Next Article in Journal
Habitat-Associated Dietary Plasticity in the Japanese Weasel (Mustela itatsi): Fecal Analysis in a Floodplain Wetland and Comparative Synthesis
Previous Article in Journal
Dry Ageing Effect on Beef Quality Characteristics from Raramuri Criollo vs. Hereford × Angus
Previous Article in Special Issue
Copper Pyrithione Induces Hepatopancreatic Apoptosis and Metabolic Disruption in Litopenaeus vannamei: Integrated Transcriptomic, Metabolomic, and Histopathological Analysis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The SQSTM1/p62 of Pacific White Shrimp (Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure

Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, Fisheries College, Guangdong Ocean University, Zhanjiang 524088, China
*
Author to whom correspondence should be addressed.
Animals 2026, 16(11), 1718; https://doi.org/10.3390/ani16111718
Submission received: 18 April 2026 / Revised: 31 May 2026 / Accepted: 1 June 2026 / Published: 4 June 2026
(This article belongs to the Special Issue Ecology of Aquatic Crustaceans: Crabs, Shrimps and Lobsters)

Simple Summary

Ammonia accumulation is a common problem in shrimp aquaculture and can cause oxidative stress and tissue damage. p62 is a selective autophagy receptor involved in protein degradation and oxidative stress regulation, but its role in Pacific white shrimp (Litopenaeus vannamei) under ammonia exposure remains unclear. In this study, Lv-p62 responded to ammonia exposure in different tissues. Knockdown of Lv-p62 changed the expression of genes related to antioxidant defense, autophagy, and apoptosis, and reduced hepatopancreatic injury and apoptosis. These findings suggest that Lv-p62 is involved in shrimp responses to ammonia stress and may help improve our understanding of how shrimp cope with ammonia stress in aquaculture.

Abstract

Ammonia exposure can induce oxidative stress in aquatic animals. The p62 protein is a selective autophagy receptor that participates in protein degradation and oxidative stress regulation. In this study, the role of Lv-p62 in the response of Litopenaeus vannamei to ammonia exposure was investigated using RNA interference. The results showed that Lv-p62 expression was significantly induced in the hepatopancreas, gills, and intestine of L. vannamei after ammonia exposure (p < 0.05). Lv-p62 expression peaked at 6 h in the gills and 24 h in the intestine, whereas a biphasic response was observed in the hepatopancreas, with an initial peak at 12 h and a higher second peak at 48 h. In the RNAi experiment, Lv-p62 knockdown altered the expression of antioxidant-related genes (Trx, Gst, and Gpx) in a tissue-specific manner, with Gpx expression being prominently increased in the gills and intestine but not in the hepatopancreas under ammonia exposure. Autophagy-related genes (ATG4 and ATG10) also showed time-dependent and tissue-specific expression changes after Lv-p62 knockdown. The expression of apoptosis-related genes, including caspase 3 and p53, was tissue-specific and was generally lower in the dsRNA-Lv-p62+NH3 group than in the dsRNA-EGFP+NH3 group at most time points. Histopathological observations showed that hepatopancreatic acinar vacuolation and structural damage were alleviated, and the hepatopancreatic apoptosis rate was reduced in L. vannamei in the dsRNA-Lv-p62+NH3 group. These findings suggest that Lv-p62 participates in the response of L. vannamei to ammonia exposure, possibly by regulating antioxidant defense, autophagy-related processes, and apoptosis, thereby affecting hepatopancreatic oxidative damage and tissue injury.

1. Introduction

Litopenaeus vannamei has become one of the most economically valuable aquaculture species worldwide, but it is susceptible to multiple environmental stressors, including salinity, temperature and ammonia [1,2]. Notably, ammonia exposure is a major environmental stressor that severely impacts the health status of aquatic animals, thereby increasing susceptibility to pathogens and raising mortality rates [3]. In aquatic environments, ammonia occurs in two main forms, unionized NH3 and ionized NH4+, with their ratio largely regulated by water pH [4]. In this study, ammonium chloride (NH4Cl) was used to establish ammonia stress. At an experimental pH of around 8.0, dissolved NH4Cl dissociates and reaches chemical equilibrium between NH4+ and toxic free NH3 [4]. Since NH3 easily penetrates biological membranes, it is regarded as the primary toxic form responsible for impairing aquatic animal health [5]. Specifically, ammonia could lead to oxidative stress in L. vannamei by increasing the concentration of reactive oxygen species (ROS) in hemocytes, and subsequently induce hepatopancreas damage [6,7]. Excessive ROS accumulation induced by ammonia stress disrupts intracellular redox homeostasis, thereby causing oxidative damage [6,7]. Oxidative stress not only impairs growth performance and immune function of shrimp [8], but also leads to mass mortality resulting in substantial economic losses to the aquaculture industry. Therefore, it is of great practical significance to deeply explore the regulatory mechanisms of the antioxidant system in L. vannamei under ammonia stress.
Autophagy is the process by which cells degrade damaged or redundant cellular components through lysosomes and is essential for maintaining cellular homeostasis [9]. Sequestosome 1 (SQSTM1), also known as p62, is a selective autophagy cargo receptor that recognizes ubiquitinated proteins or damaged organelles as autophagic cargo and links them to autophagosomes for subsequent lysosomal degradation [10]. Notably, it also regulates the antioxidant response via the nuclear factor E2-related factor 2/antioxidant response elements (Nrf2/ARE) pathway [11]. Mechanistically, accumulated p62 can interact with Keap1, reduce Keap1-mediated repression of Nrf2, and promote Nrf2-dependent transcription of antioxidant genes. In addition, p62 is closely related to pro-inflammatory and anti-inflammatory pathways [12]. Previous studies have shown that Lv-p62 possesses conserved PB1 and UBA domains, which are associated with p62 oligomerization and recognition of ubiquitinated cargo, respectively [13]. This structural conservation supports the potential functional similarity of Lv-p62 to p62 homologs in other species. In addition to its role in autophagy, p62 has also been implicated in the regulation of antioxidant responses in several aquatic species, although the detailed mechanism in L. vannamei remains unclear. Given that oxidative stress is a key trigger of autophagy [14], p62 may serve as a critical integrator linking autophagy and antioxidant responses under environmental stress.
Overexpression of p62 activated the Nrf2/ARE signaling pathway through the degradation of Keap1 [11]. In Cristaria plicata, RNA interference (RNAi) of p62 resulted in inhibiting the expression of Nrf2 and NADH quinone oxidoreductase 1 (NQO1), indicating that p62 promoted the Nrf2/ARE pathway to protect against oxidative stress [15]. Previous studies have shown that waterborne zinc exposure can alter the transcriptional responses of autophagy-related genes, including p62, in yellow catfish [16]. This may be associated with heavy metal-induced oxidative stress, which activates autophagy-related pathways and thereby modulates p62 expression as part of the cellular clearance response. In common carp (Cyprinus carpio), two p62 genes, Ccp62-1 and Ccp62-2, were reported to enhance antibacterial and antiviral immune responses and improve host survival [17]. Although the function of p62 had been extensively studied in a variety of organisms, the functions of p62 in regulating of oxidative stress induced by ammonia in L. vannamei is still unclear.
In this study, RNAi-mediated knockdown was used to investigate the role of Lv-p62 in L. vannamei under ammonia exposure. We hypothesized that Lv-p62 participates in ammonia stress responses by modulating antioxidant defense, autophagy-related processes, and apoptosis. Antioxidant-, autophagy-, and apoptosis-related gene expression, hepatopancreatic tissue damage, and TUNEL-positive apoptotic signals were assessed to clarify the involvement of Lv-p62 in ammonia stress responses. This study provides functional evidence for the role of Lv-p62 in L. vannamei under ammonia exposure.

