Next Article in Journal
Bacterial Composition Across Bat Species: A Human Health Perspective
Previous Article in Journal
Wing Shape Fluctuating Asymmetry in Flies: Insights into Environmental and Public Health Risk
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus

1
Department of Convergence Interdisciplinary Education of Maritime and Ocean Contents, Korea Maritime & Ocean University, Busan 49112, Republic of Korea
2
Ocean Science and Technology School, Korea Maritime & Ocean University, Busan 49112, Republic of Korea
3
Aquatic Disease Control Division, Fishery Products Quality Management Service, Busan 49111, Republic of Korea
4
Department Division of Convergence on Marine Science, Korea Maritime & Ocean University, Busan 49112, Republic of Korea
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2025, 15(21), 3125; https://doi.org/10.3390/ani15213125
Submission received: 24 September 2025 / Revised: 18 October 2025 / Accepted: 27 October 2025 / Published: 28 October 2025

Simple Summary

Olive flounder is a valuable aquaculture species in South Korea, and a variety of antibiotics are used to treat bacterial diseases in aquatic organisms. In our study, we examined the effect of the quinolone-class flumequine on olive flounder. The results of the drug metabolism genes and histopathological symptoms indicate increased gene expression levels and a severe lesions tendency at the high concentration of flumequine (4×) compared to the low concentration (1×). This study may contribute to understanding the effects of flumequine on drug metabolism and general toxicity.

Abstract

Flumequine is an antibiotic that is used to treat bacterial diseases in aquaculture. Fish express drug-metabolizing genes in response to antibiotic exposure. However, studies on the effects of high flumequine concentrations on drug metabolism genes and histopathology of the olive flounder are limited. To investigate the response of olive flounder to flumequine, we administered it at different concentrations. We analyzed the expression of drug metabolism genes (CYP) in the liver and histopathological lesions in the liver, spleen, and kidneys. The gene expression levels of CYP were higher at the highest flumequine concentration tested (4×) than at the lowest flumequine concentration (1×). The highest CYP gene expression level was observed for CYP2B4 (46.6-fold) at 4× flumequine compared to that in the control group. Hepatic atrophy, lymphocytic infiltration, and hematopoiesis were observed in the liver, spleen, and kidney at 4× flumequine between 3 and 24 h compared to 1× flumequine, respectively. These results contribute to a better understanding of drug metabolism and the general toxicity of pharmaceutical exposure in olive flounder.

1. Introduction

Following the discovery of penicillin by Fleming, a variety of antibiotics have been developed and are used in aquaculture to treat bacterial diseases [1]. Since nalidixic acid was discovered in 1962, numerous synthetic derivatives of quinolone antibiotics have been developed to improve their antimicrobial efficacy [2]. A quinolone antibiotic, flumequine, is used to treat bacterial diseases. Flumequine inhibits bacterial activity by targeting enzymes involved in DNA replication, particularly DNA gyrase, thereby exerting its antibacterial effect by blocking bacterial DNA replication [3,4,5].
In South Korea, flumequine is used in aquaculture and veterinary medicine to treat bacterial diseases in aquatic organisms. Fish express drug-metabolizing genes in response to antibiotic exposure [6]. Drug metabolism refers to the chemical modification of drugs in the body. In a previous study of drug metabolism in fish, 94 cytochrome P450 (CYP) genes were identified in zebrafish (Danio rerio), a species commonly used in drug metabolism research [7]. CYP is a representative group of drug-metabolizing genes that play a critical role in the biotransformation and elimination of xenobiotics from the body. These genes are primarily expressed in the liver, which is one of the largest internal organs in fish and serves as a key site for the metabolism of absorbed antibiotics [8,9]. Furthermore, absorbed antibiotics have been shown to cause adverse effects on fish internal organs, including hepatocellular degeneration and necrosis [10,11,12]. The olive flounder, Paralichthys olivaceus, a benthic fish species belonging to the order Pleuronectiformes and family Paralichthyidae, is distributed along the entire coastline of Korea. The aquaculture industry experienced rapid growth in the 1980s, following the development of aquaculture production technologies and artificial seed production techniques [13]. Olive flounder is a commercially valuable aquaculture species that constituted 46% of the total domestic aquaculture production of fish in South Korea in 2022. In South Korea, flumequine antibiotics are restricted to oral administration, and the target species include olive flounder. Flumequine is one of the most frequently used antibiotics in aquaculture [4]. However, studies on CYP gene expression and histopathology of the olive flounder in response to high flumequine concentrations are limited. To investigate the response to flumequine in olive flounder, we examined drug metabolism-related genes and histopathological lesions following the administration of different concentrations of flumequine.

