N-Carbamylglutamate Improves Production Performance and Muscle Growth by Regulating Protein Digestive Function and Muscle Protein Synthesis in Broiler Chickens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal and Experimental Design
2.2. Growth Performance
2.3. Sample Collection
2.4. Sample Analysis
2.4.1. Apparent Ileal Crude Protein Digestibility Determination
2.4.2. Enzyme Assays
2.4.3. Histological Observation
2.4.4. Amino Acid Determination
2.4.5. Hormone Assays
2.4.6. Messenger RNA Quantification
2.5. Statistical Analysis
3. Results
3.1. Growth Performance and Weight of Leg Muscle and Breast Muscle
3.2. Apparent Ileal Crude Protein Digestibility
3.3. Enzyme Activity
3.4. Histological Changes in Ileum
3.5. Amino Acid Concentrations
3.6. Plasma Hormone Levels
3.7. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| NCG | N-carbamylglutamate |
| ADG | Average daily weight gain |
| ADFI | Average daily feed intake |
| FCR | Feed conversion ratio |
| GABA | Gamma-aminobutyric acid |
| IGF-1 | Insulin-like growth factor 1 |
| mTOR | Mammalian target of rapamycin |
| P70S6K | P70 ribosomal protein S6 kinase |
References
- Tan, X.D.; Liu, R.R.; Zhao, D.; He, Z.X.; Li, W.; Zheng, M.Q.; Li, Q.H.; Wang, Q.; Liu, D.W.; Feng, F.R.; et al. Large-scale genomic and transcriptomic analyses elucidate the genetic basis of high meat yield in chickens. J. Adv. Res. 2024, 55, 1–16. [Google Scholar] [CrossRef]
- Zhang, H.; Elliott, K.E.C.; Durojaye, O.A.; Fatemi, S.A.; Schilling, M.W.; Peebles, E.D. Effects of in ovo injection of L-ascorbic acid on growth performance, carcass composition, plasma antioxidant capacity, and meat quality in broiler chickens. Poult. Sci. 2019, 98, 3617–3625. [Google Scholar] [CrossRef]
- Petracci, M.; Mudalal, S.; Soglia, F.; Cavani, C. Meat quality in fast-growing broiler chickens. World’s Poult. Sci. J. 2015, 71, 363–373. [Google Scholar] [CrossRef]
- Wood, J.D.; Enser, M.; Fisher, A.V.; Nute, G.R.; Sheard, P.R.; Richardson, R.I.; Hughes, S.I.; Whittington, F.M. Fat deposition, fatty acid composition and meat quality, a review. Meat. Sci. 2008, 78, 343–358. [Google Scholar] [CrossRef]
- Zhang, H.; Peng, A.L.; Guo, S.; Wang, M.Z.; Loor, J.J.; Wang, H.R. Dietary N-carbamylglutamate and l-arginine supplementation improves intestinal energy status in intrauterine-growth-retarded suckling lambs. Food Funct. 2019, 10, 1903–1914. [Google Scholar] [CrossRef]
- Ye, C.C.; Zeng, X.Z.; Zhu, J.L.; Liu, Y.; Ye, Q.H.; Qiao, S.Y.; Zeng, X.F. Dietary N-carbamylglutamate supplementation in a reduced protein diet affects carcass traits and the profile of muscle amino acids and fatty acids in finishing pigs. J. Agric. Food. Chem. 2017, 65, 5751–5758. [Google Scholar] [CrossRef]
- Zhu, Z.P.; Gu, C.S.; Hu, S.D.; Li, B.; Huang, L.R.; Zhang, S.; Yin, J.D. Dietary N-Carbamylglutamate supplementation enhances myofiber development and intramuscular fat deposition in growing-finishing pigs. Livest. Sci. 2020, 242, 104310. [Google Scholar] [CrossRef]
- Frank, J.W.; Escobar, J.; Nguyen, H.V.; Jobgen, S.C.; Jobgen, W.S.; Davis, T.A.; Wu, G.Y. Oral N-carbamylglutamate supplementation increases protein synthesis in skeletal muscle of piglets. J. Nutr. 2007, 137, 315–319. [Google Scholar] [CrossRef]
- Wu, X.; Ruan, Z.; Gao, Y.L.; Yin, Y.L.; Zhou, X.H.; Wang, L.; Geng, M.M.; Hou, Y.Q.; Wu, G.Y. Dietary supplementation with l-arginine or N-carbamylglutamate enhances intestinal growth and heat shock protein-70 expression in weanling pigs fed a corn- and soybean meal-based diet. Amino Acids 2010, 39, 831–839. [Google Scholar] [CrossRef]
- Ma, Y.F.; Zhou, S.; Lin, X.; Zeng, W.D.; Mi, Y.L.; Zhang, C.Q. Effect of dietary N-carbamylglutamate on development of ovarian follicles via enhanced angiogenesis in the chicken. Poult. Sci. 2020, 99, 578–589. [Google Scholar] [CrossRef]
- Zhang, H.; Peng, A.L.; Yu, Y.; Guo, S.; Wang, M.Z.; Coleman, D.N.; Loor, J.J.; Wang, H.R. N-carbamylglutamate and l-arginine promote intestinal absorption of amino acids by regulating the mTOR signaling pathway and amino acid and peptide transporters in suckling lambs with intrauterine growth restriction. J. Nutr. 2019, 149, 923–932. [Google Scholar] [CrossRef]
- Zhang, F.D.; Wang, J.; Zhang, H.J.; Wu, S.G.; Lin, J.; Qi, G.H. Effect of amniotic injection of N-Carbamylglutamate on meat quality of broilers. Animals 2020, 10, 576. [Google Scholar] [CrossRef]
- Cai, S.; Zhu, J.L.; Zeng, X.Z.; Ye, Q.H.; Ye, C.C.; Mao, X.B.; Zhang, S.H.; Qiao, S.Y.; Zeng, X.F. Maternal N-Carbamylglutamate supply during early pregnancy enhanced pregnancy outcomes in sows through modulations of targeted genes and metabolism pathways. J. Agric. Food. Chem. 2018, 66, 5845–5852. [Google Scholar] [CrossRef]
- Zhang, H.; Sun, L.W.; Wang, Z.Y.; Deng, M.T.; Nie, H.T.; Zhang, G.M.; Ma, T.W.; Wang, F. N-carbamylglutamate and L-arginine improved maternal and placental development in underfed ewes. Reproduction 2016, 151, 623–635. [Google Scholar] [CrossRef]
- Xiao, L.; Cao, W.; Liu, G.; Fang, T.; Wu, X.; Jia, G.; Chen, X.; Zhao, H.; Wang, J.; Wu, C.; et al. Arginine, N-carbamylglutamate, and glutamine exert protective effects against oxidative stress in rat intestine. Anim. Nutr. 2016, 2, 242–248. [Google Scholar] [CrossRef]
- Ma, Y.; Yao, J.; Zhou, S.; Mi, Y.; Li, J.; Zhang, C. Improvement of eggshell quality by dietary N-carbamylglutamate supplementation in laying chickens. Poult. Sci. 2020, 99, 4085–4095. [Google Scholar] [CrossRef]
- Ma, W.; Lu, Y.; Wang, C. Production performance, egg quality, and uterine gene expression for layers as affected by N-Carbamylglutamate supplementation. Front. Vet. Sci. 2023, 10, 88. [Google Scholar] [CrossRef]
- Wu, X.; Jia, G.; Zhao, H.; Chen, X.; Tang, J.; Wu, C.; Cai, J.; Tian, G.; Wang, J.; Liu, G. Roles of dietary supplementation with arginine or N-carbamylglutamate in modulating the inflammation, antioxidant property, and mRNA expression of antioxidant-relative signaling molecules in the spleen of rats under oxidative stress. Anim. Nutr. 2018, 4, 322–328. [Google Scholar]
- Hu, Y.; Shao, D.; Wang, Q.; Xiao, Y.Q.; Zhao, X.; Shen, Y.R.; Zhang, S.; Tong, H.B.; Shi, S.R. Effects of dietary N-carbamylglutamate supplementation on growth performance, tissue development and blood parameters of yellow-feather broilers. Poult. Sci. 2019, 98, 2241–2249. [Google Scholar] [CrossRef]
- NY/T 33-2004; Poultry Feeding Standards. The Ministry of Agriculture of the People’s Republic of China: Beijing, China, 2004.
- Short, F.J.; Gorton, P.; Wiseman, J.; Boorman, K.N. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed. Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef]
- Wang, S.; Zeng, X.F.; Wang, Q.W.; Zhu, J.L.; Peng, Q.; Hou, C.L.; Thacker, P.; Qiao, S.Y. The antimicrobial peptide sublancin ameliorates necrotic enteritis induced by Clostridium perfringens in broilers. J. Anim. Sci. 2015, 93, 4750–4760. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- He, L.Q.; Wu, L.; Xu, Z.Q.; Li, T.J.; Yao, K.; Cui, Z.J.; Yin, Y.L.; Wu, G.Y. Low-protein diets affect ileal amino acid digestibility and gene expression of digestive enzymes in growing and finishing pigs. Amino Acids 2016, 48, 21–30. [Google Scholar] [CrossRef]
- Tang, X.P.; Liu, X.G.; Liu, H. Effects of dietary probiotic (Bacillus subtilis) supplementation on carcass traits, meat quality, amino acid, and fatty acid profile of broiler chickens. Front. Vet. Sci. 2021, 8, 767802. [Google Scholar] [CrossRef]
- Gorissen, S.H.M.; Trommelen, J.; Kouw, I.W.K.; Holwerda, A.M.; Pennings, B.; Groen, B.B.L.; Wall, B.T.; Churchward-Venne, T.A.; Horstman, A.M.H.; Koopman, R.; et al. Protein type, protein dose, and age modulate dietary protein digestion and phenylalanine absorption kinetics and plasma phenylalanine availability in humans. J. Nutr. 2020, 150, 2041–2050. [Google Scholar] [CrossRef]
- Timmerman, K.L.; Lee, J.L.; Fujita, S.; Dhanani, S.; Dreyer, H.C.; Fry, C.S.; Drummond, M.J.; Sheffield-Moore, M.; Rasmussen, B.B.; Volpi, E. Pharmacological vasodilation improves insulin-stimulated muscle protein anabolism but not glucose utilization in older adults. Diabetes 2010, 59, 2764–2771. [Google Scholar] [CrossRef]
- Toth, M.J.; LeWinter, M.M.; Ades, P.A.; Matthews, D.E. Impaired muscle protein anabolic response to insulin and amino acids in heart failure patients, relationship with markers of immune activation. Clin. Sci. 2010, 119, 467–476. [Google Scholar] [CrossRef]
- Devries, M.C.; McGlory, C.; Bolster, D.R.; Kamil, A.; Rahn, M.; Harkness, L.; Baker, S.K.; Phillips, S.M. Protein leucine content is a determinant of shorter- and longer-term muscle protein synthetic responses at rest and following resistance exercise in healthy older women, a randomized, controlled trial. Am. J. Clin. Nutr. 2018, 107, 217–226. [Google Scholar] [CrossRef]
- Sharples, A.P.; Hughes, D.C.; Deane, C.S.; Saini, A.; Selman, C.; Stewart, C.E. Longevity and skeletal muscle mass, the role of IGF signalling, the sirtuins, dietary restriction and protein intake. Aging Cell 2015, 14, 511–523. [Google Scholar] [CrossRef]
- van Vliet, S.; Burd, N.A.; van Loon, L.J.C. The skeletal muscle anabolic response to plant- versus animal-based protein consumption. J. Nutr. 2015, 145, 1981–1991. [Google Scholar] [CrossRef]
- Morris, C.R.; Hamilton-Reeves, J.; Martindale, R.G.; Sarav, M.; Ochoa Gautier, J.B. Acquired amino acid deficiencies: A focus on arginine and glutamine. Nutr. Clin. 2017, 32, 30S–47S. [Google Scholar] [CrossRef]
- Wu, Z.; Hou, Y.; Hu, S.; Bazer, F.W.; Meininger, C.J.; McNeal, C.J.; Wu, G. Catabolism and safety of supplemental L-arginine in animals. Amino Acids 2016, 48, 1541–1552. [Google Scholar] [CrossRef]
- Wu, X.; Wan, D.; Xie, C.; Li, T.; Huang, R.; Shu, X.; Ruan, Z.; Deng, Z.; Yin, Y. Acute and sub-acute oral toxicological evaluations and mutagenicity of N-carbamylglutamate (NCG). Regul. Toxicol. Pharmacol. 2015, 73, 296–302. [Google Scholar] [CrossRef]
- Ospina-Rojas, I.C.; Pozza, P.C.; Rodrigueiro, R.J.B.; Gasparino, E.; Khatlab, A.S.; Murakami, A.E. High leucine levels affecting valine and isoleucine recommendations in low-protein diets for broiler chickens. Poult. Sci. 2020, 99, 5946–5959. [Google Scholar] [CrossRef]
- Mehri, M.; Bagherzadeh-Kasmani, F.; Rokouei, M. Growth responses of breast and leg muscles to essential amino acids in broiler chicks. Animal 2016, 10, 390–395. [Google Scholar] [CrossRef]
- Kruse, R.; Petersson, S.J.; Christensen, L.L.; Kristensen, J.M.; Sabaratnam, R.; Ortenblad, N.; Andersen, M.; Hojlund, K. Effect of long-term testosterone therapy on molecular regulators of skeletal muscle mass and fibre-type distribution in aging men with subnormal testosterone. Metabolism 2020, 112, 154347. [Google Scholar] [CrossRef]
- Ma, S.; Liu, J.; Zhao, Y.L.; Wang, Y.; Zhao, R.Q. In ovo betaine injection improves breast muscle growth in newly hatched goslings through FXR/IGF-2 pathway. Poult. Sci. 2024, 103, 104075. [Google Scholar] [CrossRef]
- Scanes, C.G. Perspectives on the endocrinology of poultry growth and metabolism. Gen. Comp. Endocrinol. 2009, 163, 24–32. [Google Scholar] [CrossRef]
- Li, D.F.; Wang, Q.; Shi, K.; Lu, Y.L.; Yu, D.B.; Shi, X.L.; Du, W.X.; Yu, M.L. Testosterone promotes the proliferation of chicken embryonic myoblasts via androgen receptor mediated PI3K/Akt signaling pathway. Int. J. Mol. Sci. 2020, 21, 1152. [Google Scholar] [CrossRef]
- Yuneldi, R.F.; Airin, C.M.; Saragih, H.T.S.; Prawira, A.Y.; Astuti, P. Testosterone hormone levels and breast muscle performance of Pelung chickens after zinc sulfate and synthetic testosterone supplementation. Vet. World 2024, 17, 2365–2369. [Google Scholar] [CrossRef]
- Wen, C.; Wu, P.; Chen, Y.P.; Wang, T.; Zhou, Y.M. Methionine improves the performance and breast muscle growth of broilers with lower hatching weight by altering the expression of genes associated with the insulin-like growth factor-I signalling pathway. Br. J. Nutr. 2014, 111, 201–206. [Google Scholar] [CrossRef]
- Ma, B.B.; He, X.F.; Lu, Z.; Zhang, L.; Li, J.L.; Jiang, Y.; Zhou, G.H.; Gao, F. Chronic heat stress affects muscle hypertrophy, muscle protein synthesis and uptake of amino acid in broilers via insulin like growth factor-mammalian target of rapamycin signal pathway. Poult. Sci. 2018, 97, 4150–4158. [Google Scholar] [CrossRef]
- Wang, Y.H.; Ayalew, H.; Wang, J.; Wu, S.G.; Qiu, K.; Qi, G.H.; Zhang, H.J. N-Carbamylglutamate in ovo feeding improves carcass yield, muscle fiber development, and meat quality in broiler chickens. J. Sci. Food. Agric. 2024, 104, 8089–8098. [Google Scholar]
- Therdyothin, A.; Phiphopthatsanee, N.; Isanejad, M. The effect of omega-3 fatty acids on sarcopenia, mechanism of action and potential efficacy. Mar. Drugs 2023, 21, 399. [Google Scholar] [CrossRef]
- Zeng, X.F.; Huang, Z.M.; Mao, X.B.; Wang, J.J.; Wu, G.Y.; Qiao, S.Y. N-carbamylglutamate enhances pregnancy outcome in rats through activation of the PI3K/PKB/mTOR signaling pathway. PLoS ONE 2012, 7, e41192. [Google Scholar] [CrossRef]
- Hu, C.J.; Li, F.N.; Duan, Y.H.; Kong, X.F.; Yan, Y.L.; Deng, J.P.; Tan, C.Q.; Wu, G.Y.; Yin, Y.L. Leucine alone or in combination with glutamic acid, but not with arginine, increases biceps femoris muscle and alters muscle AA transport and concentrations in fattening pigs. J. Anim. Physiol. Anim. Nutr. 2019, 103, 791–800. [Google Scholar] [CrossRef]
- D’Antona, G.; Ragni, M.; Cardile, A.; Tedesco, L.; Dossena, M.; Bruttini, F.; Caliaro, F.; Corsetti, G.; Bottinelli, R.; Carruba, M.O.; et al. Branched-chain amino acid supplementation promotes survival and supports cardiac and skeletal muscle mitochondrial biogenesis in middle-aged nice. Cell Metab. 2010, 12, 362–372. [Google Scholar] [CrossRef]
- Caldow, M.K.; Ham, D.J.; Trieu, J.; Chung, J.D.; Lynch, G.S.; Koopman, R. Glycine protects muscle cells from wasting in vitro via mTORC1 signaling. Front. Nutr. 2019, 6, 172. [Google Scholar] [CrossRef]
- Lee, K.; Jin, H.; Chei, S.; Oh, H.J.; Lee, J.Y.; Lee, B.Y. Effect of dietary silk peptide on obesity, hyperglycemia, and skeletal muscle regeneration in high-fat diet-fed mice. Cells 2020, 9, 377. [Google Scholar] [CrossRef]





| Ingredient and Composition | Day 1 to 21: Starter (%) | Day 22 to 42: Finisher (%) |
|---|---|---|
| Corn | 55.13 | 57.70 |
| Soybean meal | 38 | 36 |
| Soybean oil | 3.0 | 3.0 |
| Limestone | 1 | 1 |
| Dicalcium phosphate | 1.7 | 1.2 |
| NaCl | 0.3 | 0.3 |
| Lys | 0.25 | 0.3 |
| Met | 0.25 | 0.16 |
| Trace mineral premix 1 | 0.1 | 0.1 |
| Vitamin–mineral premix 2 | 0.14 | 0.14 |
| Choline chloride | 0.13 | 0.10 |
| Total | 100 | 100 |
| Calculated nutrient (%) | ||
| Crude protein | 21.09 | 20.03 |
| Ca | 1.05 | 0.85 |
| P | 0.56 | 0.45 |
| Available P | 0.42 | 0.38 |
| Lys | 1.22 | 1.04 |
| Met | 0.52 | 0.48 |
| AME (kcal/kg) | 3050 | 3010 |
| Gene | Forward Primer (5′−3′) | Reverse Primer (5′−3′) | Fragment Size (bp) | GenBank Accession Number |
|---|---|---|---|---|
| mTOR | AGCTCACACCCCTGTTTGAA | GCAACGTGCTCTCACAATG | 121 | XM_417614.6 |
| P70S6K | AAGTTGAATAGGAGGGC | GAAGATGTCACTGCGAAT | 148 | NM_205816.1 |
| β-actin | ATCCGGACCCTCCATTGTC | AGCCATGCCAATCTCGTCTT | 120 | NM205518 |
| Item | Levels of NCG | |||
|---|---|---|---|---|
| 0 | 150 g/t | 300 g/t | 450 g/t | |
| ADG (g/day) | 55.29 ± 2.03 b | 57.68 ± 3.96 a | 58.22 ± 4.61 a | 59.13 ± 3.98 a |
| ADFI (g) | 89.44 ± 6.45 | 91.51 ± 8.17 | 89.96 ± 7.86 | 88.63 ± 8.19 |
| FCR | 1.61 ± 0.08 a | 1.60 ± 0.10 a | 1.53 ± 0.06 b | 1.50 ± 0.08 b |
| Carcass weight (g) | 12,028 ± 72 | 1349 ± 61 | 1335 ± 85 | 1436 ± 74 |
| Weight of leg muscle (g) | 456.8 ± 41.8 c | 516.9 ± 45.6 b | 505.6 ± 49.1 b | 571.5 ± 46.1 a |
| Weight of breast muscle (g) | 310.6 ± 42.7 b | 345.4 ± 55.7 a | 347.1 ± 46.5 a | 346.2 ± 43.9 a |
| Item | Levels of NCG | |||
|---|---|---|---|---|
| 0 | 150 g/t | 300 g/t | 450 g/t | |
| Villus height (μm) | 879.1 ± 53.2 b | 893.6 ± 36.5 b | 968.3 ± 28.9 a | 947.2 ± 40.1 a |
| Crypt depth (μm) | 112.6 ± 13.1 | 106.5 ± 14.4 | 117.4 ± 11.5 | 105.9 ± 15.4 |
| Villus height/crypt depth | 7.85 ± 0.09 | 8.52 ± 0.12 | 8.27 ± 0.07 | 8.93 ± 0.08 |
| Amino Acids | Levels of NCG | |||
|---|---|---|---|---|
| 0 | 150 g/t | 300 g/t | 450 g/t | |
| Alanine | 390.5 ± 15.0 | 410.3 ± 8.4 | 395.2 ± 12.9 | 407.9 ± 11.54 |
| Arginine | 174.3 ± 15.8 b | 167.4 ± 12.1 b | 186.6 ± 13.9 a | 191.6 ± 14.2 a |
| Asparagine | 36.16 ± 3.34 | 40.53 ± 2.84 | 38.21 ± 4.73 | 36.42 ± 8.07 |
| Aspartic acid | 27.18 ± 2.15 | 27.76 ± 2.39 | 27.35 ± 3.06 | 28.94 ± 2.97 |
| Cysteine | 39.19 ± 4.56 | 38.78 ± 4.40 | 37.78 ± 3.55 | 36.22 ± 2.58 |
| GABA | 0.91 ± 0.19 b | 1.57 ± 0.28 a | 1.44 ± 0.13 a | 1.52 ± 0.17 a |
| Glutamate | 1589.4 ± 251.9 b | 1704.6 ± 431.7 a | 1699.0 ± 333.5 a | 1709.9 ± 379.8 a |
| Glutamine | 486.7 ± 32.7 b | 542.8 ± 25.6 a | 585.7 ± 24.7 a | 599.0 ± 27.8 a |
| Glycine | 207.3 ± 15.6 | 205.3 ± 11.1 | 211.6 ± 10.4 | 215.9 ± 15.9 |
| Histidine | 97.89 ± 8.82 | 97.60 ± 7.49 | 95.14 ± 9.62 | 96.33 ± 8.13 |
| Isoleucine | 72.09 ± 7.26 | 69.68 ± 14.11 | 65.27 ± 13.26 | 67.51 ± 12.03 |
| Leucine | 176.4 ± 22.0 b | 192.7 ± 19.4 a | 218.9 ± 17.6 a | 209.7 ± 15.8 a |
| Lysine | 229.2 ± 48.4 | 241.1 ± 25.5 | 238.9 ± 36.4 | 235.6 ± 29.1 |
| Methionine | 59.45 ± 2.74 | 62.64 ± 3.89 | 57.45 ± 4.33 | 61.40 ± 5.98 |
| Phenylalanine | 85.28 ± 2.05 | 83.47 ± 5.23 | 84.49 ± 4.77 | 83.55 ± 4.12 |
| Proline | 218.9 ± 9.6 | 232.5 ± 12.3 | 249.1 ± 11.0 | 244.0 ± 9.1 |
| Serine | 483.3 ± 31.4 | 483.2 ± 45.9 | 498.4 ± 35.6 | 477.7 ± 31.6 |
| Taurine | 22.85 ± 1.51 | 25.51 ± 2.19 | 24.35 ± 2.58 | 25.09 ± 3.17 |
| Threonine | 179.1 ± 13.4 b | 205.1 ± 28.4 a | 219.5 ± 19.3 a | 212.5 ± 15.1 a |
| Tryptophan | 42.75 ± 5.19 | 39.44 ± 5.68 | 44.78 ± 2.97 | 41.09 ± 3.64 |
| Tyrosine | 38.54 ± 1.67 | 33.07 ± 2.51 | 36.59 ± 5.03 | 37.65 ± 4.77 |
| Valine | 160.3 ± 9.3 b | 171.3 ± 8.9 a | 179.1 ± 7.5 a | 176.9 ± 9.2 a |
| BCAA | 411.5 ± 38.9 b | 432.9 ± 29.9 b | 462.7 ± 30.5 a | 453.5 ± 27.7 a |
| EAA | 1006 ± 64 b | 1063 ± 63 b | 1105 ± 59 a | 1086 ± 55 a |
| Total AA | 4979 ± 634 | 5068 ± 595 | 5185 ± 659 | 5184 ± 547 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Zhao, L.; Tan, S.; Zhang, W.; Mao, P.; Wu, X. N-Carbamylglutamate Improves Production Performance and Muscle Growth by Regulating Protein Digestive Function and Muscle Protein Synthesis in Broiler Chickens. Animals 2026, 16, 1558. https://doi.org/10.3390/ani16101558
Zhao L, Tan S, Zhang W, Mao P, Wu X. N-Carbamylglutamate Improves Production Performance and Muscle Growth by Regulating Protein Digestive Function and Muscle Protein Synthesis in Broiler Chickens. Animals. 2026; 16(10):1558. https://doi.org/10.3390/ani16101558
Chicago/Turabian StyleZhao, Lingping, Shitu Tan, Wanqiao Zhang, Pei Mao, and Xiaohong Wu. 2026. "N-Carbamylglutamate Improves Production Performance and Muscle Growth by Regulating Protein Digestive Function and Muscle Protein Synthesis in Broiler Chickens" Animals 16, no. 10: 1558. https://doi.org/10.3390/ani16101558
APA StyleZhao, L., Tan, S., Zhang, W., Mao, P., & Wu, X. (2026). N-Carbamylglutamate Improves Production Performance and Muscle Growth by Regulating Protein Digestive Function and Muscle Protein Synthesis in Broiler Chickens. Animals, 16(10), 1558. https://doi.org/10.3390/ani16101558
