Tissue-Specific Gene Expression of Digestive Tract Glands in Paroctopus digueti: Insights for Cephalopod Biology and Aquaculture
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Considerations
2.2. Capture and Maintenance
2.3. Sampling
2.4. RNA Extraction, Library Preparation, and Sequencing
2.5. Bioinformatic Analysis
2.5.1. Transcriptome Assembly
2.5.2. Transcriptome Annotation
2.5.3. Differential Gene Expression Between Glands
2.5.4. Functional Enrichment Analysis
2.6. Validation of Differential Expression via RT-qPCR
3. Results
3.1. Transcriptome Assembly and Annotation
3.2. Functional Enrichment and DEG’s
3.3. Validation of Differential Gene Expression
4. Discussion
4.1. Anterior Salivary Glands
4.2. Posterior Salivary Glands
4.3. Digestive Gland
4.4. Functional Complementarity Among the Digestive Tract Glands
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ASG | Anterior salivary glands |
| PSG | Posterior salivary glands |
| DG | Digestive gland |
| CAP | Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related proteins |
| AMPs | Antimicrobial peptides |
| CICIMAR-IPN | Centro Interdisciplinario de Ciencias Marinas del Instituto Politécnico Nacional |
| UV | Ultraviolet |
| PVC | Polyvinyl chloride |
| DEPC | Diethyl pyrocarbonate |
| RNA | Ribonucleic acid |
| CA | California |
| USA | United States of America |
| BLAST | Basic Local Alignment Search Tool |
| DE | Differential expression |
| FDR | False discovery rate |
| DEGs | Differentially expressed genes |
| GO | Gene ontology |
| TMM | Trimmed Mean of M-values |
| RT-qPCR | Real-time quantitative PCR |
| cDNA | Complementary Deoxyribonucleic acid |
| MIQE | Minimum Information for Quantification Experiments in Real Time |
| DNA | Deoxyribonucleic acid |
| ANOVA | Analysis of Variance |
| HSD | Honest Significant Difference |
| NCBI | National Center for Biotechnology Information |
| SRA | Sequence Read Archive |
| TSA | Transcriptome Shotgun Assembly |
| BP | Biological process |
| CRF | Corticotropin-releasing factor |
| BMP | Bone morphogenetic protein |
Appendix A
| Contig ID | UniProt ID | Protein Name | GenBankIdentity % | E-Value |
|---|---|---|---|---|
| ASG-TRINITY_DN5661_c0_g1_i16 | Q92035 | Acetylcholinesterase (BfAChE) (EC 3.1.1.7) | 92.87 | 0 |
| ASG-TRINITY_DN3310_c3_g1_i8 | W4VS99 | Neprilysin-1 (EC 3.4.24.11) | 90.76 | 0 |
| ASG-TRINITY_DN2975_c0_g1_i1 | Q75WF2 | Plancitoxin-1 (EC 3.1.22.1) | 85.02 | 0 |
| ASG-TRINITY_DN9286_c1_g1_i11 | B2D0J4 | Venom dipeptidyl peptidase 4 (EC 3.4.14.5) | 99.00 | 0 |
| PSG-TRINITY_DN8583_c3_g1_i1 | Q92035 | Acetylcholinesterase (BfAChE) (EC 3.1.1.7) | 92.31 | 0 |
| PSG-TRINITY_DN15665_c0_g1_i1 | Q8MMH3 | Damage-control phosphatase ARMT1 (EC 3.1.3.-) (Venom protein 2) | 78.16 | 0 |
| PSG-TRINITY_DN12902_c0_g1_i1 | A7ISW2 | Glutaminyl-peptide cyclotransferase (EC 2.3.2.5) | 100.0 | 0 |
| PSG-TRINITY_DN303_c2_g1_i1 | C0HKM3 | Hyaluronidase conohyal-P1 (EC 3.2.1.35) (Hyaluronoglucosaminidase) | 88.22 | 1 × 10−104 |
| PSG-TRINITY_DN21310_c0_g1_i2 | P0DPU3 | Scoloptoxin SSD14 (SLPTX-SSD14) (Toxin-SSD14) | 85.14 | 0 |
| PSG-TRINITY_DN367_c0_g1_i6 | Q8I6S2 | Tachykinin-2 (OctTK-II) (Tachykinin II) | 44.44 | 2 × 10−13 |
| PSG-TRINITY_DN7162_c10_g1_i1 | B2D0J4 | Venom dipeptidyl peptidase 4 (EC 3.4.14.5) | 89.68 | 0 |
| PSG-TRINITY_DN135_c1_g1_i7 | W8E7D1 | Venom phosphodiesterase (EC 3.6.1.-) | 85.41 | 0 |
| DG-TRINITY_DN94241_c0_g1_i1 | A3QVP0 | Hyaluronidase-1 | 86.49 | 0 |
| DG-TRINITY_DN213_c14_g1_i1 | W4VS99 | Neprilysin-1 (EC 3.4.24.11) | 78.69 | 5 × 10−168 |
| DG-TRINITY_DN128_c0_g1_i10 | Q75WF2 | Plancitoxin-1 (EC 3.1.22.1) | 85.02 | 0 |
| DG-TRINITY_DN37926_c0_g1_i1 | A0A2I4HXH5 | Snake venom 5′-nucleotidase (EC 3.1.3.5) (Ecto-5′-nucleotidase) | 84.00 | 0 |
| DG-TRINITY_DN1667_c0_g1_i4 | W8E7D1 | Venom phosphodiesterase (EC 3.6.1.-) | 86.78 | 0 |
| DG-TRINITY_DN1667_c0_g1_i7 | J3SBP3 | Venom phosphodiesterase 2 (EC 3.6.1.-) | 86.78 | 0 |
| Contig ID | Align. Length | Name in Almeida et al., 2020 [22] | Name in GenBank | Identify % | E-Value |
|---|---|---|---|---|---|
| ASG-TRINITY_DN20858_c0_g1_i2 | 83 | Overall_14980|DAMPD_268|11|DAMPD|DAMPD_13|ACBP_PIG | Acyl-CoA-binding protein | 86.72 | 3 × 10−116 |
| ASG-TRINITY_DN6172_c0_g1_i3 | 372 | Overall_30231|UniProtKb_480|Q9WTV1_Q5BJR6|CH3L1_RAT | Chitinase-3-like protein 1 | 81.82 | 2 × 10−67 |
| ASG-TRINITY_DN480_c1_g2_i1 | 97 | Overall_11222|CAMP_Validated_1683|CAMPSQ4123|Histone | Histone H2A | 89.71 | 0 |
| ASG-TRINITY_DN18196_c0_g1_i3 | 102 | Overall_15249|DAMPD_537|11|DAMPD|DAMPD_372|H2A_LITVA | Histone H2A | 94.79 | 7 × 10−166 |
| ASG-TRINITY_DN3219_c0_g1_i1 | 97 | Overall_15444|DAMPD_732|11|DAMPD|DAMPD_548|H2B_LITVA | Histone H2B | 92.08 | 0 |
| ASG-TRINITY_DN8763_c0_g1_i1 | 82 | Overall_15447|DAMPD_735|11|DAMPD|DAMPD_550|H4_LITVA | Histone H4 | 96.47 | 2 × 10−141 |
| ASG-TRINITY_DN203799_c0_g1_i1 | 88 | Overall_15300|DAMPD_588|11|DAMPD|DAMPD_418|LYS2_CRAVI | Lysozyme 2 | 98.10 | 1 × 10−124 |
| ASG-TRINITY_DN24348_c5_g2_i1 | 113 | Overall_11234|CAMP_Validated_1695|CAMPSQ4136|Lysozyme | Lysozyme-3-like | 86.28 | 6 × 10−132 |
| ASG-TRINITY_DN13922_c0_g1_i1 | 76 | Overall_21373|DBAASP_5429|5781|cgUbiquitin | Ubiquitin-40S ribosomal protein S27a | 99.59 | 1×10-121 |
| ASG-TRINITY_DN246_c0_g2_i1 | 73 | Overall_3029|APD_1148|AP02030|cgUbiquitin | Ubiquitin-40S ribosomal protein S27a | 85.41 | 7 × 10−131 |
| PSG-TRINITY_DN6816_c0_g1_i1 | 384 | Overall_30231|UniProtKb_480|Q9WTV1_Q5BJR6|CH3L1_RAT | Chitinase-3-like protein 1 | 86.01 | 0 |
| PSG-TRINITY_DN12886_c0_g1_i17 | 120 | Overall_15640|DAMPD_928|11|DAMPD|DAMPD_724|H2A_ONCMY | Core histone macro-H2A.1 | 91.93 | 0 |
| PSG-TRINITY_DN1606_c0_g1_i1 | 97 | Overall_15444|DAMPD_732|11|DAMPD|DAMPD_548|H2B_LITVA | Histone H2B | 89.22 | 0 |
| PSG-TRINITY_DN60123_c0_g1_i2 | 108 | Overall_11234|CAMP_Validated_1695|CAMPSQ4136|Lysozyme | Lysozyme 3-like | 87.98 | 4 × 10−124 |
| PSG-TRINITY_DN211390_c0_g1_i1 | 159 | Overall_9012|CAMP_Structure_155|CAMPST238|Crystal | Peptidoglycan-recognition protein SC2-like | 66.46 | 2 × 10−79 |
| PSG-TRINITY_DN3094_c0_g1_i1 | 614 | Overall_32035|UniProtKb_2284|P80025| PERL_BOVIN | Peroxidase-like protein | 90.99 | 0 |
| PSG-TRINITY_DN10374_c0_g1_i2 | 76 | Overall_21373|DBAASP_5429|5781| cgUbiquitin | Polyubiquitin-C | 99.10 | 0 |
| PSG-TRINITY_DN7229_c0_g1_i1 | 66 | Overall_32216|UniProtKb_2465|A4QNF3|ROMO1_XENTR | Reactive oxygen species modulator 1 | 87.88 | 3 × 10−30 |
| DG-TRINITY_DN860_c0_g1_i12 | 83 | Overall_14980|DAMPD_268|11|DAMPD|DAMPD_13|ACBP_PIG | Acyl-CoA-binding protein | 88.49 | 6 × 10−86 |
| DG-TRINITY_DN4732_c0_g1_i13 | 367 | Overall_30229|UniProtKb_478|Q29411_Q5UC99|CH3L1_PIG | Chitotriosidase-1 | 84.19 | 6 × 10−176 |
| DG-TRINITY_DN26923_c0_g1_i2 | 120 | Overall_566|AMPer_566|H2A_ONCMY|Histone | Core histone macro-H2A.1 | 89.82 | 0 |
| DG-TRINITY_DN118_c1_g1_i2 | 59 | Overall_3101|APD_1220|AP02096| Ubiquicidin | FAU ubiquitin-like and ribosomal protein S30 | 91.98 | 2 × 10−175 |
| DG-TRINITY_DN2681_c0_g1_i4 | 102 | Overall_15249|DAMPD_537|11|DAMPD|DAMPD_372|H2A_LITVA | Histone H2A | 94.92 | 5 × 10−162 |
| DG-TRINITY_DN924_c0_g1_i4 | 91 | Overall_15444|DAMPD_732|11|DAMPD|DAMPD_548|H2B_LITVA | Histone H2B | 92.37 | 4 × 10−149 |
| DG-TRINITY_DN118938_c0_g1_i1 | 82 | Overall_15447|DAMPD_735|11|DAMPD|DAMPD_550|H4_LITVA | Histone H4 | 90.03 | 8 × 10−108 |
| DG-TRINITY_DN1155_c0_g1_i3 | 113 | Overall_11234|CAMP_Validated_1695|CAMPSQ4136|Lysozyme | Lysozyme | 83.53 | 2 × 10−168 |
| DG-TRINITY_DN1155_c0_g1_i2 | 113 | Overall_31680|UniProtKb_1929|P86383|LYS_MERLU | Lysozyme | 84.24 | 3 × 10−126 |
| DG-TRINITY_DN871_c0_g2_i4 | 109 | Overall_15299|DAMPD_587|11|DAMPD|DAMPD_417|LYS1_CRAVI | Lysozyme 1 | 85.17 | 2 × 10−175 |
| DG-TRINITY_DN4246_c0_g2_i6 | 161 | Overall_32049|UniProtKb_2298|B5T255|PGRP1_BOSIN | Peptidoglycan recognition protein 1 | 87.65 | 0 |
| DG-TRINITY_DN3181_c0_g1_i2 | 463 | Overall_32035|UniProtKb_2284|P80025|PERL_BOVIN | Peroxidase-like protein | 88.13 | 0 |
| DG-TRINITY_DN63140_c0_g1_i2 | 76 | Overall_21373|DBAASP_5429|5781|cgUbiquitin | Polyubiquitin-C | 89.66 | 6 × 10−135 |
| DG-TRINITY_DN6534_c0_g1_i1 | 66 | Overall_32216|UniProtKb_2465|A4QNF3|ROMO1_XENTR | Reactive oxygen species modulator 1 | 87.88 | 1 × 10−30 |
| DG-TRINITY_DN2339_c1_g1_i2 | 165 | Overall_9232|CAMP_Structure_375|CAMPST436|human | RNA exonuclease 4 | 71.43 | 1 × 10−77 |
| DG-TRINITY_DN12780_c2_g3_i5 | 73 | Overall_3029|APD_1148|AP02030|cgUbiquitin | Ubiquitin-40S ribosomal protein S27a | 93.54 | 0 |
References
- De Rusha, R.H.; Forsythe, J.W.; Hanlon, R.T. Laboratory Growth, Reproduction and Life of the Pacific Pygmy Octopus, Octopus digueti. Pac. Sci. 1987, 41, 104–121. [Google Scholar]
- Von Boletzky, S.; Villanueva, R. Cephalopod Biology. In Cephalopod Culture; Iglesias, J., Fuentes, L., Villanueva, R., Eds.; Springer: Dordrecht, The Netherlands, 2014; pp. 3–16. ISBN 978-94-017-8648-5. [Google Scholar]
- Norman, M.D.; Fin, J.K. Species of No Current Interest to Fisheries, or Rare Species for Which Only Few Records Exist to Date. In Cephalopods of the World: An Annotated and Illustrated Catalogue of Cephalopod Species Known to Date; Jereb, P., Roper, C.F.E., Norman, M.D., Finn, J.K., Eds.; Food and Agriculture Organization of the United Nations: Rome, Italy, 2016; Volume 3, pp. 155–161. ISBN 9789251079898. [Google Scholar]
- Sánchez, M.; Gallardo, P.; Domingues, P.; Rosas, C.; Pascual, C.; Ceballos-Vázquez, B.P. Changes in Digestive Enzymes and Nutritional Ontogeny Reserves in Newly Hatched Pacific Pygmy Octopus, Paroctopus digueti. Aquaculture 2023, 576, 739873. [Google Scholar] [CrossRef]
- García-Flores, M.; Ceballos-Vazquez, B.P.; Rosales-Velazquez, M.O. Embryonic Development and Fecundity of the Pacific Pygmy Octopus, Paroctopus digueti. J. Shellfish. Res. 2022, 41, 125–134. [Google Scholar] [CrossRef]
- Hanlon, R.T.; Forsythe, J.W. Advances in the Laboratory Culture of Octopuses for Biomedical Research. Lab. Anim. Sci. 1985, 35, 33–40. [Google Scholar] [PubMed]
- Guerra, A. Sobre La Alimentación y Comportamiento Alimentario de Octopus vulgaris. Inv. Pesq. 1987, 42, 351–364. [Google Scholar]
- Nixon, M. Is There External Digestion by Octopus? J. Zool. Lond. 1984, 202, 441–447. [Google Scholar] [CrossRef]
- Boucaud-Camou, E.; Boucher-Rodoni, R. Feeding and Digestion in Cephalopods. In The Mollusca; Saleuddin, A.S.M., Wilburt, K.M., Eds.; Elsevier: Amsterdam, The Netherlands, 1983; Volume 5, pp. 149–187. ISBN 978-0-12-751405-5. [Google Scholar]
- Ponte, G.; Modica, M.V. Salivary Glands in Predatory Mollusks: Evolutionary Considerations. Front. Physiol. 2017, 8, 580. [Google Scholar] [CrossRef]
- Boucaud-Camou, E. Etude Histologique et Histochimique de l’appareil Digestif de Sepiola atlantica d’Orbigny et Sepia officinalis L. Bull. Soc. Linn. Normandie 1968, 9, 220–243. [Google Scholar]
- Fingerhut, L.C.H.W.; Strugnell, J.M.; Faou, P.; Labiaga, Á.R.; Zhang, J.; Cooke, I.R. Shotgun Proteomics Analysis of Saliva and Salivary Gland Tissue from the Common Octopus Octopus vulgaris. J. Proteome Res. 2018, 17, 3866–3876. [Google Scholar] [CrossRef]
- Fernández-Gago, R.; Molist, P.; Rocha, F. Anatomical and Histochemical Features of the Digestive System of Octopus vulgaris Cuvier, 1797 with a Special Focus on Secretory Cells. Acta Zoolog. 2019, 100, 320–335. [Google Scholar] [CrossRef]
- Stoskopf, M.K.; Oppenheim, B.S. Anatomic Features of Octopus bimaculoides and Octopus digueti. J. Zoo Wildl. Med. 1996, 27, 1–18. [Google Scholar]
- Grisley, M.S.; Boyle, P.R.; Key, L.N. Eye Puncture as a Route of Entry for Saliva during Predation on Crabs by the Octopus Eledone cirrhosa (Lamarck). J. Exp. Mar. Biol. Ecol. 1996, 202, 225–237. [Google Scholar] [CrossRef]
- Grisley, M.S.; Boyle, P.R. Bioassay and Proteolytic Activity of Digestive Enzymes from Octopus Saliva. Comp. Biochem. Physiol. 1987, 88, 1117–1123. [Google Scholar] [CrossRef]
- Pech-Puch, D.; Cruz-López, H.; Canche-Ek, C.; Campos-Espinosa, G.; García, E.; Mascaro, M.; Rosas, C.; Chávez-Velasco, D.; Rodríguez-Morales, S. Chemical Tools of Octopus maya during Crab Predation Are Also Active on Conspecifics. PLoS ONE 2016, 11, e0148922. [Google Scholar] [CrossRef] [PubMed]
- Cooke, I.R.; Whitelaw, B.; Norman, M.; Caruana, N.; Strugnell, J.M. Toxicity in Cephalopods. In Evolution of Venomous Animals and Their Toxins; Gopalakrishnakone, P., Malhotra, A., Eds.; Springer: Dordrecht, The Netherlands, 2017; pp. 125–143. ISBN 2542-761X. [Google Scholar]
- Ruder, T.; Sunagar, K.; Undheim, E.A.B.; Ali, S.A.; Wai, T.C.; Low, D.H.W.; Jackson, T.N.W.; King, G.F.; Antunes, A.; Fry, B.G. Molecular Phylogeny and Evolution of the Proteins Encoded by Coleoid (Cuttlefish, Octopus, and Squid) Posterior Venom Glands. J. Mol. Evol. 2013, 76, 192–204. [Google Scholar] [CrossRef] [PubMed]
- Cariello, L.; Zanetti, L. α- and β-Cephalotoxin: Two Paralysing Proteins from Posterior Salivary Glands of Octopus vulgaris. Comp. Biochem. Physiol. 1977, 57, 169–173. [Google Scholar] [CrossRef]
- Whitelaw, B.L.; Strugnell, J.M.; Faou, P.; Da Fonseca, R.R.; Hall, N.E.; Norman, M.; Finn, J.; Cooke, I.R. Combined Transcriptomic and Proteomic Analysis of the Posterior Salivary Gland from the Southern Blue-Ringed Octopus and the Southern Sand Octopus. J. Proteome Res. 2016, 15, 3284–3297. [Google Scholar] [CrossRef]
- Almeida, D.; Domínguez-Pérez, D.; Matos, A.; Agüero-Chapin, G.; Osório, H.; Vasconcelos, V.; Campos, A.; Antunes, A. Putative Antimicrobial Peptides of the Posterior Salivary Glands from the Cephalopod Octopus vulgaris Revealed by Exploring a Composite Protein Database. Antibiotics 2020, 9, 757. [Google Scholar] [CrossRef]
- Pineda-Suazo, D.; Escobedo-Hinojosa, W.; Fabian-Canseco, L.E.; Gallardo, P.; Moguel-Ojeda, C.; Caamal-Monsreal, C.; Sánchez-Arteaga, A.; Rosas, C. Evaluation of Octopus maya Enzyme Activity of the Digestive Gland and Gastric Juice. Biol. Open 2024, 13, bio060429. [Google Scholar] [CrossRef]
- Pineda-Suazo, D.; Guillén-Chable, F.; Escobedo-Hinojosa, W.I.; Galindo-Sánchez, C.E.; Rosas, C. Insights into Octopus maya Cathepsins from Metatranscriptome and Genome: Structure Evolutionary Relationships and Functional Role Prediction in Digestive Processes. Biol. Open 2025, 14, bio061778. [Google Scholar] [CrossRef]
- Rosas, C.; Sánchez, A.; Pascual, C.; Aguila, J.; Maldonado, T.; Domingues, P. Effects of Two Dietary Protein Levels on Energy Balance and Digestive Capacity of Octopus maya. Aquac. Int. 2011, 19, 165–180. [Google Scholar] [CrossRef]
- Martínez, R.; López-Ripoll, E.; Avila-Poveda, O.H.; Santos-Ricalde, R.; Mascaró, M.; Rosas, C. Cytological Ontogeny of the Digestive Gland in Post-Hatching Octopus maya, and Cytological Background of Digestion in Juveniles. Aquat. Biol. 2011, 11, 249–261. [Google Scholar] [CrossRef]
- Gallardo, P.; Olivares, A.; Martínez-Yáñez, R.; Caamal-Monsreal, C.; Domingues, P.M.; Mascaró, M.; Sánchez, A.; Pascual, C.; Rosas, C. Digestive Physiology of Octopus maya and O. mimus: Temporality of Digestion and Assimilation Processes. Front. Physiol. 2017, 8, 355. [Google Scholar] [CrossRef] [PubMed]
- Moguel, C.; Mascaró, M.; Avila-Poveda, O.H.; Caamal-Monsreal, C.; Sanchez, A.; Pascual, C.; Rosas, C. Morphological, Physiological and Behavioral Changes during Post-Hatching Development of Octopus maya (Mollusca: Cephalopoda) with Special Focus on the Digestive System. Aquat. Biol. 2010, 9, 35–48. [Google Scholar] [CrossRef]
- Bastos, P.; Fracalossi, D.M.; Chimal, M.E.; Sánchez, A.; Rosas, C. Digestive Enzymes and Timing of Digestion in Octopus vulgaris Type II. Aquac. Rep. 2020, 16, 100262. [Google Scholar] [CrossRef]
- Morishita, T. Participation Digestion by the Proteolytic Enzymes of the Posterior Gland in Octopus-IV. Purification and Some Properties of Proteolytic Enzymes from the Digestive Juice. Bull. Jpn. Soc. Sci. Fish. 1974, 40, 927–936. [Google Scholar] [CrossRef][Green Version]
- Aguila, J.; Cuzon, G.; Pascual, C.; Domingues, P.M.; Gaxiola, G.; Sánchez, A.; Maldonado, T.; Rosas, C. The Effects of Fish Hydrolysate (CPSP) Level on Octopus maya (Voss and Solis) Diet: Digestive Enzyme Activity, Blood Metabolites, and Energy Balance. Aquaculture 2007, 273, 641–655. [Google Scholar] [CrossRef]
- Braga, R.; Van der Molen, S.; Rodriguez, Y.E.; Fernández-Giménez, A.V.; Battini, N.; Rosas, C.; Ortiz, N. Morphophysiological Responses of Octopus tehuelchus Juveniles during the Transition Period between Endogenous and Exogenous Feeding. Aquaculture 2022, 556, 738269. [Google Scholar] [CrossRef]
- Linares, M.; Caamal-Monsreal, C.; Olivares, A.; Sánchez, A.; Rodríguez, S.; Zúñiga, O.; Pascual, C.; Gallardo, P.; Rosas, C. Timing of Digestion, Absorption and Assimilation in Octopus Species from Tropical (Octopus maya) and Subtropical-Temperate (O. mimus) Ecosystems. Aquat. Biol. 2015, 24, 127–140. [Google Scholar] [CrossRef]
- Santiago, I.; Rosas, C.; Cruz-López, H.; Domingues, P.; Pascual, C.; Mascaro, M.; Sanchez-Arteaga, A.; Caamal, C.; Gallardo, P. Growth, Survival, Digestive Activity and Respiratory Metabolism of Octopus maya Juveniles Fed with Prepared Diets. J. Anim. Physiol. Anim. Nutr. 2024, 108, 1383–1392. [Google Scholar] [CrossRef]
- Perales-García, N.; Tovar-Ramírez, D.; Martínez-Morales, M.G.; Ceballos-Vázquez, B.P.; Corona-Rojas, D.A.; Salcedo-Meza, M.A.; Garrido-Mora, A.; Vega-Villasante, F.; Nolasco-Soria, H. PH Evaluation in the Digestive Tract of the Pygmy Octopus, Paractopus digueti. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2024, 269, 110881. [Google Scholar] [CrossRef]
- Gonçalves, C.; Moutinho Cabral, I.; Alves de Matos, A.P.; Grosso, A.R.; Costa, P.M. Transcriptome Profiling of the Posterior Salivary Glands of the Cuttlefish Sepia officinalis from the Portuguese West Coast. Front. Mar. Sci. 2024, 11, 1362824. [Google Scholar] [CrossRef]
- Zheng, J.; Li, C.; Zheng, X. Polystyrene Microplastic Ingestion Induces the Damage in Digestive Gland of Amphioctopus fangsiao at the Physiological, Inflammatory, Metabolome and Transcriptomic Levels. Environ. Pollut. 2022, 315, 120480. [Google Scholar] [CrossRef]
- Fry, B.G.; Roelants, K.; Norman, J.A. Tentacles of Venom: Toxic Protein Convergence in the Kingdom Animalia. J. Mol. Evol. 2009, 68, 311–321. [Google Scholar] [CrossRef]
- NOM-062-ZOO-1999; NORMA Oficial Mexicana—Especificaciones Técnicas para la Producción, Cuidado y Uso de los Animales de Laboratorio. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación: Ciudad de México, Mexico, 2001.
- Fiorito, G.; Affuso, A.; Basil, J.; Cole, A.; de Girolamo, P.; D’angelo, L.; Dickel, L.; Gestal, C.; Grasso, F.; Kuba, M.; et al. Guidelines for the Care and Welfare of Cephalopods in Research—A Consensus Based on an Initiative by CephRes, FELASA and the Boyd Group. Lab. Anim. 2015, 49, 1–90. [Google Scholar] [CrossRef] [PubMed]
- Andrews, P.L.R.; Tansey, E.M. A Technique for Central Drug Administration in Octopus vulgaris. J. Neurosci. Methods 1981, 4, 243–247. [Google Scholar] [CrossRef] [PubMed]
- Prado-Álvarez, M.; Dios, S.; García-Fernández, P.; Tur, R.; Hachero-Cruzado, I.; Domingues, P.; Almansa, E.; Varó, I.; Gestal, C. De Novo Transcriptome Reconstruction in Aquacultured Early Life Stages of the Cephalopod Octopus vulgaris. Sci. Data 2022, 9, 609. [Google Scholar] [CrossRef] [PubMed]
- Moltschaniwskyj, N.A.; Hall, K.; Lipinski, M.R.; RMarian, E.A.; Nishiguchi, M.; Sakai, M.; Shulman, D.J.; Sinclair, B.; Sinn, D.L.; Staudinger, M.; et al. Ethical and Welfare Considerations When Using Cephalopods as Experimental Animals. Rev. Fish. Biol. Fish. 2007, 17, 455–476. [Google Scholar] [CrossRef]
- Fang, Z.; Cui, X. Design and Validation Issues in RNA-Seq Experiments. Brief. Bioinform. 2011, 12, 280–287. [Google Scholar] [CrossRef]
- Vidal, E.A.G.; Shea, E.K. Cephalopod Ontogeny and Life Cycle Patterns. Front. Mar. Sci. 2023, 10, 1162735. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 27 August 2024).
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-Length Transcriptome Assembly from RNA-Seq Data without a Reference Genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
- Smith-Unna, R.; Boursnell, C.; Patro, R.; Hibberd, J.M.; Kelly, S. TransRate: Reference-Free Quality Assessment of de Novo Transcriptome Assemblies. Genome Res. 2016, 26, 1134–1144. [Google Scholar] [CrossRef] [PubMed]
- Fu, L.; Niu, B.; Zhu, Z.; Wu, S.; Li, W. CD-HIT: Accelerated for Clustering the next-Generation Sequencing Data. Bioinformatics 2012, 28, 3150–3152. [Google Scholar] [CrossRef] [PubMed]
- Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De Novo Transcript Sequence Reconstruction from RNA-Seq: Reference Generation and Analysis with Trinity. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef] [PubMed]
- Almeida, D.; Domínguez-Pérez, D.; Matos, A.; Agüero-Chapin, G.; Castaño, Y.; Vasconcelos, V.; Campos, A.; Antunes, A. Data Employed in the Construction of a Composite Protein Database for Proteogenomic Analyses of Cephalopods Salivary Apparatus. Data 2020, 5, 110. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- Simão, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing Genome Assembly and Annotation Completeness with Single-Copy Orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef]
- Dai, H.; Guan, Y. The Nubeam Reference-Free Approach to Analyze Metagenomic Sequencing Reads. Genome Res. 2020, 30, 1364–1375. [Google Scholar] [CrossRef]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon Provides Fast and Bias-Aware Quantification of Transcript Expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene Ontology Analysis for RNA-Seq: Accounting for Selection Bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [PubMed]
- Kolde, R. Pheatmap: Pretty Heatmaps. CRAN: Contributed Packages. 2010. Available online: https://doi.org/10.32614/CRAN.package.pheatmap (accessed on 9 September 2025).
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor Package for Differential Expression Analysis of Digital Gene Expression Data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Imperadore, P.; Cagnin, S.; Allegretti, V.; Millino, C.; Raffini, F.; Fiorito, G.; Ponte, G. Transcriptome-Wide Selection and Validation of a Solid Set of Reference Genes for Gene Expression Studies in the Cephalopod Mollusk Octopus vulgaris. Front. Mol. Neurosci. 2023, 16, 1091305. [Google Scholar] [CrossRef] [PubMed]
- Sirakov, M.; Zarrella, I.; Borra, M.; Rizzo, F.; Biffali, E.; Arnone, M.I.; Fiorito, G. Selection and Validation of a Set of Reliable Reference Genes for Quantitative RT-PCR Studies in the Brain of the Cephalopod Mollusc Octopus vulgaris. BMC Mol. Biol. 2009, 10, 70. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Bustin, S.A.; Ruijter, J.M.; van den Hoff, M.J.B.; Kubista, M.; Pfaffl, M.W.; Shipley, G.L.; Tran, N.; Rödiger, S.; Untergasser, A.; Mueller, R.; et al. MIQE 2.0: Revision of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments Guidelines. Clin. Chem. 2025, 71, 634–651. [Google Scholar] [CrossRef]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. MiRDeepFinder: A MiRNA Analysis Tool for Deep Sequencing of Plant Small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of Housekeeping Genes for Gene Expression Studies in Human Reticulocytes Using Real-Time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Zar, J.H. Biostatistical Analysis, 4th ed.; Deirdre, L., Ed.; Pearson: Hoboken, NJ, USA, 2010; ISBN 978-0-13-100846-5. [Google Scholar]
- Dunn, O.J. Multiple Comparisons Using Rank Sums. Technometrics 1964, 6, 241–252. [Google Scholar] [CrossRef]
- Posit Team. RStudio: Integrated Development Environment for R [Software]; Posit Software, P.B.C.: Boston, MA, USA, 2024; Available online: https://posit.co/ (accessed on 9 September 2025).
- Lee, C.C.; Hsieh, H.J.; Hsieh, C.H.; Hwang, D.F. Plancitoxin I from the Venom of Crown-of-Thorns Starfish (Acanthaster planci) Induces Oxidative and Endoplasmic Reticulum Stress Associated Cytotoxicity in A375.S2 Cells. Exp. Mol. Pathol. 2015, 99, 7–15. [Google Scholar] [CrossRef]
- Destanović, D.; Schultz, D.T.; Styfhals, R.; Cruz, F.; Gómez-Garrido, J.; Gut, M.; Gut, I.; Fiorito, G.; Simakov, O.; Alioto, T.S.; et al. A Chromosome-Level Reference Genome for the Common Octopus, Octopus vulgaris (Cuvier, 1797). G3 Genes Genomes Genet. 2023, 13, jkad220. [Google Scholar] [CrossRef]
- Krishnan, N.; Sukumaran, S.; Vysakh, V.G.; Sebastian, W.; Jose, A.; Raj, N.; Gopalakrishnan, A. De Novo Transcriptome Analysis of the Indian Squid Uroteuthis duvaucelii (Orbigny, 1848) from the Indian Ocean. Sci. Data 2024, 11, 1236. [Google Scholar] [CrossRef]
- Andrews, P.L.R.; Tansey, E.M. The Digestive Tract of Octopus vulgaris: The Anatomy, Physiology and Pharmacology of the Upper Tract. J. Mar. Biol. Assoc. United Kingd. 1983, 63, 109–134. [Google Scholar] [CrossRef]
- Wood, J.D. Electrophysiological and Pharmacological Properties of the Stomach of the Squid Loligo pealii (Lesueur). Biochem. Physiol. 1969, 30, 813–824. [Google Scholar] [CrossRef]
- Bellono, N.W.; Bayrer, J.R.; Leitch, D.B.; Castro, J.; Zhang, C.; O’Donnell, T.A.; Brierley, S.M.; Ingraham, H.A.; Julius, D. Enterochromaffin Cells Are Gut Chemosensors That Couple to Sensory Neural Pathways. Cell 2017, 170, 185–198.e16. [Google Scholar] [CrossRef]
- Suzuki, H.; Muraoka, T.; Yamamoto, T. Localization of Corticotropin-Releasing Factor-Immunoreactive Nervous Tissue and Colocalization with Neuropeptide Y-like Substance in the Optic Lobe and Peduncle Complex of the Octopus (Octopus vulgaris). Cell Tissue Res. 2003, 313, 129–138. [Google Scholar] [CrossRef]
- Appleyard, S.M. Appetite Regulation, Neuronal Control. In Encyclopedia of Hormones; Henry, H.L., Norman, A.W., Eds.; Academic Press: San Diego, CA, USA, 2003; pp. 171–179. ISBN 978-0-12-341103-7. [Google Scholar]
- Suzuki, H.; Yamamoto, T.; Nakagawa, M.; Uemura, H. Neuropeptide Y-Immunoreactive Neuronal System and Colocalization with FMRFamide in the Optic Lobe and Peduncle Complex of the Octopus (Octopus vulgaris). Cell Tissue Res. 2002, 307, 255–264. [Google Scholar] [CrossRef] [PubMed]
- Baldascino, E.; Di Cristina, G.; Tedesco, P.; Hobbs, C.; Shaw, T.J.; Ponte, G.; Andrews, P.L.R. The Gastric Ganglion of Octopus vulgaris: Preliminary Characterization of Gene- and Putative Neurochemical-Complexity, and the Effect of Aggregata octopiana Digestive Tract Infection on Gene Expression. Front. Physiol. 2017, 8, 1001. [Google Scholar] [CrossRef] [PubMed]
- Di Cristo, C.; Delli Bovi, P.; Di Cosmo, A. Role of FMRFamide in the Reproduction of Octopus vulgaris: Molecular Analysis and Effect on Visual Input. Peptides 2003, 24, 1525–1532. [Google Scholar] [CrossRef] [PubMed]
- Bechtold, D.A.; Luckman, S.M. The Role of RFamide Peptides in Feeding. J. Endocrinol. 2007, 192, 3–15. [Google Scholar] [CrossRef]
- Zhang, Z.; Tublitz, N.J. Expression of the SOFaRP2 Gene in the Central Nervous System of the Adult Cuttlefish Sepia officinalis. Neuropeptides 2013, 47, 149–155. [Google Scholar] [CrossRef]
- Zatylny-Gaudin, C.; Favrel, P. Diversity of the RFamide Peptide Family in Mollusks. Front. Endocrinol. 2014, 5, 178. [Google Scholar] [CrossRef]
- Le Gall, S.; F6ral, C.; Van Minnen, J.; Marchand, C.R. Evidence for Peptidergic Innervation of the Endocrine Optic Gland in Sepia by Neurons Showing FMRFamide-like Immunoreactivity. Brain Res. 1988, 462, 83–88. [Google Scholar] [CrossRef]
- Di Cosmo, A.; Di Cristo, C. Neuropeptidergic Control of the Optic Gland of Octopus vulgaris: FMRF-Amide and GnRH Immunoreactivity. J. Comp. Neurol. 1998, 398, 1–12. [Google Scholar] [CrossRef]
- Wang, Z.Y.; Ragsdale, C.W. Multiple Optic Gland Signaling Pathways Implicated in Octopus Maternal Behaviors and Death. J. Exp. Biol. 2018, 221, jeb185751. [Google Scholar] [CrossRef]
- Juárez, O.E.; Arreola-Meraz, L.; Sánchez-Castrejón, E.; Avila-Poveda, O.H.; López-Galindo, L.L.; Rosas, C.; Galindo-Sánchez, C.E. Oviducal Gland Transcriptomics of Octopus maya through Physiological Stages and the Negative Effects of Temperature on Fertilization. PeerJ 2022, 10, e12895. [Google Scholar] [CrossRef]
- Dominguez-Estrada, A.; Galindo-Sanchez, C.E.; Ventura-Lopez, C.; Rosas, C.; Juarez, O.E. Response of Optic Gland Pathways to Thermal Stress in the Reproductive Phase of Female Octopus maya. J. Molluscan Stud. 2022, 88, eyac018. [Google Scholar] [CrossRef]
- Le, T.N.M.; Reza, M.A.; Swarup, S.; Kini, R.M. Gene Duplication of Coagulation Factor V and Origin of Venom Prothrombin Activator in Pseudonaja textilis Snake. Thromb. Haemost. 2005, 93, 420–429. [Google Scholar] [CrossRef] [PubMed]
- Macrander, J.; Brugler, M.R.; Daly, M. A RNA-Seq Approach to Identify Putative Toxins from Acrorhagi in Aggressive and Non-Aggressive Anthopleura elegantissima Polyps. BMC Genom. 2015, 16, 221. [Google Scholar] [CrossRef] [PubMed]
- Ota, E.; Nagashima, Y.; Shiomi, K.; Sakurai, T.; Kojima, C.; Waalkes, M.P.; Himeno, S. Caspase-Independent Apoptosis Induced in Rat Liver Cells by Plancitoxin I, the Major Lethal Factor from the Crown-of-Thorns Starfish Acanthaster planci Venom. Toxicon 2006, 48, 1002–1010. [Google Scholar] [CrossRef] [PubMed]
- Mancuso, M.; Giordano, D.; Maria Genovese, L.; Denaro, M.G. Study of Digestive Enzymes in Wild Specimens of Sepia officinalis (Linnaeus, 1758) and Octopus vulgaris (Cuvier, 1797). Cah. Biol. Mar. 2014, 55, 445–452. [Google Scholar]
- Pereda, S.V.; Uriarte, I.; Cabrera, J.C. Effect of Diet and Paralarval Development on Digestive Enzyme Activity in the Cephalopod Robsonella fontaniana. Mar. Biol. 2009, 156, 2121–2128. [Google Scholar] [CrossRef]
- Rosas, C.; Valero, A.; Caamal-Monsreal, C.; Uriarte, I.; Farias, A.; Gallardo, P.; Sánchez, A.; Domingues, P. Effects of Dietary Protein Sources on Growth, Survival and Digestive Capacity of Octopus maya Juveniles (Mollusca: Cephalopoda). Aquac. Res. 2013, 44, 1029–1044. [Google Scholar] [CrossRef]
- Hamdan, M.; Tomás-Vidal, A.; Martínez, S.; Cerezo-Valverde, J.; Moyano, F.J. Development of an in Vitro Model to Assess Protein Bioavailability in Diets for Common Octopus (Octopus vulgaris). Aquac. Res. 2014, 45, 2048–2056. [Google Scholar] [CrossRef]
- Rosas, C.; Tut, J.; Baeza, J.; Sánchez, A.; Sosa, V.; Pascual, C.; Arena, L.; Domingues, P.; Cuzon, G. Effect of Type of Binder on Growth, Digestibility, and Energetic Balance of Octopus maya. Aquaculture 2008, 275, 291–297. [Google Scholar] [CrossRef]
- Cornet, V.; Henry, J.; Corre, E.; Le Corguille, G.; Zanuttini, B.; Zatylny-Gaudin, C. Dual Role of the Cuttlefish Salivary Proteome in Defense and Predation. J. Proteom. 2014, 108, 209–222. [Google Scholar] [CrossRef]
- Vidal, J.F.D.; Schwartz, M.F.; Garay, A.V.; Valadares, N.F.; Bueno, R.V.; Monteiro, A.C.L.; de Freitas, S.M.; Barbosa, J.A.R.G. Exploring the Diversity and Function of Serine Proteases in Toxicofera Reptile Venoms: A Comprehensive Overview. Toxins 2024, 16, 428. [Google Scholar] [CrossRef]
- Kanda, A.; Iwakoshi-Ukena, E.; Takuwa-Kuroda, K.; Minakata, H. Isolation and Characterization of Novel Tachykinins from the Posterior Salivary Gland of the Common Octopus Octopus vulgaris. Peptides 2003, 24, 35–43. [Google Scholar] [CrossRef]
- Rokyta, D.R.; Lemmon, A.R.; Margres, M.J.; Aronow, K. The Venom-Gland Transcriptome of the Eastern Diamondback Rattlesnake (Crotalus Adamanteus). BMC Genom. 2012, 13, 312. [Google Scholar] [CrossRef]
- Lee, P.G. Nutrition of Cephalopods: Fueling the System. Mar. Freshw. Behav. Physiol. 1995, 25, 35–51. [Google Scholar] [CrossRef]
- García-Garrido, S.; Hachero-Cruzado, I.; Garrido, D.; Rosas, C.; Domingues, P. Lipid Composition of the Mantle and Digestive Gland of Octopus vulgaris Juveniles (Cuvier, 1797) Exposed to Prolonged Starvation. Aquac. Int. 2010, 18, 1223–1241. [Google Scholar] [CrossRef]









| Transcript ID | Putative Protein | Tm | Sequence | Ps | E% | |
|---|---|---|---|---|---|---|
| ASG-TRINITY_DN652_c0_g1_i9 | FMRFamide neuropeptide | F | 58.19 | GGAACCTGACAAGCGATTCA | 144 | 100.3 |
| R | 59.75 | TCTTCTTCCCCATTGCCTCG | ||||
| PSG-TRINITY_DN383_c0_g1_i1 | Chymotrypsin-1 | F | 59.68 | GATGGGGTGATCTCGGATGG | 134 | 98.7 |
| R | 59.07 | GTCACCTGCACACAAGACG | ||||
| DG-TRINITY_DN585_c2_g2_i7 | NPC intracellular cholesterol transporter 2 | F | 58.3 | GGTCTCACTTGTCCCTTAAGC | 149 | 99.5 |
| R | 58.09 | GCTGGGATCTGGACACAAAA | ||||
| PSG-TRINITY_DN3257_c3_g1_i1 | ATPase subunit D | F | 58.4 | CCGAAGCCAAGTTTACCACA | 147 | 99.8 |
| R | 58.88 | TGGTGTCTGTTCCGTCTTGA | ||||
| ASG-TRINITY_DN15872_c0_g1_i1 | Elongation factor 1-beta | F | 59.01 | TGCCCTCATTGCCAAGAGTA | 123 | 115 |
| R | 59.46 | GAAGCACCCCAGAGTAGACC | ||||
| Embryo-TRINITY_DN11489_c0_g1_i4 | Eukaryotic translation initiation factor 2A | F | 58.68 | GCTGGCACTGGTTTACTTGT | 149 | 105.7 |
| R | 59.3 | TGCCACTCCACACAATAGACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martínez-Morales, M.G.; Juárez, O.E.; Tovar-Ramírez, D.; Galindo-Sánchez, C.E.; Ventura-López, C.; Rosas, C.; Nolasco-Soria, H.; Ceballos-Vázquez, B.P. Tissue-Specific Gene Expression of Digestive Tract Glands in Paroctopus digueti: Insights for Cephalopod Biology and Aquaculture. Animals 2025, 15, 3224. https://doi.org/10.3390/ani15213224
Martínez-Morales MG, Juárez OE, Tovar-Ramírez D, Galindo-Sánchez CE, Ventura-López C, Rosas C, Nolasco-Soria H, Ceballos-Vázquez BP. Tissue-Specific Gene Expression of Digestive Tract Glands in Paroctopus digueti: Insights for Cephalopod Biology and Aquaculture. Animals. 2025; 15(21):3224. https://doi.org/10.3390/ani15213224
Chicago/Turabian StyleMartínez-Morales, María G., Oscar E. Juárez, Dariel Tovar-Ramírez, Clara E. Galindo-Sánchez, Claudia Ventura-López, Carlos Rosas, Héctor Nolasco-Soria, and Bertha Patricia Ceballos-Vázquez. 2025. "Tissue-Specific Gene Expression of Digestive Tract Glands in Paroctopus digueti: Insights for Cephalopod Biology and Aquaculture" Animals 15, no. 21: 3224. https://doi.org/10.3390/ani15213224
APA StyleMartínez-Morales, M. G., Juárez, O. E., Tovar-Ramírez, D., Galindo-Sánchez, C. E., Ventura-López, C., Rosas, C., Nolasco-Soria, H., & Ceballos-Vázquez, B. P. (2025). Tissue-Specific Gene Expression of Digestive Tract Glands in Paroctopus digueti: Insights for Cephalopod Biology and Aquaculture. Animals, 15(21), 3224. https://doi.org/10.3390/ani15213224