2. Materials and Methods

2.1. Experimental Animals and Drug

Healthy adult olive flounder weighing 408.2 ± 35.7 g (body length, 33.1 ± 1.5 cm) were purchased from a private farm in Pohang city, Gyeongbuk, Korea, and acclimated for two weeks under laboratory conditions. The absence of flumequine in the serum, muscle, and skin was confirmed by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) method. Commercial flumequine was purchased from Komipharm (Siheung City, Gyeonggi-do, Republic of Korea). The recommended oral usage and dosage of flumequine is 120–200 g per body weight for 3–7 d, which has a raw material ingredient with 12–20 g of raw material ingredient per ton. To investigate the effect of flumequine, 20 fish in each of the six experimental groups (3, 6, 12, 24, 96, and 168 h) were orally administered a commercial pellet diet (CJ Feed Inc., Gunsan, Jeonbuk, Republic of Korea) containing flumequine at 1× and 4× doses for seven days. Diets were prepared by mixing flumequine with commercial pellets. Individual fish received flumequine at doses of 0.8 mg/g of fish body weight/day. Fish that were not treated with flumequine were used as the control group. All experimental feeds were supplied twice, and a total of 280 fish were used for the experiment. The water temperature in running water type culture tanks (1.5 ton) was maintained at 23 ± 0.5 °C using heat control systems (Aquatron System, Yoowon Electronics, Seoul, Republic of Korea). Experimental fish were humanely euthanized using MS-222 (ethyl 3-aminobenzoate methanesulfonate salt, Sigma-Aldrich, St. Louis, MO, USA). All the fish experiments were approved by the Institutional Animal Care and Use Committee (IACUC, NIFS-2019-6).

2.2. Expression Analysis of Drug Metabolism-Related Genes by Real-Time PCR

Total RNA was extracted from the liver using an RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Total RNA was reverse transcribed using a Transcriptor First-Strand cDNA Synthesis Kit (Roche, Dublin, Ireland). Real-Time quantitative reverse transcription PCR (RT-qPCR) was used to evaluate gene expression levels using a 7500 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). RT-qPCR was performed with SYBR™ Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA) using specific primer sets of the different cytochrome P-450 genes (Table 1) according to the manufacturer’s protocol. Expression of the target genes was normalized to an endogenous reference β-actin and presented as the subtraction of target CT values from β-actin CT values (ΔCT value). Comparison of gene expression between groups and calibrator was derived from subtraction of the calibrator ΔCT values from the target ΔCT values to give a ΔΔCT value. Relative gene expression was calculated to determine fold difference (2−ΔΔCT). The control group was used to perform relative quantification by comparison with the values of the 1× and 4× experimental groups at each time point (3, 6, 12, 24, 96, and 168 h). Significant differences between the flumequine-treated and control groups were determined using the SPSS Student’s t-test (Version 25.0, SPSS Inc., Chicago, IL, USA). All experiments were performed in triplicates.

2.3. Histopathological Analysis

For histopathological analysis, olive flounders from the control and experimental groups (3, 6, 12, 24, 96, and 168 h) were collected after administration of flumequine at different concentrations (1× and 4×). The fish were anesthetized using MS-222 (ethyl 3-aminobenzoate methanesulfonate salt) and the liver, spleen, and kidney were separated and fixed in 10% neutral buffered formalin. Tissue samples were dehydrated through an ethanol, cleared, and embedded in paraffin wax using a tissue processor (Leica TP1020, Leica Biosystems, Wetzlar, Germany). Tissue blocks were sectioned (4 µm thickness) using a microtome machine (Leica RM2235, Leica Biosystems, Wetzlar, Germany) and stained with hematoxylin and eosin (H&E) for microscopy. All experiments were performed in triplicates.