2. Materials and Methods

2.1. Experimental Animal

The L. vannamei (3.9 ± 0.2 g) used in this experiment were obtained from local farmers on Donghai Island, Zhanjiang City, Guangdong Province, China. Then, the shrimp were acclimated in three breeding buckets (1 m3) for a week with 150 shrimp maintained in each bucket during the acclimation period. The shrimp were reared under indoor conditions, fed twice daily, and only healthy individuals with normal swimming behavior, active feeding, intact appendages, and no visible signs of disease or injury were used for the experiment.
Formal experiments were carried out in 0.5 m3 breeding buckets filled with natural seawater that had been disinfected with Qianglvjing (trichloroisocyanuric acid; Wuhan Shuidingdang Technology, Wuhan, China) and fully aerated before use (total water volume: 0.3 m3). Water parameters were maintained appropriately: temperature at 26–28 °C, salinity at 28–30, and pH at approximately 8.0, and dissolved oxygen above 5.0 mg/L. Air pumps continuously aerated into the water to ensure sufficient dissolved oxygen. During the experiment, pH, temperature, salinity, dissolved oxygen, and ammonia concentration were monitored, and ammonia was maintained within the normal range except for the ammonia-exposure treatment. All animal procedures were approved by the Guangdong Ocean University Research Council (approval number: GDOU-LAE-2026-054; approval date: 5 December 2025).

2.2. Ammonia Exposure Experiment

Healthy shrimp were randomly selected for ammonia exposure treatment. A total of 180 healthy shrimp were prepared for this experiment. Among them, 90 shrimp were assigned to three tank replicates, with 30 shrimp per tank, while the remaining shrimp were used for 0 h baseline sampling before ammonia exposure and kept as backup individuals. Except for scheduled sampling, no shrimp were artificially replaced during the experiment. Ammonia exposure was applied using ammonium chloride (NH4Cl; Sangon Biotech, Shanghai, China) to achieve a final ammonia nitrogen concentration of 20 mg/L [18]. At 0 h before exposure and at 6, 12, 24, 48, and 72 h after ammonia exposure, 3 shrimp were randomly sampled from each replicate, and the hepatopancreases, gills, and intestines of L. vannamei were collected. These tissues were immediately stored in liquid nitrogen for subsequent total RNA extraction to determine the time-series expression of the Lv-p62 gene.

2.3. Verification of Lv-p62 Knockdown Efficiency

The dsRNAs used in this study, including dsRNA-Lv-p62 and dsRNA-EGFP, were synthesized using an in vitro transcription T7 kit for siRNA synthesis (TaKaRa, Dalian, China). The assays were performed in PCR tubes (Jet Biofil, Guangzhou, China), and the quality and concentration of dsRNAs were verified by 1% agarose gel electrophoresis and NanoDrop 2000 spectrophotometry (Thermo Fisher Scientific, Waltham, MA, USA) before injection. To verify the knockdown efficiency of Lv-p62 in L. vannamei under non-ammonia conditions, shrimp were injected with dsRNA-Lv-p62 only. A second injection of dsRNA-Lv-p62 was administered 24 h after the first injection to maintain RNAi efficacy during the sampling period. At 0, 6, 12, 24, 48, and 72 h after the second injection, shrimp were randomly sampled, and the hepatopancreases, gills, and intestines were collected and immediately stored in liquid nitrogen. The knockdown efficiency of Lv-p62 was subsequently evaluated by qRT-PCR as described in Section 2.5 and Section 2.6.

2.4. Lv-p62 RNAi Experiment

Healthy shrimp were selected for the experiment as described above and divided into two groups, with three replicate culture tanks per group. A total of 180 healthy shrimp were used in the RNAi experiment, with 30 shrimp per tank. The first group was injected with 100 μL of 0.5 μg/g dsRNA-EGFP, and the second group was injected with 100 μL of 0.5 μg/g dsRNA-Lv-p62. Both groups received a second injection with the corresponding dsRNA at 24 h after the first injection to maintain RNAi efficacy during the subsequent ammonia exposure period, and ammonia exposure was initiated immediately after the second injection. The two groups were designated as the dsRNA-EGFP+NH3 group and the dsRNA-Lv-p62+NH3 group, respectively. At 0, 6, 12, 24, 48, and 72 h post ammonia exposure, three shrimp were randomly sampled from each replicate at each time point, and the hepatopancreases, gills, and intestines were dissected and collected. These tissues were immediately stored in liquid nitrogen for subsequent total RNA extraction. No shrimp were artificially removed or replaced during the experiment. During each sampling period, only healthy and active shrimp were randomly selected for tissue collection. The dsRNA injection dose and basic RNAi procedure used in this study were based on our previously published study [13], with minor modifications according to the present experimental design.

2.5. RNA Extraction

Total RNA was isolated from shrimp tissues using a commercial RNA extraction kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol. Subsequently, first-strand cDNA was synthesized from the extracted RNA using a reverse transcription kit (TaKaRa, Dalian, China) following the supplied instructions.

2.6. Gene Expression Analysis

Using EF-1α as the reference gene, the expression of the Lv-p62 gene in L. vannamei was detected in the ammonia exposure experiment. After injection with dsRNA-Lv-p62 or dsRNA-EGFP followed by ammonia exposure, the expression levels of antioxidant, autophagy, and apoptosis genes in L. vannamei were detected. The primer sequences used for these genes were designed based on sequences validated in our previous study [13] and are listed in Table A1. The relative expression levels of genes were calculated using the 2−ΔΔCt method. Amplification was performed in a 10 μL total reaction volume with the QuantStudio 6 Flex qRT-PCR system (Thermo Fisher Scientific, Waltham, MA, USA) and TB Green® Premix Ex Taq™ II (Tli RNaseH Plus; TaKaRa, Dalian, China), following the respective manufacturers’ protocols.

2.7. Histopathological Analysis

In the Lv-p62 RNAi experiment, hepatopancreas samples from the dsRNA-EGFP+NH3 and dsRNA-Lv-p62+NH3 groups were collected at 72 h. Samples were fixed in Carnoy’s fixative (prepared in-house) for over 24 h and then processed for routine paraffin embedding as previously described with minor modifications [13]. Briefly, tissues were dehydrated through a graded ethanol series (70%, 80%, 90%, 95%, and 100%), cleared in xylene, infiltrated with molten paraffin at 60 °C, embedded in paraffin blocks, sectioned at 8 μm, rehydrated, and stained with hematoxylin-eosin (H&E) using a commercial kit (G1125, Solarbio, Beijing, China). Representative images were selected from multiple randomly observed sections to describe the main histopathological alterations.

2.8. Detection of Apoptotic Cells by TUNEL Assay

After deparaffinization and rehydration, tissue sections without HE staining were subjected to TUNEL staining with Elabscience’s One-Step TUNEL In Situ Apoptosis Detection Kit (Green, FITC) (Elabscience, Wuhan, China), following the manufacturer’s protocol, and then observed and image acquisition were conducted using an instrument from Leica Microsystems (Leica, Wetzlar, Germany).

