parasitaemias. PLoS ONE 2014, 9, e103905. [Google Scholar] [CrossRef]
- Zorkóczy, O.K.; Gyurcsó, A.; Ózsvári, L.; Lehotzky, P.; Sanil, R.; Zenke, P. Development of a Loop-Mediated Isothermal Amplification Technique for Sex Detection in Cervidae Species. Mamm. Biol. 2024, 105, 113–121. [Google Scholar] [CrossRef]
- Vincent, J.P.; Existe, A.V.; Komaki-Yasuda, K.; Boncy, J.; Kano, S. Performance of the Procedure for Ultra-Rapid Extraction and Loop-Mediated Isothermal Amplification (PURE-LAMP) Method to Detect Malaria in Haiti. Infect. Dis. Poverty 2023, 12, 53. [Google Scholar] [CrossRef]
- Khan, M.; Wang, R.; Li, B.; Liu, P.; Weng, Q.; Chen, Q. Comparative Evaluation of the LAMP Assay and PCR-Based Assays for the Rapid Detection of Alternaria Solani. Front. Microbiol. 2018, 9, 2089. [Google Scholar] [CrossRef]
- Ahmadi, Y.; Yu, Y.; Cui, Z.; Huang, W.; Andersson, M. Loop-Mediated Isothermal Amplification (LAMP) for the Diagnosis of Sexually Transmitted Infections: A Review. Microb. Biotechnol. 2025, 18, e70153. [Google Scholar] [CrossRef]
- Augustine, R.; Hasan, A.; Das, S.; Ahmed, R.; Mori, Y.; Notomi, T.; Kevadiya, B.; Thakor, A. Loop-Mediated Isothermal Amplification (LAMP): A Rapid, Sensitive, Specific, and Cost-Effective Point-of-Care Test for Coronaviruses in the Context of COVID-19 Pandemic. Biology 2020, 9, 182. [Google Scholar] [CrossRef]
- Tanner, N.; Zhang, Y.; Evans, T. Simultaneous Multiple Target Detection in Real-Time Loop-Mediated Isothermal Amplification. BioTechniques 2012, 53, 81–89. [Google Scholar] [CrossRef]
- Jiang, Y.; Bhadra, S.; Li, B.; Wu, Y.; Milligan, J.; Ellington, A. Robust Strand Exchange Reactions for the Sequence-Specific, Real-Time Detection of Nucleic Acid Amplicons. Anal. Chem. 2015, 87, 3314–3320. [Google Scholar] [CrossRef]
- Hardinge, P.; Murray, J. Reduced False Positives and Improved Reporting of Loop-Mediated Isothermal Amplification Using Quenched Fluorescent Primers. Sci. Rep. 2019, 9, 7400. [Google Scholar] [CrossRef]


| Primer Name | Type | Sequence (5′-3′) | Primer Stock Concentration (μM) |
|---|---|---|---|
| iCOI-44 F3 | Forward outer | TTTTGGACATCCTGAGGTT | 5.0 |
| iCOI-44 B3 | Backward outer | GCAGCACTAAAATAAGTACGA | 5.0 |
| iCOI-44 FIP | Forward inner (F1c + F2) | GGCCAAACAAACGATCCTTATCAG-TATTTTACCGGTGTTTGGGAT | 40.0 |
| iCOI-44 BIP | Backward inner (B1c + B2) | TGACTTTTGCTTCTATTTGGATTGC-GTATCAATATCCAAACCAGCT | 40.0 |
| iCOI-44 LB | Loop backward | TATTGGGGACTTCTGTTTGGGGT | 10.0 |
| rND5-1 F3 | Forward outer | CTTTTGTTAAGGGTGGTCAG | 5.0 |
| rND5-1 B3 | Backward outer | CAAAAACCAGAAAAAACCAAAGT | 5.0 |
| rND5-1 FIP | Forward inner (F1c + F2) | ACTATGAACCAAACAACTAACAGGA-TATCCTTTTGGTAGTTGGCTT | 40.0 |
| rND5-1 BIP | Backward inner (B1c + B2) | GTTACTGCTGGTGTTATGTTAATGG-ACAAAAGACAACACATCAGAA | 40.0 |
| rND5-1 LF | Loop forward | GGGGCAGCCATAGCTTTAGG | 10.0 |
| Dirofilaria immitis | Dirofilaria repens | ||||
|---|---|---|---|---|---|
| Primer Sets | False Negative | False Positive | Primer Sets | False Negative | False Positive |
| iCOI-1 | 0 | 0 | rCOI-2 | 0 | 0 |
| iCOI-2 | 0 | 4 | rCOI-4 | 0 | 0 |
| iCOI-15 | 16 | 0 | rCOI-14 | 0 | 6 |
| iCOI-32 | 1 | 0 | rCOI-18 | 8 | 2 |
| iCOI-44 | 0 | 0 | rCOI-27 | 19 | 0 |
| iND1-1 | 0 | 0 | rCOI-36 | 14 | 5 |
| iND1-11 | 0 | 0 | rCOI-44 | 19 | 1 |
| iND1-22 | 0 | 0 | rND5-1 | 0 | 0 |
| Parasite | GenBank Accession Number | In Silico Primer Test | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| iCOI-44 | rND5-1 | ||||||||||||||
| F3 | B3 | F1 | F2 | B1 | B2 | LB | F3 | B3 | F1 | F2 | B1 | B2 | LF | ||
| Dirofilaria immitis | NC_005305 | + | + | + | + | + | + | + | + | − | + | − | + | − | − |
| Dirofilaria repens | NC_029975 | + | − | − | − | − | + | − | + | + | + | + | + | + | + |
| Acanthocheilonema reconditum | AJ544876 | + | − | − | − | + | − | − | − | − | − | − | − | − | − |
| Acanthocheilonema dracunculoides | MG797680 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Brugia malayi | MT149211 | − | + | − | − | + | + | − | − | − | + | − | − | + | − |
| Brugia timori | AP017686 | − | + | − | − | − | + | − | − | − | + | − | + | + | − |
| Angiostrongylus vasorum | NC_018602 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Anaplasma phagocytophilum | NZ_CP166491 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Anaplasma platys | CP046391.1 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Ehrlichia canis | NZ_CP085277 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Ehrlichia ewingii | OP067658.1 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Babesia canis | PV059163.1 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Wolbachia pipientis | NZ_AP038754.1 | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Sample ID | qPCR Ct | LAMP on DNA | Direct LAMP on Blood | Sample ID | qPCR CT | LAMP on DNA | Direct LAMP on Blood | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Di | Dr | Di | Dr | Di | Dr | Di | Dr | Di | Dr | Di | Dr | ||
| Di1 | 28 | − | + | − | + | − | Dr7 | − | 25 | − | + | − | + |
| Di2 | 33 | − | + | − | + | − | Dr8 | − | 23 | − | + | − | + |
| Di3 | 33 | − | + | − | + | − | Dr9 | − | 21 | − | + | − | + |
| Di4 | 26 | − | + | − | + | − | Dr10 | − | 21 | − | + | − | + |
| Di5 | 28 | − | + | − | + | − | Dr11 | − | 27 | − | + | − | − |
| Di6 | 26 | − | + | − | + | − | Dr12 | − | 28 | − | + | − | − |
| Di7 | 33 | − | + | − | + | − | Dr13 | − | 24 | − | + | − | + |
| Di8 | 41 | − | − | − | − | − | Dr14 | − | 20 | − | + | − | + |
| Di9 | 24 | − | + | − | + | − | Dr15 | − | 23 | − | + | − | + |
| Di10 | 28 | − | + | − | + | − | Dir1 | 24 | 35 | + | + | + | + |
| Di11 | 20 | − | + | − | + | − | Dir2 | 30 | 35 | + | + | + | + |
| Di12 | 29 | − | + | − | + | − | Dir3 | 27 | 40 | + | + | + | − |
| Di13 | 30 | − | + | − | + | − | Dir4 | 27 | 29 | + | + | + | + |
| Di14 | 30 | − | + | − | + | − | Dir5 | 26 | 35 | + | + | + | − |
| Di15 | 26 | − | + | − | + | − | Dir6 | 36 | 30 | + | + | + | + |
| Di16 | 34 | − | - | − | − | − | Dir7 | 34 | 26 | − | + | − | − |
| Di17 | 31 | − | + | − | + | − | Dir8 | 20 | 33 | + | + | + | + |
| Di18 | 26 | − | + | − | + | − | Dir9 | 23 | 22 | + | + | + | + |
| Di19 | 28 | − | + | − | + | − | Dir10 | 24 | 32 | + | + | + | + |
| Di20 | 29 | − | + | − | + | − | Dir11 | 25 | 28 | + | + | + | + |
| Di21 | 30 | − | + | − | + | − | Dir12 | 21 | 37 | + | + | + | − |
| Di22 | 23 | − | + | − | + | − | Dir13 | 29 | 26 | + | + | + | + |
| Di23 | 22 | − | + | − | + | − | Dir14 | 24 | 24 | + | + | + | + |
| Di24 | 26 | − | + | − | + | − | Dir15 | 24 | 24 | + | + | + | + |
| Di25 | 24 | − | + | − | + | − | Dir16 | 24 | 27 | + | + | + | + |
| Di26 | 24 | − | + | − | + | − | D1 | − | − | − | − | − | − |
| Di27 | 24 | − | + | − | + | − | D2 | − | − | − | − | − | − |
| Di28 | 33 | − | + | − | − | − | D3 | − | − | − | − | − | − |
| Di29 | 27 | − | + | − | − | − | D4 | − | − | − | − | − | − |
| Di30 | 24 | − | + | − | + | − | D5 | − | − | − | − | − | − |
| Di31 | 26 | − | + | − | + | − | D6 | − | − | − | − | − | − |
| Di32 | 27 | − | + | − | + | − | D7 | − | − | − | − | − | − |
| Di33 | 24 | − | + | − | + | − | D8 | − | − | − | − | − | − |
| Di34 | 24 | − | + | − | + | − | D9 | − | − | − | − | − | − |
| Di35 | 26 | − | + | − | + | − | D10 | − | − | − | − | − | − |
| Di36 | 25 | − | + | − | + | − | D11 | − | − | − | − | − | − |
| Di37 | 22 | − | + | − | + | − | D12 | − | − | − | − | − | − |
| Di38 | 31 | − | + | − | + | − | D13 | − | − | − | − | − | − |
| Di39 | 26 | − | + | − | + | - | D14 | − | − | − | − | − | − |
| Dr1 | − | 26 | − | + | − | − | D15 | − | − | − | − | − | − |
| Dr2 | − | 27 | − | + | − | + | D16 | − | − | − | − | − | − |
| Dr3 | − | 22 | − | + | − | + | D17 | − | − | − | − | − | − |
| Dr4 | − | 23 | − | + | − | + | D18 | − | − | − | − | − | − |
| Dr5 | − | 25 | - | + | − | + | D19 | − | − | − | − | − | − |
| Dr6 | − | 26 | − | + | − | + | D20 | − | − | − | − | − | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Bujtor, Z.; Földvári, T.; Pribenszky, C.; Jerzsele, Á.; Zenke, P. Rapid Point-of-Care Detection of Dirofilaria immitis and Dirofilaria repens in Canine Blood Using Two Direct Closed-Tube LAMP Assays. Animals 2026, 16, 1820. https://doi.org/10.3390/ani16121820
Bujtor Z, Földvári T, Pribenszky C, Jerzsele Á, Zenke P. Rapid Point-of-Care Detection of Dirofilaria immitis and Dirofilaria repens in Canine Blood Using Two Direct Closed-Tube LAMP Assays. Animals. 2026; 16(12):1820. https://doi.org/10.3390/ani16121820
Chicago/Turabian StyleBujtor, Zsófia, Tünde Földvári, Csaba Pribenszky, Ákos Jerzsele, and Petra Zenke. 2026. "Rapid Point-of-Care Detection of Dirofilaria immitis and Dirofilaria repens in Canine Blood Using Two Direct Closed-Tube LAMP Assays" Animals 16, no. 12: 1820. https://doi.org/10.3390/ani16121820
APA StyleBujtor, Z., Földvári, T., Pribenszky, C., Jerzsele, Á., & Zenke, P. (2026). Rapid Point-of-Care Detection of Dirofilaria immitis and Dirofilaria repens in Canine Blood Using Two Direct Closed-Tube LAMP Assays. Animals, 16(12), 1820. https://doi.org/10.3390/ani16121820