3. Results

3.1. Gene Expression Analysis

In the liver of olive flounder, gene expression of CYP1A1 was significantly induced after flumequine treatment. The 4× flumequine group exhibited higher expression levels than the 1× flumequine group at 6–24 h (p < 0.05). The highest CYP1A1 expression was observed at 6 h (27.1-fold) but remained significant between 12 h and 24 h (Figure 1A) (p < 0.05). The gene expression of CYP1B1 increased at 6 h following 1× and 4× flumequine administration compared to the control group. The expression level in the 4× group was 12.9-fold, which was higher than the 8.5-fold induction observed in the 1× treatment group (Figure 1B).
CYP2B4 expression was significantly increased in both treatment groups. In the 1× flumequine group, moderate increases were observed at all time points, ranging from 2.3 to 7.5-fold (p < 0.05). In contrast, the 4× group showed a 46.6-fold increase at 6 h, with sustained upregulation of 7.4 and 23.8-fold at 12 and 24 h, respectively (Figure 1C) (p < 0.05). In the case of CYP2F2, 1× flumequine significantly induced gene expression by 6.4-fold compared with that in the control group at 96 h (Figure 1D) (p < 0.05). Furthermore, 4× flumequine resulted in a 23.0-fold significant increase at 6 h, which was 3.6-fold higher than the peak expression observed with 1× (Figure 1D) (p < 0.05). No significant increase in CYP4B1 gene expression was observed in the 1× flumequine compared to that in the control. However, 4× flumequine significantly upregulated CYP4B1 expression by 12.7-fold and 8.1-fold at 6 h and 24 h after administration, respectively (Figure 1E) (p < 0.05).

3.2. Histopathological Analysis

In the control group, no histopathological changes were observed in the liver, spleen, and kidney. However, mild hepatic atrophy, lymphocytic infiltration in the spleen, and hematopoiesis in the kidney were observed at 3 to 168 h in the test group exposed to 1× flumequine (Figure 2). In the 4× test group, hepatic atrophy (black arrows) and congestion (blue arrows) were observed from 3 to 24 h, along with lymphocytic infiltration (green arrows) in the spleen and hematopoiesis (yellow arrows) in the kidneys (Figure 2). All lesions observed in the 4× flumequine group exhibited a progressive increase in severity over time.