2.9. Data Visualization and Statistical Analysis

All data are expressed as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism version 9.5. For the ammonia exposure experiment, the relative expression of Lv-p62 at different time points within the same tissue was compared using one-way analysis of variance (ANOVA) followed by Tukey’s honestly significant difference (HSD) post hoc test. Different letters above the bars indicate significant differences among different time points within the same tissue (p < 0.05).
For the Lv-p62 RNAi experiment, comparisons between the dsRNA-EGFP+NH3 group and the dsRNA-Lv-p62+NH3 group at the same time point were performed using an unpaired two-tailed Student’s t-test. Asterisks indicate significant differences between the two groups at the same time point (* p < 0.05, ** p < 0.01). No dataset was analyzed using both one-way ANOVA and Student’s t-test. The final design and layout of all figures were completed using Adobe Photoshop 2021 version 22.5.9. The statistical analysis procedures used in this study were based on our previously published study [13], with minor modifications according to the present experimental design.

3. Results

3.1. Tissue Expression Sequence of Lv-p62 After Ammonia Exposure

As shown in Figure 1, the mRNA expression level of Lv-p62 in the hepatopancreas, gills, and intestine of L. vannamei was increased after ammonia exposure (p < 0.05). In the hepatopancreas, Lv-p62 expression first increased to reach the first peak at 12 h, then decreased at 24 h, and subsequently rose again to reach the second, higher peak at 48 h, followed by a slight decline at 72 h. In the gills, Lv-p62 expression peaked at 6 h (p < 0.05), followed by a gradual decrease in expression, and the level at 72 h remained higher than that at 0 h. In the intestine, Lv-p62 expression increased continuously and peaked at 24 h, then declined gradually. These results indicate that ammonia exposure increased Lv-p62 expression in a tissue-specific and time-dependent manner.

3.2. RNAi Efficiency Analysis

The knockdown effect of Lv-p62 was assessed by qRT-PCR analysis in the hepatopancreas, gills and intestine. The relative expression level of Lv-p62 was reduced after dsRNA-Lv-p62 injection in all three tissues and reached its lowest level at 24 h after the second injection among the examined time points (Figure 2). These results suggest that the silencing effect of Lv-p62 was most pronounced at 24 h after the second injection under the present experimental conditions. At later time points, Lv-p62 expression showed a partial recovery.

3.3. Antioxidant-Related Genes Expression

As shown in Figure 3, antioxidant-related genes exhibited tissue-specific expression patterns after Lv-p62 knockdown under ammonia exposure, with Gpx showing a prominent increase mainly in the gill and intestine. In the hepatopancreas, the Trx expression in the dsRNA-Lv-p62+NH3 group was significantly higher than that in the dsRNA-EGFP+NH3 group at 12 h, 48 h and 72 h (p < 0.05). Gpx expression in the dsRNA-EGFP+NH3 group decreased gradually to the lowest level at 48 h, whereas that in the dsRNA-Lv-p62+NH3 group peaked at 72 h (p < 0.05). Gst expression in the dsRNA-Lv-p62+NH3 group peaked at 48 h and then decreased, whereas that in the dsRNA-EGFP+NH3 group remained at a relatively high level after 24 h, with significant differences between the two groups at all detected time points (p < 0.05).
In the gills, Trx expression in the dsRNA-Lv-p62+NH3 group was significantly lower than that in the dsRNA-EGFP+NH3 group at 6, 24 and 48 h (p < 0.05), Gst expression in the dsRNA-Lv-p62+NH3 group was generally lower than that in the dsRNA-EGFP+NH3 group at all post-exposure time points from 6 to 72 h (p < 0.05), Gpx expression in the dsRNA-Lv-p62+NH3 group was significantly higher than that in the dsRNA-EGFP+NH3 group at all post-exposure time points from 6 to 72 h (p < 0.05).
In the intestine, Trx expression in the dsRNA-Lv-p62+NH3 group was significantly higher than that in the dsRNA-EGFP+NH3 group at 24 h and 48 h (p < 0.05), Gpx expression in the dsRNA-Lv-p62+NH3 group was significantly higher than that in the dsRNA-EGFP+NH3 group at 6, 12, 48 and 72 h (p < 0.05), and Gst expression in the dsRNA-Lv-p62+NH3 group was significantly lower than that in the dsRNA-EGFP+NH3 group across all time points (p < 0.05), with Gst expression in the dsRNA-Lv-p62+NH3 group reaching the minimum at 24 h while that in the dsRNA-EGFP+NH3 group peaked at 24 h.

3.4. Autophagy-Related Genes Expression

As exhibited in Figure 4, in the hepatopancreas, the expression of ATG10 at all observation time points (6, 12, 24, 48 h) in the dsRNA-EGFP+NH3 group was lower than that at 0 h, and the ATG10 expression levels in both the dsRNA-Lv-p62+NH3 group and the dsRNA-EGFP+NH3 group peaked at 72 h. Compared with the dsRNA-EGFP+NH3 group, the expression of ATG10 in the dsRNA-Lv-p62+NH3 group was significantly downregulated at 48 h and 72 h. The ATG4 expression in the dsRNA-EGFP+NH3 group decreased during the early stage after ammonia exposure, then increased and reached its highest level at 48 h. In contrast, ATG4 expression in the dsRNA-Lv-p62+NH3 group was suppressed during the early stage and did not rebound until 72 h.
In gill tissue, the expression levels of ATG10 and ATG4 in the dsRNA-Lv-p62+NH3 group showed a downward trend after ammonia exposure, and were significantly lower than those in the dsRNA-EGFP+NH3 group (p < 0.05). The expression level of ATG10 in the dsRNA-EGFP+NH3 group initially increased and remained significantly higher than that at 0 h until 72 h (p < 0.05).
In the intestine, ATG10 and ATG4 in both the dsRNA-EGFP+NH3 group and the dsRNA-Lv-p62+NH3 group first increased and then decreased after ammonia exposure. ATG4 in the dsRNA-EGFP+NH3 group reached its highest level at 12 h, whereas that in the dsRNA-Lv-p62+NH3 group peaked at 48 h and then decreased.

3.5. Apoptosis Gene Expression

As shown in Figure 5, in the hepatopancreas, for the caspase 3 gene, the overall expression level in the dsRNA-EGFP+NH3 group was significantly higher than that in the dsRNA-Lv-p62+NH3 group at 6, 12, 48, and 72 h (p < 0.05). However, at 24 h, the opposite pattern was observed: caspase 3 expression was significantly higher in the dsRNA-Lv-p62+NH3 group than in the dsRNA-EGFP+NH3 group (p < 0.05), and reached its peak in the dsRNA-Lv-p62+NH3 group. The p53 expression in the dsRNA-Lv-p62+NH3 group was significantly lower than that in the dsRNA-EGFP+NH3 group at 12, 48, and 72 h (p < 0.05).
In the gill, the caspase 3 in dsRNA-EGFP+NH3 group reached its peak expression at 48 h, while the dsRNA-Lv-p62+NH3 group peaked at 24 h and 48 h. Additionally, the caspase 3 expression level in the dsRNA-Lv-p62+NH3 group was significantly lower than that in the dsRNA-EGFP+NH3 group at 6, 48, and 72 h (p < 0.05). p53 expression levels in both the dsRNA-EGFP+NH3 and dsRNA-Lv-p62+NH3 groups were significantly lower than those at 0 h (p < 0.05).
In the intestine, the expression levels of caspase 3 in the dsRNA-EGFP+NH3 were significantly upregulated after ammonia exposure (p < 0.05). The expression level of caspase 3 in the dsRNA-EGFP+NH3 group was significantly higher than that in the dsRNA-Lv-p62+NH3 group at 6, 12, 24, 48, and 72 h (p < 0.05). For the p53 gene, the dsRNA-EGFP+NH3 group reached its peak expression at 6 h, followed by an overall downward trend. In contrast, the dsRNA-Lv-p62+NH3 group showed fluctuating expression, with the highest level observed at 48 h.

3.6. Effects of Lv-p62 RNAi on Hepatopancreatic Histopathology

As observed in Figure 6, in the dsRNA-EGFP group, the hepatopancreatic acini were star-shaped with intact structures. However, in the dsRNA-EGFP+NH3 group, the walls of hepatopancreatic acini became thinner and distorted, and the normal structure was lost, with obvious vacuolation. The histopathological alterations were mainly characterized by acinar wall thinning, structural distortion, loss of normal architecture, and vacuolation, whereas obvious necrosis or epithelial sloughing was not observed in the examined sections. In contrast, vacuolation of hepatopancreatic acini in the dsRNA-Lv-p62+NH3 group was reduced, and the acinar structure was largely preserved, with morphology closer to that of the dsRNA-EGFP group.

3.7. TUNEL Detection Analysis

As illustrated in Figure 7, apoptotic signals were detected by the TUNEL assay, with green fluorescence indicating apoptotic cells. Representative images from multiple randomly selected sections are shown. More obvious apoptotic signals were observed in the dsRNA-EGFP+NH3 group, whereas relatively weaker apoptotic signals were observed in the dsRNA-EGFP group and the dsRNA-Lv-p62+NH3 group. Quantitative analysis further confirmed that the cell apoptosis rate was increased in the dsRNA-EGFP+NH3 group, whereas this increase was reduced in the dsRNA-Lv-p62+NH3 group (Figure 8).

4. Discussion

P62 acts as a selective autophagy receptor and mediates protein aggregate degradation via its functional domains, thereby contributing to intracellular homeostasis [19,20]. p62 also activates the Nrf2 pathway to upregulate antioxidant gene expression. For example, exercise-induced upregulation of antioxidant proteins depends on p62-mediated Nrf2 activation [21]. In addition, p62-mediated selective autophagy contributes to immune regulation and host defense [22]. Our previous studies showed that Lv-p62 was involved in the immune response against Vibrio harveyi infection [13]. However, the role of Lv-p62 in the response of L. vannamei to ammonia exposure remains unclear.
Ammonia exposure causes tissue damage, oxidative stress, and metabolic disorders in L. vannamei [1]. We performed ammonia exposure and Lv-p62 RNAi experiments, measuring gene expression in the hepatopancreas, gills, and intestine to evaluate the involvement of Lv-p62 in ammonia-induced oxidative stress. After ammonia exposure, Lv-p62 expression was significantly upregulated in all three tissues. Similar upregulation of p62 has been reported under starvation-induced oxidative stress in the intestine of Pelodiscus sinensis [23]. However, the peak expression time of Lv-p62 differed markedly among tissues, peaking at 6 h in the gill, 24 h in the intestine, whereas a biphasic response was observed in the hepatopancreas, with a first peak at 12 h and a higher second peak at 48 h. The biphasic expression of Lv-p62 in the hepatopancreas may reflect a stage-dependent response to ammonia stress. The first peak at 12 h may indicate an early transcriptional response to acute ammonia-induced cellular stress, whereas the higher peak at 48 h may be associated with accumulated cellular damage and enhanced Lv-p62-related autophagy/ubiquitin-associated stress signaling [10,19]. This interpretation is consistent with the lower hepatopancreatic vacuolation and weaker TUNEL-positive signals observed in the dsRNA-Lv-p62+NH3 group than in the dsRNA-EGFP+NH3 group, suggesting that sustained Lv-p62 upregulation may be associated with the hepatopancreatic response under ammonia exposure. Since p62 can interact with Keap1 and promote Nrf2-mediated antioxidant responses, the second peak may indicate activation of a p62-Keap1-Nrf2-related adaptive response to prolonged oxidative stress [11,15]. The different Gpx responses after Lv-p62 knockdown may be related to tissue-specific physiological functions. The gill and hepatopancreas show different toxicity responses under ammonia exposure [2], while the hepatopancreas has important roles in metabolism and immune regulation [24]. Therefore, Lv-p62 knockdown may affect antioxidant gene regulation differently among tissues, possibly through p62-related antioxidant signaling such as the Keap1–Nrf2 pathway [25]. Physiologically, the gill is the tissue directly exposed to ammonia, which may explain its earliest response in Lv-p62 expression under ammonia exposure [2]. Cong et al. also reported that the gill was the fastest-responding tissue in Ruditapes philippinarum under ammonia exposure [26]. These results suggest that Lv-p62 may be involved in ammonia-induced oxidative stress.
Our results revealed tissue-specific expression patterns of antioxidant genes following ammonia exposure and Lv-p62 knockdown. Notably, Gpx expression in the dsRNA-Lv-p62+NH3 group was significantly higher than that in the dsRNA-EGFP+NH3 group in both the gill and intestine, whereas Trx and Gst expression mostly showed the opposite pattern. These changes suggest that Lv-p62 knockdown did not simply suppress the antioxidant system, but disturbed the balance of antioxidant gene regulation in a tissue-dependent manner. Mechanistically, this response may be closely associated with the p62–Keap1–Nrf2 signaling axis. Under oxidative stress, accumulated p62 can interact with Keap1, competitively inhibit Keap1-mediated repression of Nrf2, and thereby promote Nrf2 stabilization and transcriptional activation of antioxidant and detoxification genes [25,27]. Ammonia-induced ROS accumulation may disrupt redox homeostasis, promote oxidative damage, and induce increased apoptotic signals [7]. In addition, ammonia nitrogen stress can induce oxidative stress and autophagy-related responses in the shrimp hepatopancreas [14]. In the present study, hepatopancreatic structural damage, vacuolation, and increased TUNEL-positive signals were observed under short-term ammonia exposure, whereas the dsRNA-Lv-p62+NH3 group showed milder histological alterations and weaker TUNEL-positive signals than the dsRNA-EGFP+NH3 group. These results suggest that Lv-p62 may participate in the acute hepatopancreatic response to ammonia stress; however, whether this effect persists under long-term ammonia exposure requires further investigation. The increased Gpx expression in the gill and intestine after Lv-p62 knockdown may represent a compensatory response to enhanced oxidative pressure or activation of alternative antioxidant pathways. In contrast, the hepatopancreas did not show the same Gpx upregulation, which may be related to its central metabolic and detoxification functions and its greater susceptibility to ammonia-induced cellular damage. Under severe or prolonged stress, hepatopancreatic cells may have limited capacity to further activate Gpx transcription after Lv-p62 knockdown. Another possible explanation is that antioxidant regulation in the hepatopancreas depends more strongly on the p62–Keap1–Nrf2 axis, whereas the gill and intestine may activate additional compensatory pathways because they are directly exposed to environmental ammonia or involved in barrier defense. Conversely, as reported in previous studies, p62 knockdown can indirectly upregulate certain antioxidant genes by restoring FOXO1/3 expression [28]. Thus, the increased Gpx expression observed in the gill and intestine after Lv-p62 knockdown may represent a compensatory response to enhanced oxidative pressure or activation of alternative antioxidant pathways [28], whereas the decreased or less responsive expression of Trx and Gst may reflect impaired Nrf2/Keap1-mediated transcriptional regulation [25,27]. These findings imply that Lv-p62 modulates antioxidant responses in a tissue-specific manner, probably via the Nrf2 pathway.
The expression of ATG4 and ATG10 in the hepatopancreas in the dsRNA-EGFP+NH3 group and the dsRNA-Lv-p62+NH3 group showed a downward trend after ammonia exposure. The result is consistent with a previous report [14]. Compared with the dsRNA-EGFP+NH3 group, ATG10 expression in the gill and intestine was significantly downregulated in the dsRNA-Lv-p62+NH3 group. We have previously found that knocking down p62 led to the downregulation of autophagy gene expression [13]. These results indicate that p62 is involved in regulating autophagy.
The expression of caspase 3 in all tested tissues in the dsRNA-EGFP+NH3 group was upregulated at 6 h after ammonia exposure. Ammonia and Vibrio infection might trigger apoptosis [13,29]. Overall, the expression of caspase 3 and p53 was higher in the dsRNA-EGFP+NH3 group than in the dsRNA-Lv-p62+NH3 group. This is similar to the results in the Vibrio infection experiment [13]. TUNEL analysis showed that the dsRNA-Lv-p62+NH3 group had fewer TUNEL-positive signals than the dsRNA-EGFP+NH3 group. Knockdown of p62 could reduce the apoptosis of U87MG human glioma cells [30]. Collectively, these results suggest that Lv-p62 may be involved in apoptosis-related responses during ammonia exposure in L. vannamei.
For crustaceans, the hepatopancreas is an important organ with multiple functions [24]. Therefore, histological analysis in this study was focused on the hepatopancreas because it is a major immune, metabolic, and detoxification organ in crustaceans and is highly sensitive to ammonia-induced oxidative damage [7,24,31]. Ding et al. found that black shrimp exposed to acute ammonia exposure exhibited hepatopancreatic oxidative damage, and this result is similar to that observed in the present study [31]. Hepatopancreatic acini in the dsRNA-Lv-p62+NH3 group also exhibited vacuolation, but the degree of vacuolar damage was lower than that in the dsRNA-EGFP+NH3 group. These findings suggest that Lv-p62 may be associated with hepatopancreatic apoptosis-related responses and tissue damage under short-term ammonia exposure. Qian et al. also found that liver damage in mice with p62 knockdown could be effectively repaired at 48 h after APAP-induced liver injury [32]. These observations are consistent with the possibility that Lv-p62 is involved in hepatopancreatic apoptosis-related responses and tissue damage under ammonia exposure. In the present experimental design, the effects of Lv-p62 knockdown were evaluated under ammonia exposure by comparing the dsRNA-EGFP+NH3 and dsRNA-Lv-p62+NH3 groups. Therefore, the interpretation of these results was limited to the comparison between these two groups under short-term ammonia exposure. In addition, the newly added RNAi efficiency data under non-ammonia conditions confirmed the effective knockdown of Lv-p62, supporting the reliability of the RNAi strategy used in this study. Accordingly, the conclusions were framed to describe the involvement of Lv-p62 in responses to ammonia exposure, rather than its basal function under non-ammonia conditions. Further studies should validate the proposed mechanism at the protein and functional levels, including protein abundance, enzyme activity, Nrf2 activation, determination of un-ionized ammonia levels, and quantitative histological assessment across multiple time points.

5. Conclusions

In this study, ammonia exposure combined with RNAi was used to investigate the function of Lv-p62 in the ammonia exposure response of L. vannamei. Knockdown of Lv-p62 altered the tissue-specific expression patterns of antioxidant-, autophagy-, and apoptosis-related genes, and alleviated ammonia-induced hepatopancreatic injury and apoptosis. These findings suggest that Lv-p62 participates in mediating ammonia-induced oxidative stress and tissue damage in L. vannamei. Overall, this study provides new insight into the role of Lv-p62 in ammonia stress adaptation in shrimp.

Author Contributions

Conceptualization, W.L., J.L. and L.F.; methodology, W.L. and J.J.; investigation, W.L., J.L. and S.C.; validation, J.L., L.F. and S.C.; resources, J.L. and J.J.; data curation, W.L. and J.L.; visualization, L.F.; writing—original draft preparation, W.L.; writing—review and editing, S.Y.; project administration, S.Y.; funding acquisition, S.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Innovative Team Building Project of Guangdong Modern Agricultural Industrial Technology System (Grant 2026CXTD27), Zhanjiang Science and Technology Plan Project (2025522), the Modern Seed Industry Park for White-leg Shrimp of Guang dong Province (Grant K22219).

Institutional Review Board Statement

The use of all animals in this project was conducted under the Animal Welfare Act, the PHS Animal Welfare Policy, the National Institutes of Health (NIH) Guide for Care and Use of Laboratory Animals, and the policies and procedures of the People’s Republic of China, Guangdong province, and Guangdong Ocean University. The study was conducted incompliance with the regulations for administering laboratory animals in Guangdong province, Chinand in compliance with the Guangdong Ocean University Research Council’s guidelines for the care and use of laboratory animals (approval number: GDOU-LAE-2026-054, approval date: 5 December 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

Upon a reasonable request, the corresponding author will provide the data supporting the results of this study.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
SQSTM1Sequestosome 1
Lv-p62Litopenaeus vannamei p62
RNAiRNA interference
dsRNADouble-stranded RNA
EGFPEnhanced green fluorescent protein
qRT-PCRQuantitative real-time polymerase chain reaction
ROSReactive oxygen species
Nrf2Nuclear factor E2-related factor 2
AREAntioxidant response elements
Keap1Kelch-like ECH-associated protein 1
TrxThioredoxin
GstGlutathione S-transferase
GpxGlutathione peroxidase
ATGAutophagy-related gene
caspase 3Cysteinyl aspartate specific proteinase 3
p53Tumor protein 53
HEHematoxylin–eosin
TUNELTerminal deoxynucleotidyl transferase dUTP nick-end labeling
EF-1αElongation factor 1 alpha
NH3Ammonia
NH4ClAmmonium chloride

Appendix A

The primers used for qRT-PCR are listed in Table A1.
Table A1. Sequences of primers used in this study.
Table A1. Sequences of primers used in this study.
Gene NamesSequence (5′–3′)
dsp62-T7FTAATACGACTCACTATAGGGAGGATCTCTGTGCTGCCTGCGAGTTTA
dsp62-T7RTAATACGACTCACTATAGGGAGTGTCCAAGGACATTCCTTGTCTTTG
dsEGFP-T7FTAATACGACTCACTATAGGGAGGTGCCCATCCTGGTCGAGCT
dsEGFP-T7RTAATACGACTCACTATAGGGAGTGCACGCTGCCGTCCTCGAT
p62-FATGTCAGACGACAGAAGCATGAGCG
p62-RTTATTTGTTGACTGGCTGAAGAATG
qTrx-FTTAACGAGGCTGGAAACA
qTrx-RAACGACATCGCTCATAGA
qGst-FAAGATAACGCAGAGCAAGG
qGst-RTCGTAGGTGACGGTAAAGA
qGpx-FAGGGACTTCCACCAGATG
qGpx-RCAACAACTCCCCTTCGGTA
qAtg4-FCTTTGTTGGTGATGAGGTCGTCTA
qAtg4-RACTTGTCTGTTTCCACTTCCGTTT
qAtg10-FCAATCACTCGGGTAAACTTCT
qAtg10-RGGATGCTCTTGTTGCGTCAGG
qP53-FATCCCGTGGGATTCTCTCCA
qP53-RATTTGTGACGACCTGCCCAT
qCaspase3-FAACCAAGGCATCCCTGTCA
qCaspase3-RGGGTTTATTCTGAAGTTGTGGG
EF1α-FGTATTGGAACAGTGCCCGTG
EF1α-RACCAGGGACAGCCTCAGTAAG

References

  1. Lin, L.; Zhuo, H.; Zhang, Y.; Li, J.; Zhou, X.; Wu, G.; Guo, C.; Liu, J. Effects of Ammonia Exposure and Post-Exposure Recovery in Pacific White Shrimp, Litopenaeus vannamei: Histological, Physiological and Molecular Responses. Aquat. Toxicol. 2024, 277, 107133. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, Y.; Liu, J.; Zhuo, H.; Lin, L.; Li, J.; Fu, S.; Xue, H.; Wen, H.; Zhou, X.; Guo, C.; et al. Differential Toxicity Responses between Hepatopancreas and Gills in Litopenaeus vannamei under Chronic Ammonia-N Exposure. Animals 2023, 13, 3799. [Google Scholar] [CrossRef]
  3. Frías-Espericueta, M.G.; Harfush-Melendez, M.; Páez-Osuna, F. Effects of Ammonia on Mortality and Feeding of Postlarvae Shrimp Litopenaeus vannamei. Bull. Environ. Contam. Toxicol. 2000, 65, 98–103. [Google Scholar] [CrossRef]
  4. Edwards, T.M.; Puglis, H.J.; Kent, D.B.; Durán, J.L.; Bradshaw, L.M.; Farag, A.M. Ammonia and Aquatic Ecosystems—A Review of Global Sources, Biogeochemical Cycling, and Effects on Fish. Sci. Total Environ. 2024, 907, 167911. [Google Scholar] [CrossRef]
  5. Yun, S.C.; Jeong, H.; Lee, J.-S.; Kim, J.-H.; Kim, I.-C.; Maszczyk, P.; Yang, Z.; Hagiwara, A.; Lee, J.-S. A Review of Ammonia Toxicity on Aquatic Organisms: Species-Specific Responses, Microbial Shifts, and Environmental Interactions. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2026, 300, 110388. [Google Scholar] [CrossRef]
  6. Li, X.; Wang, S.; Zhang, M.; Li, M. Enhancement of Autophagy Can Alleviate Oxidative Stress, Inflammation, and Apoptosis Induced by Ammonia Stress in Yellow Catfish Pelteobagrus fulvidraco. Fish Shellfish. Immunol. 2024, 149, 109582. [Google Scholar] [CrossRef]
  7. Liang, Z.; Liu, R.; Zhao, D.; Wang, L.; Sun, M.; Wang, M.; Song, L. Ammonia Exposure Induces Oxidative Stress, Endoplasmic Reticulum Stress and Apoptosis in Hepatopancreas of Pacific White Shrimp (Litopenaeus vannamei). Fish Shellfish. Immunol. 2016, 54, 523–528. [Google Scholar] [CrossRef]
  8. Bian, D.-D.; Shi, Y.-X.; Zhang, X.; Liu, X.; Jiang, J.-J.; Zhu, X.-R.; Zhang, D.-Z.; Liu, Q.-N.; Zhu, B.-J.; Tang, B.-P. Nitrite Toxicity in Shrimp Aquaculture: Mechanisms, Health Impacts, and Sustainable Mitigation Strategies. Rev. Aquac. 2025, 17, e70062. [Google Scholar] [CrossRef]
  9. Ortega, M.A.; García-Montero, C.; Fraile-Martínez, O.; García-Honduvilla, N.; Álvarez-Mon, M.; Buján, J.; Asúnsolo, Á. Autophagy in Its (Proper) Context: Molecular Basis, Biological Functions, and Therapeutic Perspectives. Cells 2024, 13, 1016. [Google Scholar] [CrossRef]
  10. Kim, S.; Lee, W.; Cho, K. p62 Links the Autophagy Pathway and the Ubiquitin–Proteasome System in Endothelial Cells during Atherosclerosis. Int. J. Mol. Sci. 2021, 22, 7791. [Google Scholar] [CrossRef] [PubMed]
  11. Katsuragi, Y.; Ichimura, Y.; Komatsu, M. Regulation of the Keap1–Nrf2 Pathway by p62/SQSTM1. Curr. Opin. Toxicol. 2016, 1, 54–61. [Google Scholar] [CrossRef]
  12. Hennig, P.; Fenini, G.; Di Filippo, M.; Karakaya, T.; Beer, H.-D. The Pathways Underlying the Multiple Roles of p62 in Inflammation and Cancer. Biomedicines 2021, 9, 707. [Google Scholar] [CrossRef]
  13. Luo, J.; Lu, W.; Chen, Y.; Li, G.; Feng, J.; Huang, Y.; Yu, Y.; Cai, S.; Jian, J.; Yang, S. SQSTM1/p62 from Litopenaeus vannamei Is Involved in the Immune Response to Vibrio Infection. Fish Shellfish. Immunol. 2025, 158, 110161. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, F.; Huang, L.; Liao, M.; Dong, W.; Liu, C.; Zhuang, X.; Liu, Y.; Yin, X.; Liang, Q.; Wang, W. Pva-miR-252 Participates in Ammonia Nitrogen-Induced Oxidative Stress by Modulating Autophagy in Penaeus vannamei. Ecotoxicol. Environ. Safe 2021, 225, 112774. [Google Scholar] [CrossRef]
  15. Wu, J.; Hou, S.; Yang, L.; Wang, Y.; Wen, C.; Guo, Y.; Luo, S.; Fang, H.; Jiao, H.; Xu, H.; et al. p62/SQSTM1 Upregulates NQO1 Transcription via Nrf2/Keap1a Signaling Pathway to Resist Microcystins-Induced Oxidative Stress in Freshwater Mussel Cristaria plicata. Aquat. Toxicol. 2023, 255, 106398. [Google Scholar] [CrossRef]
  16. Wei, C.-C.; Luo, Z.; Song, Y.-F.; Pan, Y.-X.; Zhuo, M.-Q. Characterization of Twelve Autophagy-Related Genes from Yellow Catfish Pelteobagrus fulvidraco and Their Transcriptional Responses to Waterborne Zinc Exposure. Ecol. Indic. 2018, 93, 677–686. [Google Scholar] [CrossRef]
  17. Zhang, Y.; Li, C.; Zhang, M.; Gao, F.; Zhao, Y.; Kong, X. Selective Autophagy Receptor p62 Promotes Antibacterial and Antiviral Immunity in Common Carp (Cyprinus carpio). Fish Shellfish. Immunol. 2024, 151, 109719. [Google Scholar] [CrossRef]
  18. Huang, Y.; Li, Q.; Yang, S.; Yuan, Y.; Zhang, Z.; Jiang, B.; Lv, J.; Zhong, J.; Jian, J. Identification and Characterization of Heme Oxygenase-1 from Litopenaeus vannamei Involved in Antioxidant and Anti-Apoptosis under Ammonia Stress. Fishes 2022, 7, 356. [Google Scholar] [CrossRef]
  19. Lin, X.; Li, S.; Zhao, Y.; Ma, X.; Zhang, K.; He, X.; Wang, Z. Interaction Domains of p62: A Bridge between p62 and Selective Autophagy. DNA Cell Biol. 2013, 32, 220–227. [Google Scholar] [CrossRef]
  20. Liu, H.; Dai, C.; Fan, Y.; Guo, B.; Ren, K.; Sun, T.; Wang, W. From Autophagy to Mitophagy: The Roles of p62 in Neurodegenerative Diseases. J. Bioenerg. Biomembr. 2017, 49, 413–422. [Google Scholar] [CrossRef]
  21. Yamada, M.; Iwata, M.; Warabi, E.; Oishi, H.; Lira, V.A.; Okutsu, M. p62/SQSTM1 and Nrf2 Are Essential for Exercise-Mediated Enhancement of Antioxidant Protein Expression in Oxidative Muscle. FASEB J. 2019, 33, 8022–8032. [Google Scholar] [CrossRef]
  22. Huang, M.; Zhang, W.; Yang, Y.; Shao, W.; Wang, J.; Cao, W.; Zhu, Z.; Yang, F.; Zheng, H. From Homeostasis to Defense: Exploring the Role of Selective Autophagy in Innate Immunity and Viral Infections. Clin. Immunol. 2024, 262, 110169. [Google Scholar] [CrossRef] [PubMed]
  23. Shi, X.; Yue, D.; Guo, Q.; Li, X.; Zhang, P.; Liu, H. Starvation Affects the Intestinal Oxidative Stress, Autophagy, Microbiota and Histology of Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Aquacult. Rep. 2025, 42, 102835. [Google Scholar] [CrossRef]
  24. Rőszer, T. The Invertebrate Midintestinal Gland (“Hepatopancreas”) Is an Evolutionary Forerunner in the Integration of Immunity and Metabolism. Cell Tissue Res. 2014, 358, 685–695. [Google Scholar] [CrossRef]
  25. Komatsu, M.; Kurokawa, H.; Waguri, S.; Taguchi, K.; Kobayashi, A.; Ichimura, Y.; Sou, Y.-S.; Ueno, I.; Sakamoto, A.; Tong, K.I.; et al. The Selective Autophagy Substrate p62 Activates the Stress Responsive Transcription Factor Nrf2 through Inactivation of Keap1. Nat. Cell Biol. 2010, 12, 213–223. [Google Scholar] [CrossRef]
  26. Cong, M.; Wu, H.; Cao, T.; Ji, C.; Lv, J. Effects of Ammonia Nitrogen on Gill Mitochondria in Clam Ruditapes philippinarum. Environ. Toxicol. Pharmacol. 2019, 65, 46–52. [Google Scholar] [CrossRef]
  27. Jain, A.; Lamark, T.; Sjøttem, E.; Bowitz Larsen, K.; Atesoh Awuh, J.; Øvervatn, A.; McMahon, M.; Hayes, J.D.; Johansen, T. p62/SQSTM1 Is a Target Gene for Transcription Factor NRF2 and Creates a Positive Feedback Loop by Inducing Antioxidant Response Element-Driven Gene Transcription. J. Biol. Chem. 2010, 285, 22576–22591. [Google Scholar] [CrossRef]
  28. Zhao, L.; Li, H.; Wang, Y.; Zheng, A.; Cao, L.; Liu, J. Autophagy Deficiency Leads to Impaired Antioxidant Defense via p62-FOXO1/3 Axis. Oxidative Med. Cell. Longev. 2019, 2019, 2526314. [Google Scholar] [CrossRef]
  29. Zhang, M.; Li, M.; Wang, R.; Qian, Y. Effects of Acute Ammonia Toxicity on Oxidative Stress, Immune Response and Apoptosis of Juvenile Yellow Catfish Pelteobagrus fulvidraco and the Mitigation of Exogenous Taurine. Fish Shellfish. Immunol. 2018, 79, 313–320. [Google Scholar] [CrossRef] [PubMed]
  30. Zhang, Y.-B.; Gong, J.-L.; Xing, T.-Y.; Zheng, S.-P.; Ding, W. Autophagy Protein p62/SQSTM1 Is Involved in HAMLET-Induced Cell Death by Modulating Apotosis in U87MG Cells. Cell Death Dis. 2013, 4, e550. [Google Scholar] [CrossRef] [PubMed]
  31. Ding, Y.; Jiang, S.; Jiang, S.; Li, Y.; Yang, Q.; Yang, L.; Huang, J.; Shi, J.; Li, P.; Diao, H.; et al. Metabolic Response of Black Tiger Shrimp (Penaeus monodon) to Acute Ammonia Nitrogen Stress. Biology 2025, 14, 501. [Google Scholar] [CrossRef] [PubMed]
  32. Qian, H.; Bai, Q.; Yang, X.; Akakpo, J.Y.; Ji, L.; Yang, L.; Rülicke, T.; Zatloukal, K.; Jaeschke, H.; Ni, H.-M.; et al. Dual Roles of p62/SQSTM1 in the Injury and Recovery Phases of Acetaminophen-Induced Liver Injury in Mice. Acta Pharm. Sin. B 2021, 11, 3791–3805. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Tissue-expression dynamics of the Lv-p62 gene in Pacific white shrimp (Litopenaeus vannamei) under ammonia exposure. Relative Lv-p62 expression levels were detected in the hepatopancreas, gill, and intestine at different time points after ammonia exposure. Different letters indicate significant differences among time points (p < 0.05).
Figure 1. Tissue-expression dynamics of the Lv-p62 gene in Pacific white shrimp (Litopenaeus vannamei) under ammonia exposure. Relative Lv-p62 expression levels were detected in the hepatopancreas, gill, and intestine at different time points after ammonia exposure. Different letters indicate significant differences among time points (p < 0.05).
Animals 16 01718 g001
Figure 2. RNA interference efficiency analysis of Lv-p62 in Pacific white shrimp (Litopenaeus vannamei). Relative Lv-p62 expression levels were detected in the hepatopancreas, gill, and intestine at different time points after double-stranded RNA injection. Different letters indicate significant differences among time points (p < 0.05).
Figure 2. RNA interference efficiency analysis of Lv-p62 in Pacific white shrimp (Litopenaeus vannamei). Relative Lv-p62 expression levels were detected in the hepatopancreas, gill, and intestine at different time points after double-stranded RNA injection. Different letters indicate significant differences among time points (p < 0.05).
Animals 16 01718 g002
Figure 3. Expression levels of antioxidant-related genes in Pacific white shrimp (Litopenaeus vannamei) after ammonia stress. The relative expression levels of thioredoxin (Trx), glutathione peroxidase (Gpx), and glutathione S-transferase (Gst) in the hepatopancreas, gill, and intestine were detected by qRT-PCR at different time points after ammonia exposure. Asterisks indicate significant differences between the two treatment groups at the same time point, as determined by an unpaired two-tailed Student’s t-test (* p < 0.05, ** p < 0.01). Grey bars represent the control group before ammonia exposure (0 h).
Figure 3. Expression levels of antioxidant-related genes in Pacific white shrimp (Litopenaeus vannamei) after ammonia stress. The relative expression levels of thioredoxin (Trx), glutathione peroxidase (Gpx), and glutathione S-transferase (Gst) in the hepatopancreas, gill, and intestine were detected by qRT-PCR at different time points after ammonia exposure. Asterisks indicate significant differences between the two treatment groups at the same time point, as determined by an unpaired two-tailed Student’s t-test (* p < 0.05, ** p < 0.01). Grey bars represent the control group before ammonia exposure (0 h).
Animals 16 01718 g003
Figure 4. Expression levels of autophagy-related genes in Pacific white shrimp (Litopenaeus vannamei) after ammonia stress. The relative expression levels of autophagy-related gene 4 (ATG4) and autophagy-related gene 10 (ATG10) in the hepatopancreas, gill, and intestine were detected by qRT-PCR at different time points after ammonia exposure. Asterisks indicate significant differences between the two treatment groups at the same time point, as determined by an unpaired two-tailed Student’s t-test (* p < 0.05, ** p < 0.01). Grey bars represent the control group before ammonia exposure (0 h).
Figure 4. Expression levels of autophagy-related genes in Pacific white shrimp (Litopenaeus vannamei) after ammonia stress. The relative expression levels of autophagy-related gene 4 (ATG4) and autophagy-related gene 10 (ATG10) in the hepatopancreas, gill, and intestine were detected by qRT-PCR at different time points after ammonia exposure. Asterisks indicate significant differences between the two treatment groups at the same time point, as determined by an unpaired two-tailed Student’s t-test (* p < 0.05, ** p < 0.01). Grey bars represent the control group before ammonia exposure (0 h).
Animals 16 01718 g004
Figure 5. Expression levels of apoptosis-related genes in Pacific white shrimp (Litopenaeus vannamei) after ammonia stress. The relative expression levels of caspase 3 and tumor protein p53 in the hepatopancreas, gill, and intestine were detected by qRT-PCR at different time points after ammonia exposure. Asterisks indicate significant differences between the two treatment groups at the same time point, as determined by an unpaired two-tailed Student’s t-test (* p < 0.05, ** p < 0.01). Grey bars represent the control group before ammonia exposure (0 h).
Figure 5. Expression levels of apoptosis-related genes in Pacific white shrimp (Litopenaeus vannamei) after ammonia stress. The relative expression levels of caspase 3 and tumor protein p53 in the hepatopancreas, gill, and intestine were detected by qRT-PCR at different time points after ammonia exposure. Asterisks indicate significant differences between the two treatment groups at the same time point, as determined by an unpaired two-tailed Student’s t-test (* p < 0.05, ** p < 0.01). Grey bars represent the control group before ammonia exposure (0 h).
Animals 16 01718 g005
Figure 6. Histological changes in the hepatopancreas of Pacific white shrimp (Litopenaeus vannamei) among the three treatment groups. Notes Representative hematoxylin and eosin (H&E)-stained sections are shown for the dsRNA-EGFP group, the dsRNA-EGFP+NH4Cl group, and the dsRNA-Lv-p62+NH4Cl group. Panels (A) and (B) show the hepatopancreatic tissue at 200× and 400× magnification, respectively. Black boxes indicate the regions enlarged in the corresponding higher-magnification images. Arrows indicate hepatopancreatic tubule cavitation, lumen enlargement, and thinning of the tubule wall. Scale bars = 50 μm.
Figure 6. Histological changes in the hepatopancreas of Pacific white shrimp (Litopenaeus vannamei) among the three treatment groups. Notes Representative hematoxylin and eosin (H&E)-stained sections are shown for the dsRNA-EGFP group, the dsRNA-EGFP+NH4Cl group, and the dsRNA-Lv-p62+NH4Cl group. Panels (A) and (B) show the hepatopancreatic tissue at 200× and 400× magnification, respectively. Black boxes indicate the regions enlarged in the corresponding higher-magnification images. Arrows indicate hepatopancreatic tubule cavitation, lumen enlargement, and thinning of the tubule wall. Scale bars = 50 μm.
Animals 16 01718 g006
Figure 7. TUNEL staining of apoptotic hepatopancreatic cells in Pacific white shrimp (Litopenaeus vannamei) among the three treatment groups. Notes: Representative TUNEL-stained hepatopancreatic sections are shown for the dsRNA-EGFP control group, the dsRNA-EGFP+NH4Cl group, and the dsRNA-Lv-p62+NH4Cl group. Green fluorescence indicates TUNEL-positive apoptotic cells, blue fluorescence indicates DAPI-stained nuclei, and merged images show the colocalization of apoptotic signals and nuclei. All sections were observed at 200× magnification. Scale bars are shown in each panel.
Figure 7. TUNEL staining of apoptotic hepatopancreatic cells in Pacific white shrimp (Litopenaeus vannamei) among the three treatment groups. Notes: Representative TUNEL-stained hepatopancreatic sections are shown for the dsRNA-EGFP control group, the dsRNA-EGFP+NH4Cl group, and the dsRNA-Lv-p62+NH4Cl group. Green fluorescence indicates TUNEL-positive apoptotic cells, blue fluorescence indicates DAPI-stained nuclei, and merged images show the colocalization of apoptotic signals and nuclei. All sections were observed at 200× magnification. Scale bars are shown in each panel.
Animals 16 01718 g007
Figure 8. Quantitative analysis of hepatopancreatic cell apoptosis in Pacific white shrimp (Litopenaeus vannamei) based on TUNEL staining. The apoptosis rate was calculated as the percentage of TUNEL-positive cells relative to the total number of DAPI-stained nuclei in the analyzed fields. The three groups correspond to the dsRNA-EGFP group, the dsRNA-EGFP+NH4Cl group, and the dsRNA-Lv-p62+NH4Cl group.
Figure 8. Quantitative analysis of hepatopancreatic cell apoptosis in Pacific white shrimp (Litopenaeus vannamei) based on TUNEL staining. The apoptosis rate was calculated as the percentage of TUNEL-positive cells relative to the total number of DAPI-stained nuclei in the analyzed fields. The three groups correspond to the dsRNA-EGFP group, the dsRNA-EGFP+NH4Cl group, and the dsRNA-Lv-p62+NH4Cl group.
Animals 16 01718 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lu, W.; Luo, J.; Feng, L.; Cai, S.; Jian, J.; Yang, S. The SQSTM1/p62 of Pacific White Shrimp (Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure. Animals 2026, 16, 1718. https://doi.org/10.3390/ani16111718

AMA Style

Lu W, Luo J, Feng L, Cai S, Jian J, Yang S. The SQSTM1/p62 of Pacific White Shrimp (Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure. Animals. 2026; 16(11):1718. https://doi.org/10.3390/ani16111718

Chicago/Turabian Style

Lu, Wei, Junliang Luo, Leyuan Feng, Shuanghu Cai, Jichang Jian, and Shiping Yang. 2026. "The SQSTM1/p62 of Pacific White Shrimp (Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure" Animals 16, no. 11: 1718. https://doi.org/10.3390/ani16111718

APA Style

Lu, W., Luo, J., Feng, L., Cai, S., Jian, J., & Yang, S. (2026). The SQSTM1/p62 of Pacific White Shrimp (Litopenaeus vannamei) Is Involved in the Oxidative Stress Induced by Ammonia Exposure. Animals, 16(11), 1718. https://doi.org/10.3390/ani16111718

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop