Oxazolone-Induced Immune Response in Atopic Dermatitis Using a Goat Model and Exploration of the Therapeutic Potential of Pomegranate Peel Extract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. PPE Preparation
2.3. Animals
2.4. Induction of Model of Goat AD
2.5. Evaluation of Skin Lesions
2.6. Histopathological Examination
2.7. Immunohistochemistry
2.8. Real-Time qRT-PCR
2.9. Statistical Analysis
3. Results
3.1. Clinical Assessment of AD Model in Goat
3.2. Pathological Assessment of AD Model in Goat
3.3. Molecular Assessment of AD Model in Goats
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Byrd, A.L.; Belkaid, Y.; Segre, J.A. The Human Skin Microbiome. Nat. Rev. Microbiol. 2018, 16, 143–155. [Google Scholar] [CrossRef] [PubMed]
- Boyazoglu, J.; Hatziminaoglou, I.; Morand-Fehr, P. The Role of the Goat in Society: Past, Present and Perspectives for the Future. Small Rumin. Res. 2005, 60, 13–23. [Google Scholar] [CrossRef]
- Mandour, A.S.; Samir, H.; Yoshida, T.; Matsuura, K.; Abdelmageed, H.A.; Elbadawy, M.; Al-Rejaie, S.; El-Husseiny, H.M.; Elfadadny, A.; Ma, D.; et al. Assessment of the Cardiac Functions Using Full Conventional Echocardiography with Tissue Doppler Imaging before and after Xylazine Sedation in Male Shiba Goats. Animals 2020, 10, 2320. [Google Scholar] [CrossRef] [PubMed]
- Weidinger, S.; Beck, L.A.; Bieber, T.; Kabashima, K.; Irvine, A.D. Atopic Dermatitis. Nat. Rev. Dis. Prim. 2018, 4, 1. [Google Scholar] [CrossRef]
- Orciani, M.; Campanati, A.; Caffarini, M.; Ganzetti, G.; Consales, V.; Lucarini, G.; Offidani, A.; Di Primio, R. T Helper (Th)1, Th17 and Th2 Imbalance in Mesenchymal Stem Cells of Adult Patients with Atopic Dermatitis: At the Origin of the Problem. Br. J. Dermatol. 2017, 176, 1569–1576. [Google Scholar] [CrossRef]
- Kaiko, G.E.; Horvat, J.C.; Beagley, K.W.; Hansbro, P.M. Immunological Decision-Making: How Does the Immune System Decide to Mount a Helper T-Cell Response? Immunology 2008, 123, 326–338. [Google Scholar] [CrossRef]
- Sugaya, M. The Role of Th17-Related Cytokines in Atopic Dermatitis. Int. J. Mol. Sci. 2020, 21, 1314. [Google Scholar] [CrossRef]
- Yuan, Z.; Fang, Y.; Zhang, T.; Fei, Z.; Han, F.; Liu, C.; Liu, M.; Xiao, W.; Zhang, W.; Wu, S.; et al. The Pomegranate (Punica granatum L.) Genome Provides Insights into Fruit Quality and Ovule Developmental Biology. Plant Biotechnol. J. 2018, 16, 1363–1374. [Google Scholar] [CrossRef]
- Dhumal, S.S.; Karale, A.R.; Jadhav, S.B.; Kad, V.P. Recent Advances and the Developments in the Pomegranate Processing and Utilization: A Review. J. Agric. Crop Sci. 2014, 1, 1–17. [Google Scholar]
- Colombo, E.; Sangiovanni, E.; Dell’Agli, M. A Review on the Anti-Inflammatory Activity of Pomegranate in the Gastrointestinal Tract. Evid.-Based Complement. Altern. Med. 2013, 2013, 247145. [Google Scholar] [CrossRef]
- Mastrogiovanni, F.; Mukhopadhya, A.; Lacetera, N.; Ryan, M.T.; Romani, A.; Bernini, R.; Sweeney, T. Anti-Inflammatory Effects of Pomegranate Peel Extracts on in Vitro Human Intestinal Caco-2 Cells and Ex Vivo Porcine Colonic Tissue Explants. Nutrients 2019, 11, 548. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Chen, T.; Sun, S.; Wang, R.; Deng, J.; Lyu, L.; Wu, H.; Yang, M.; Pu, X.; Du, L.; et al. Nonbone Marrow CD34+ Cells Are Crucial for Endothelial Repair of Injured Artery. Circ. Res. 2021, 129, e146–e165. [Google Scholar] [CrossRef] [PubMed]
- Revenfeld, A.L.S.; Bæk, R.; Jørgensen, M.M.; Varming, K.; Stensballe, A. Induction of a Regulatory Phenotype in CD3+ CD4+ HLA-DR+ T Cells after Allogeneic Mixed Lymphocyte Culture; Indications of Both Contact-Dependent and -Independent Activation. Int. J. Mol. Sci. 2017, 18, 1603. [Google Scholar] [CrossRef] [PubMed]
- Mwangi, W.E.; Mogoa, E.M.; Mwangi, J.N.; Mbuthia, P.G.; Mbugua, S.W. Wound Healing after Ovariohysterectomy in Dogs. Int. J. Vet. Sci. 2019, 8, 300–307. [Google Scholar]
- Marsella, R.; Saridomichelakis, M.N. Environmental and Oral Challenge with Storage Mites in Beagles Experimentally Sensitized to Dermatophagoides farinae. Vet. Dermatol. 2010, 21, 106–112. [Google Scholar] [CrossRef]
- Olivry, T.; Marsella, R.; Iwasaki, T.; Mueller, R.; Bensignor, E.; Carlotti, D.; DeBoer, D.J.; Griffin, C.; Halliwell, R.; Hammerberg, B.; et al. Validation of CADESI-03, a Severity Scale for Clinical Trials Enrolling Dogs with Atopic Dermatitis. Vet. Dermatol. 2007, 18, 78–86. [Google Scholar] [CrossRef]
- Roest, H.I.J.; Post, J.; van Gelderen, B.; van Zijderveld, F.G.; Rebel, J.M.J. Q Fever in Pregnant Goats: Humoral and Cellular Immune Responses. Vet. Res. 2013, 44, 67. [Google Scholar] [CrossRef]
- Puech, C.; Dedieu, L.; Chantal, I.; Rodrigues, V. Design and Evaluation of a Unique SYBR Green Real-Time RT-PCR Assay for Quantification of Five Major Cytokines in Cattle, Sheep and Goats. BMC Vet. Res. 2015, 11, 65. [Google Scholar] [CrossRef]
- Tamagawa-Mineoka, R.; Katoh, N. Atopic Dermatitis: Identification and Management of Complicating Factors. Int. J. Mol. Sci. 2020, 21, 2671. [Google Scholar] [CrossRef]
- Heller, F.; Fuss, I.J.; Nieuwenhuis, E.E.; Blumberg, R.S.; Strober, W. Oxazolone Colitis, a Th2 Colitis Model Resembling Ulcerative Colitis, Is Mediated by IL-13-Producing NK-T Cells. Immunity 2002, 17, 629–638. [Google Scholar] [CrossRef]
- Man, M.Q.; Hatano, Y.; Lee, S.H.; Man, M.; Chang, S.; Feingold, K.R.; Leung, D.Y.M.; Holleran, W.; Uchida, Y.; Elias, P.M. Characterization of a Hapten-Induced, Murine Model with Multiple Features of Atopic Dermatitis: Structural, Immunologic, and Biochemical Changes Following Single versus Multiple Oxazolone Challenges. J. Investig. Dermatol. 2008, 128, 79–86. [Google Scholar] [CrossRef] [PubMed]
- Sidney, L.E.; Branch, M.J.; Dunphy, S.E.; Dua, H.S.; Hopkinson, A. Concise Review: Evidence for CD34 as a Common Marker for Diverse Progenitors. Stem Cells 2014, 32, 1380–1389. [Google Scholar] [CrossRef] [PubMed]
- Tumbar, T.; Guasch, G.; Greco, V.; Blanpain, C.; Lowry, W.E.; Rendl, M.; Fuchs, E. Defining the Epithelial Stem Cell Niche in Skin. Science 2004, 303, 359–363. [Google Scholar] [CrossRef] [PubMed]
- Mushtaq, S.; Abbasi, B.H.; Uzair, B.; Abbasi, R. Natural Products as Reservoirs of Novel Therapeutic Agents. EXCLI J. 2018, 17, 420–451. [Google Scholar] [CrossRef]
- Elfadadny, A.; Ragab, R.F.; Hamada, R.; Al Jaouni, S.K.; Fu, J.; Mousa, S.A.; El-Far, A.H. Natural Bioactive Compounds-Doxorubicin Combinations Targeting Topoisomerase II-Alpha: Anticancer Efficacy and Safety. Toxicol. Appl. Pharmacol. 2023, 461, 116405. [Google Scholar] [CrossRef]
- Singh, J.; Kaur, H.P.; Verma, A.; Chahal, A.S.; Jajoria, K.; Rasane, P.; Kaur, S.; Kaur, J.; Gunjal, M.; Ercisli, S.; et al. Pomegranate Peel Phytochemistry, Pharmacological Properties, Methods of Extraction, and Its Application: A Comprehensive Review. ACS Omega 2023, 8, 35452–35469. [Google Scholar] [CrossRef]
- Kusmardi, K.; Hermanto, D.; Estuningytas, A.; Tedjo, A.; Priosoeryanto, B.P. The Potency of Indonesia’s Pomegranate Peel Ethanol Extract (Punica granatum Linn.) as Anti-Inflammatory Agent in Mice Colon Induced by Dextran Sodium Sulfate: Focus on Cyclooxygenase-2 and Inos Expressions. Asian J. Pharm. Clin. Res. 2017, 10, 370–375. [Google Scholar] [CrossRef]
Antibody | Host and Type | Dilution | Source |
---|---|---|---|
anti-CD3 | Primary, Rabbit monoclonal | 1:150 | Abcam, Cambridge, UK #clone SP7 ab16669 |
anti-CD4 | Primary, Rabbit monoclonal | 1:1000 | Abcam EPR19514 |
anti-CD34 | Primary, Rabbit polyclonal | 1:200 | Abcam EP373Y |
IgG | Secondary, goat, HRP-conjugated | 1:200 | Abcam ab6721 |
Primer | Forward | Reverse | Reference |
---|---|---|---|
IL-17A | TTCTCTTTCCCAGGGCTACC | TCAACAAGATAATTGCTAATCTGACT | This study |
TNF-α | CCTTGAGAAGATCTCACCTA | CAAACATAAACAGAGGGAGT | [17] |
IL-1β | TACCTGTCTTGTGTGAAAAA | CAAATTCAACTGTGTTCTTG | [17] |
IFN-α | GAGGAAATACTTCCACAGA | ATGACTTCTGCTCTGACAAC | [17] |
IL-13 | GTGTGGAGCCTCAACCTGAC | ACAGATGTGGGACTGAATGC | This study |
IL-4 | CAGCATGGAGCTGCCT | ACAGAACAGGTCTTGCTTGC | [18] |
GAPDH | ATCTCGCTCCTGGAAGATG | TCGGAGTGAACGGATTCG | [18] |
β-actin | TGGGCATGGAATCCTG | GGCGCGATGATCTTGAT | [18] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elfadadny, A.; Samir, H.; Mandour, A.S.; Ragab, R.F.; Elshafey, B.G.; Alanazi, F.E.; Hetta, H.F.; Alharbi, A.A.; Albalawi, A.S.; Aljameel, S.S.; et al. Oxazolone-Induced Immune Response in Atopic Dermatitis Using a Goat Model and Exploration of the Therapeutic Potential of Pomegranate Peel Extract. Animals 2025, 15, 411. https://doi.org/10.3390/ani15030411
Elfadadny A, Samir H, Mandour AS, Ragab RF, Elshafey BG, Alanazi FE, Hetta HF, Alharbi AA, Albalawi AS, Aljameel SS, et al. Oxazolone-Induced Immune Response in Atopic Dermatitis Using a Goat Model and Exploration of the Therapeutic Potential of Pomegranate Peel Extract. Animals. 2025; 15(3):411. https://doi.org/10.3390/ani15030411
Chicago/Turabian StyleElfadadny, Ahmed, Haney Samir, Ahmed S. Mandour, Rokaia F. Ragab, Besheer G. Elshafey, Fawaz E. Alanazi, Helal F. Hetta, Ahmad A. Alharbi, Abdullah S. Albalawi, Suhailah S. Aljameel, and et al. 2025. "Oxazolone-Induced Immune Response in Atopic Dermatitis Using a Goat Model and Exploration of the Therapeutic Potential of Pomegranate Peel Extract" Animals 15, no. 3: 411. https://doi.org/10.3390/ani15030411
APA StyleElfadadny, A., Samir, H., Mandour, A. S., Ragab, R. F., Elshafey, B. G., Alanazi, F. E., Hetta, H. F., Alharbi, A. A., Albalawi, A. S., Aljameel, S. S., Alwaili, M. A., Nageeb, W. M., & Emam, M. H. (2025). Oxazolone-Induced Immune Response in Atopic Dermatitis Using a Goat Model and Exploration of the Therapeutic Potential of Pomegranate Peel Extract. Animals, 15(3), 411. https://doi.org/10.3390/ani15030411