4. Discussion

Flumequine is an antibiotic used to treat bacterial infections. In this study, we investigated the effect of flumequine on olive flounder by analyzing the expression of cytochrome P450 (CYP) family genes in the liver and conducting histopathological analyses of the liver, spleen, and kidneys after oral administration of different concentrations of flumequine. Exposure to chemical substances can influence the expression of CYPs in fish [14]. Fish may experience adverse effects on their organs because of exposure to chemicals, including pharmaceuticals [15]. In this study, flumequine, an antibacterial agent used to treat bacterial diseases, tended to increase the expression of CYP1A1, CYP1B1, CYP2B4, CYP2F2, and CYP4B1 following administration at a 4× dose compared to a 1× dose. Therefore, it has been shown that acute exposure of olive flounder to high concentrations of flumequine induces an increase in gene expression compared with lower concentrations.
In zebrafish, exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which is used in chemical risk assessments for fish, has been reported to induce CYP1A and CYP1B gene expression in zebrafish embryos [16]. These reports anticipated a similar effect on CYP1 family genes in olive flounder following exposure to xenobiotics. In this study, following exposure to flumequine, the expression of CYP1A1 and CYP1B1 increased in the liver of olive flounder (Figure 1A,B). This also suggests that after the drug diffuses into the hepatocytes, it may bind to intracellular carrier proteins and enter the nucleus to stimulate mRNA transcription [17]. Exposure to the toxic compound 3,3′,4,4′,5-pentachlorobiphenyl (PCB126) affected the expression of CYP2 family genes in zebrafish, which are regulated by the xenobiotic-metabolizing receptor Pregnane X Receptor (PXR) [18]. Therefore, the observed increase in CYP2B4 and CYP2F2 expression following flumequine exposure may be attributed to PXR-mediated regulatory effects (Figure 1C,D). The CYP4 family is primarily expressed in the liver and intestine of the rare minnow (Gobiocypris rarus) [19]. CYP4B1 is involved in the metabolism of toxic xenobiotics, including valproic acid [20]. In this study, the observed increase in liver CYP4B1 expression suggests that flumequine may induce toxicity in olive flounder (Figure 1E).
Fish generally show increased expression of CYP family genes after acute exposure to chemical substances. However, chronic exposure leads to a decrease in the expression of the CYP gene family. This has been reported as an adaptation to contaminated environments [21]. In this study, CYP gene expression increased after the acute exposure of olive flounder to flumequine. In humans, the increase in CYP gene expression is the cause of liver injury induced by drug toxicity because the liver plays a central role in the metabolism of most drug [22]. Although the fish liver does not perfectly mirror the human liver, it exhibits physiological processes and drug metabolism pathways that are similar to those in humans. This makes it a valuable experimental model for studying drug-induced liver injuries [23]. Therefore, the increase in CYP expression in the liver of olive flounder exposed to flumequine is likely a response induced by drug detoxification [24].
Histopathological analysis is used to assess the effect of antibiotics on aquatic organisms and is an experimental technique used to identify tissue lesions from antibiotic exposure [25]. Oral administration of flumequine induces hepatic tumors in mice [26]. Fluoroquinolones are similar to flumequine. In a mouse experiment, orally administered fluoroquinolone caused follicular hyperplasia in the spleen and induced lymphocytic inflammation in the kidneys [27]. In the present study, olive flounder exposed to a low concentration (1×) of flumequine exhibited mild lesions in the liver, spleen, and kidneys. In contrast, the administration of a high concentration (4×) of flumequine resulted in the exacerbation of tissue lesions. These results suggest that the liver, spleen, and kidneys of olive flounder exhibited a more pronounced response to high concentrations of flumequine than to low concentrations. The differences in histopathological findings between mice and olive flounder following exposure to quinolone antibiotics may be attributed to variations in administered drug concentrations and fundamental species-specific differences between mammals and fish.
In this study, olive flounder exposed to 4× flumequine exhibited increased CYP gene expression and severe histopathological lesions compared to those exposed to 1× flumequine. The observed upregulation of CYP gene expression and histopathological tissue lesions in the liver are presumed to be caused by the widespread diffusion of drug toxins throughout the liver via the portal vein [8]. This suggests that the liver plays a critical role in the response to antibiotic exposure. Therefore, the expression of drug-metabolizing genes and tissue damage in olive flounder are not independent but rather involve interacting mechanisms. Further research is necessary to clarify the associations between gene expression and tissue lesion changes.

5. Conclusions

In this study, the expression of CYP drug-metabolizing genes increased following 4× flumequine exposure compared to 1× exposure. Furthermore, 4× flumequine exposure exacerbated the tissue lesion severity relative to 1× exposure. Therefore, a 4× concentration of flumequine can exacerbate adverse health effects in olive flounder compared to a 1× concentration. To ensure safe and healthy aquaculture organisms, using high concentrations of flumequine should be discouraged, and adhering to established dosage guidelines is essential. These results contribute to elucidating the effects of flumequine exposure on drug metabolism and general toxicity in olive flounder.

Author Contributions

Conceptualization, S.D.H. and J.S.S.; methodology, G.B.L., H.J.N. and J.-M.J.; formal analysis, G.B.L., H.J.N. and J.S.S.; investigation, G.B.L., H.J.N., J.-M.J., M.-G.K., S.D.H. and J.S.S.; resources, G.B.L., H.J.N., J.-M.J., M.-G.K., S.D.H. and J.S.S.; writing—original draft preparation, G.B.L. and H.J.N.; writing—review and editing, S.D.H. and J.S.S.; visualization, G.B.L. and H.J.N.; supervision, S.D.H. and J.S.S.; project administration, M.-G.K. and J.S.S.; funding acquisition, M.-G.K. and J.S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Fishery products Quality management Service (NFQS2025002), Ministry of Oceans and Fisheries, Republic of Korea.

Institutional Review Board Statement

All the fish experiments were approved by the Institutional Animal Care and Use Committee (IACUC NIFS-2019-6).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Son, K.T.; Jo, M.R.; Oh, E.G.; Mok, J.S.; Kwon, J.Y.; Lee, T.S.; Song, K.C.; Kim, P.H.; Lee, H.J. Residues of ampicillin and amoxicillin in Olive Flounder Paralichthys olivaceus following oral administration. Korean J. Fish. Aquat. Sci. 2011, 44, 464–469. [Google Scholar] [CrossRef] [Scilit]
  2. Pecorelli, I.; Galarini, R.; Bibi, R.; Floridi, A.; Casciarri, E.; Floridi, A. Simultaneous determination of 13 quinolones from feeds using accelerated solvent extraction and liquid chromatography. Anal. Chim. Acta 2003, 483, 81–89. [Google Scholar] [CrossRef] [Scilit]
  3. Ali, I.; Sekkoum, K.; Belboukhari, N.; Rebizi, M.N.; Zaid, M.E.A.; Yusuf, K.; Alothman, A.A.; AlJumah, B.A.; Ouladsmane, M. Determination of enantio-separation, absolute configuration and chiral recognition mechanism of ofloxacin and flumequine by HPLC and modeling studies. J. Chem. Technol. Biotechnol. 2021, 96, 2901–2908. [Google Scholar] [CrossRef] [Scilit]
  4. Baati, T.; Brahim, M.B.; Salek, A.; Selmi, M.; Njim, L.; Umek, P.; Aouane, A.; Hammami, M.; Hosni, K. Flumequine-loaded titanate nanotubes as antibacterial agents for aquaculture farms. RSC Adv. 2022, 12, 5953–5963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Rajakumari, K.; Aravind, K.; Balamugundhan, M.; Jagadeesan, M.; Somasundaram, A.; Devi, P.B.; Ramasamy, P. Comprehensive review of DNA gyrase as enzymatic target for drug discovery and development. Eur. J. Med. Chem. Rep. 2024, 12, 100233. [Google Scholar] [CrossRef] [Scilit]
  6. David, S.; Hamilton, J.P. Drug-induced liver injury. US Gastroenterol. Hepatol. Rev. 2010, 6, 73. [Google Scholar] [PubMed]
  7. Cakan-Akdogan, G.; Aftab, A.M.; Cinar, M.C.; Abdelhalim, K.A.; Konu, O. Zebrafish as a model for drug induced liver injury: State of the art and beyond. Explor. Dig. Dis. 2023, 2, 44–55. [Google Scholar] [CrossRef] [Scilit]
  8. Long, S.; Dong, X.; Liu, H.; Yan, X.; Tan, B.; Zhang, S.; Chi, S.; Yang, Q.; Liu, H.; Yang, Y.; et al. Effect of dietary oxidized fish oil on liver function in hybrid grouper (♀ Epinephelus fuscoguttatus × ♂ Epinephelus lanceolatus). Aquac. Rep. 2022, 22, 101000. [Google Scholar] [CrossRef] [Scilit]
  9. Zhao, M.; Ma, J.; Li, M.; Zhang, Y.; Jiang, B.; Zhao, X.; Huai, C.; Shen, L.; Zhang, N.; He, L.; et al. Cytochrome P450 enzymes and drug metabolism in humans. Int. J. Mol. Sci. 2021, 22, 12808. [Google Scholar] [CrossRef] [Scilit]
  10. Bardhan, A.; Abraham, T.J.; Das, R.; Patil, P.K. Unraveling florfenicol’s effects on splenic histology, erythrocytes, and hematology of healthy Oreochromis niloticus juveniles. Appl. Res. 2024, 3, e202400017. [Google Scholar] [CrossRef] [Scilit]
  11. Limbu, S.M.; Ma, Q.; Zhang, M.L.; Du, Z.Y. High fat diet worsens the adverse effects of antibiotic on intestinal health in juvenile Nile tilapia (Oreochromis niloticus). Sci. Total Environ. 2019, 680, 169–180. [Google Scholar] [CrossRef] [Scilit]
  12. Rodrigues, S.; Antunes, S.C.; Nunes, B.; Correia, A.T. Histological alterations in gills and liver of rainbow trout (Oncorhynchus mykiss) after exposure to the antibiotic oxytetracycline. Environ. Toxicol. Pharmacol. 2017, 53, 164–176. [Google Scholar] [CrossRef] [Scilit]
  13. Seong, M.J.; Park, Y.J. Short and long-term immune effects of Poly (I: C) in kidney of Olive flounder (Paralichthys olivaceus). J. Fish Pathol. 2024, 37, 123–132. [Google Scholar]
  14. Bailey, C.; von Siebenthal, E.W.; Rehberger, K.; Segner, H. Transcriptomic analysis of the impacts of ethinylestradiol (EE2) and its consequences for proliferative kidney disease outcome in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 222, 31–48. [Google Scholar] [CrossRef] [Scilit]
  15. Reddy, J.K.; Rao, M.S. Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. Am. J. Physiol.-Gastrointest. Liver Physiol. 2006, 290, G852–G858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Dorrington, T.; Zanette, J.; Zacchi, F.L.; Stegeman, J.J.; Bainy, A.C. Basal and 3-methylcholanthrene-induced expression of cytochrome P450 1A, 1B and 1C genes in the Brazilian guppy, Poecilia vivipara. Aquat. Toxicol. 2012, 124, 106–113. [Google Scholar] [CrossRef] [Scilit]
  17. Li, Q.; He, B.; Ge, C.; Yu, D. Transcriptomics-based systematic identification and tissue-specific distribution of cytochrome P450 genes in Carassius auratus. Aquac. Res. 2022, 53, 4567–4576. [Google Scholar] [CrossRef] [Scilit]
  18. Saad, M.; Cavanaugh, K.; Verbueken, E.; Pype, C.; Casteleyn, C.; Van Ginneken, C.; Van Cruchten, S. Xenobiotic metabolism in the zebrafish: A review of the spatiotemporal distribution, modulation and activity of Cytochrome P450 families 1 to 3. J. Toxicol. Sci. 2016, 41, 1–11. [Google Scholar] [CrossRef] [Scilit]
  19. Uno, T.; Ishizuka, M.; Itakura, T. Cytochrome P450 (CYP) in fish. Environ. Toxicol. Pharmacol. 2012, 34, 1–13. [Google Scholar] [CrossRef] [Scilit]
  20. Baer, B.R.; Rettie, A.E. CYP4B1: An enigmatic P450 at the interface between xenobiotic and endobiotic metabolism. Drug Metab. Rev. 2006, 38, 451–476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Cortés-Miranda, J.; Rojas-Hernández, N.; Muñoz, G.; Copaja, S.; Quezada-Romegialli, C.; Veliz, D.; Vega-Retter, C. Biomarker selection depends on gene function and organ: The case of the cytochrome P450 family genes in freshwater fish exposed to chronic pollution. PeerJ 2024, 12, e16925. [Google Scholar] [CrossRef] [Scilit]
  22. Serras, A.S.; Rodrigues, J.S.; Cipriano, M.; Rodrigues, A.V.; Oliveira, N.G.; Miranda, J.P. A critical perspective on 3D liver models for drug metabolism and toxicology studies. Front. Cell Dev. Biol. 2021, 9, 626805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Vliegenthart, A.B.; Tucker, C.S.; Del Pozo, J.; Dear, J.W. Zebrafish as model organisms for studying drug-induced liver injury. Br. J. Clin. Pharmacol. 2014, 78, 1217–1227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Burkina, V.; Zlabek, V.; Zamaratskaia, G. Effects of pharmaceuticals present in aquatic environment on Phase I metabolism in fish. Environ. Toxicol. Pharmacol. 2015, 40, 430–444. [Google Scholar] [CrossRef] [Scilit]
  25. Rodrigues, S.; Antunes, S.C.; Nunes, B.; Correia, A.T. Histopathological effects in gills and liver of Sparus aurata following acute and chronic exposures to erythromycin and oxytetracycline. Environ. Sci. Pollut. Res. 2019, 26, 15481–15495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Yoshida, M.; Miyajima, K.; Shiraki, K.; Ando, J.; Kudoh, K.; Nakae, D.; Takahashi, M.; Maekawa, A. Hepatotoxicity and consequently increased cell proliferation are associated with flumequine hepatocarcinogenesis in mice. Cancer Lett. 1999, 141, 99–107. [Google Scholar] [CrossRef] [Scilit]
  27. Khasawneh, A.F.; Al-Hadidi, K.A.; Aburjai, T.A.; Obeidat, F.N. Acute and subacute (20-d) oral dose toxicity study of modified fluoroquinolone compound 6C in BALB/c mice. Toxin Rev. 2015, 34, 129–135. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Gene expression of (A) CYP1A1, (B) CYP1B1, (C) CYP2B4, (D) CYP2F2, and (E) CYP4B1 in the liver at 3 h, 6 h, 12 h, 24 h, 96 h, and 168 h after administration of different concentrations of flumequine to olive flounder. * indicate significant differences (p < 0.05).
Figure 1. Gene expression of (A) CYP1A1, (B) CYP1B1, (C) CYP2B4, (D) CYP2F2, and (E) CYP4B1 in the liver at 3 h, 6 h, 12 h, 24 h, 96 h, and 168 h after administration of different concentrations of flumequine to olive flounder. * indicate significant differences (p < 0.05).
Animals 15 03125 g001
Figure 2. Histopathological sections of liver, spleen, and kidney after flumequine administration at 3 h, 6 h, 12 h, 24 h, 96 h, and 168 h in olive flounder. Sections were stained with hematoxylin and eosin to observe histopathological changes. The microphotographs of histopathological lesion were observed using a microscope (ECLIPSE Ni-U, Nikon, Tokyo, Japan; Scale bar = 50 μm).
Figure 2. Histopathological sections of liver, spleen, and kidney after flumequine administration at 3 h, 6 h, 12 h, 24 h, 96 h, and 168 h in olive flounder. Sections were stained with hematoxylin and eosin to observe histopathological changes. The microphotographs of histopathological lesion were observed using a microscope (ECLIPSE Ni-U, Nikon, Tokyo, Japan; Scale bar = 50 μm).
Animals 15 03125 g002
Table 1. Primers for RT-qPCR used in this study.
Table 1. Primers for RT-qPCR used in this study.
GenesPrimerSequences (5′-3′)
β-actinforwardGAGATGAAGCCCAGAGCAAGAG
reverseCAGCTGTGGTGGTGAAGGAGTAG
CYP1A1forwardGATGAGGAGCTGTGGAAAGA
reverseAGACTTCATTTCGAGCGATG
CYP1B1forwardATGCAGCTGTTCCTTTTCAC
reverseTTTGACCTCCTCTGCACTTC
CYP2B4forwardCACACATACAAGAGCGTTGC
reverseCCCATGAGCTCTGTGTCTTT
CYP2F2forwardAAGCCTTCATGCCTTTCTCT
reverseGGTTTAGGGGTCTGAGTCGT
CYP4B1forwardTGCCTGAAGGTTCTCTTGTC
reverseGTCTGACCGATGCAGTTTCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lee, G.B.; Na, H.J.; Jeong, J.-M.; Kwon, M.-G.; Hwang, S.D.; Seo, J.S. Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus. Animals 2025, 15, 3125. https://doi.org/10.3390/ani15213125

AMA Style

Lee GB, Na HJ, Jeong J-M, Kwon M-G, Hwang SD, Seo JS. Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus. Animals. 2025; 15(21):3125. https://doi.org/10.3390/ani15213125

Chicago/Turabian Style

Lee, Gi Baeg, Hyeon Ju Na, Ji-Min Jeong, Mun-Gyeong Kwon, Seong Don Hwang, and Jung Soo Seo. 2025. "Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus" Animals 15, no. 21: 3125. https://doi.org/10.3390/ani15213125

APA Style

Lee, G. B., Na, H. J., Jeong, J.-M., Kwon, M.-G., Hwang, S. D., & Seo, J. S. (2025). Effects of High Concentrations of Flumequine on CYP Gene Expression and Histopathology in Olive Flounder, Paralichthys olivaceus. Animals, 15(21), 3125. https://doi.org/10.3390/ani15213125

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop