Effects of Dietary Tea Polyphenols on the Growth, Antioxidant Status, Immune Function, and Intestinal Microbiota of Largemouth Bass (Micropterus salmoides)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Feed Design and Preparation
2.2. Experimental Trial
2.3. Sampling
2.4. Growth Parameters
2.5. Proximate Composition Assay
2.6. Enzymatic Activities and Serum Biochemical Indices
2.7. Histology Analysis
2.8. Real-Time PCR Assay
2.9. Intestinal Microbiota Analysis
2.10. Statistical Analysis
3. Results
3.1. Growth Performance, Proximate Composition, and Biometric Parameters
3.2. Serum Biochemical Indices
3.3. Antioxidant Capacity of the Serum and Liver
3.4. Digestive Enzyme Activities
3.5. Intestine and Liver Histomorphology
3.6. Intestinal Microbial Analysis in the C, TP4, and TP8 Groups
3.6.1. Diversity, Richness, and Structure of the Intestinal Microbiota
3.6.2. Bacterial Composition
3.7. The mRNA Expression of Genes Related to Antioxidation and Immunity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dong, S.L.; Dong, Y.W.; Huang, L.Y.; Zhou, Y.G.; Cao, L.; Tian, X.L.; Han, L.M.; Li, D.H. Advancements and Hurdles of Deeper-offshore Aquaculture in China. Rev. Aquac. 2024, 16, 644–655. [Google Scholar] [CrossRef]
- Dong, S.L.; Dong, Y.W.; Cao, L.; Verreth, J.; Olsen, Y.; Liu, W.J.; Fang, Q.Z.; Zhou, Y.G.; Li, L.; Li, J.Y.; et al. Optimization of Aquaculture Sustainability through Ecological Intensification in China. Rev. Aquac. 2022, 14, 1249–1259. [Google Scholar] [CrossRef]
- Yang, Z.X.; Liu, P.Q.; Kong, Q.; Deng, Y.Y.; Zhang, W.Q.; Xu, G.H.; Tang, H.J. Effects of Co-Fermented Feed Using Lactobacillus acidophilus, Limosilactobacillus reuteri and Lactiplantibacillus plantarum on Growth, Antioxidant Capacity, Fatty Acids and Gut Microbiota of Largemouth Bass (Micropterus salmoides). Fishes 2023, 8, 433. [Google Scholar] [CrossRef]
- Ministry of Agriculture and Rural Affairs, China. China Fishery Statistics Yearbook; China Agriculture Press: Beijing, China, 2023; ISBN 978-109-30778-0.
- Tadese, D.A.; Song, C.Y.; Sun, C.X.; Liu, B.; Liu, B.; Zhou, Q.L.; Xu, P.; Ge, X.P.; Liu, M.Y.; Xu, X.D.; et al. The Role of Currently Used Medicinal Plants in Aquaculture and Their Action Mechanisms: A Review. Rev. Aquac. 2022, 14, 816–847. [Google Scholar] [CrossRef]
- Zhong, L.; Hu, Y.J.; Hu, Y.; Li, J.L.; Tian, Y.N.; Chen, J.S.; Ai, Q.H.; Xiao, T.Y. Effects of Dietary Tea Polyphenols on Growth, Immunity and Lipid Metabolism of Juvenile Black Carp Mylopharyngodon Piceus. Aquac. Res. 2020, 51, 569–576. [Google Scholar] [CrossRef]
- Wang, J.; Deng, L.F.; Chen, M.X.; Che, Y.Y.; Li, L.; Zhu, L.L.; Chen, G.S.; Feng, T. Phytogenic Feed Additives as Natural Antibiotic Alternatives in Animal Health and Production: A Review of the Literature of the Last Decade. Anim. Nutr. 2024, 17, 244–264. [Google Scholar] [CrossRef]
- Elumalai, P.; Kurian, A.; Lakshmi, S.; Faggio, C.; Esteban, M.A.; Ringø, E. Herbal Immunomodulators in Aquaculture. Rev. Fish. Sci. Aquac. 2021, 29, 33–57. [Google Scholar] [CrossRef]
- Uchida, K.; Konishi, Y.; Harada, K.; Okihashi, M.; Yamaguchi, T.; Do, M.H.N.; Bui, L.T.; Nguyen, T.D.; Nguyen, P.D.; Khong, D.T.; et al. Monitoring of Antibiotic Residues in Aquatic Products in Urban and Rural Areas of Vietnam. J. Agric. Food Chem. 2016, 64, 6133–6138. [Google Scholar] [CrossRef]
- Yukgehnaish, K.; Kumar, P.; Sivachandran, P.; Marimuthu, K.; Arshad, A.; Paray, B.A.; Arockiaraj, J. Gut Microbiota Metagenomics in Aquaculture: Factors Influencing Gut Microbiome and Its Physiological Role in Fish. Rev. Aquac. 2020, 12, 1903–1927. [Google Scholar] [CrossRef]
- Chelossi, E.; Vezzulli, L.; Milano, A.; Branzoni, M.; Fabiano, M.; Riccardi, G.; Banat, I.M. Antibiotic Resistance of Benthic Bacteria in Fish-Farm and Control Sediments of the Western Mediterranean. Aquaculture 2003, 219, 83–97. [Google Scholar] [CrossRef]
- Fowler, L.A.; Williams, M.B.; Dennis-Cornelius, L.N.; Farmer, S.; Barry, R.J.; Powell, M.L.; Watts, S.A. Influence of Commercial and Laboratory Diets on Growth, Body Composition, and Reproduction in the Zebrafish Danio Rerio. Zebrafish 2019, 16, 508–521. [Google Scholar] [CrossRef] [PubMed]
- Dwyer, K.S.; Parrish, C.C.; Brown, J.A. Lipid Composition of Yellowtail Flounder (Limanda ferruginea) in Relation to Dietary Lipid Intake. Mar. Biol. 2003, 143, 659–667. [Google Scholar] [CrossRef]
- Awad, E.; Awaad, A. Role of Medicinal Plants on Growth Performance and Immune Status in Fish. Fish Shellfish Immunol. 2017, 67, 40–54. [Google Scholar] [CrossRef] [PubMed]
- Lillehoj, H.; Liu, Y.; Calsamiglia, S.; Fernandez-Miyakawa, M.E.; Chi, F.; Cravens, R.L.; Oh, S.; Gay, C.G. Phytochemicals as Antibiotic Alternatives to Promote Growth and Enhance Host Health. Vet. Res. 2018, 49, 76. [Google Scholar] [CrossRef] [PubMed]
- Qian, Y.C.; Wang, X.; Ren, J.; Wang, J.; Limbu, S.M.; Li, R.X.; Zhou, W.H.; Qiao, F.; Zhang, M.L.; Du, Z.Y. Different Effects of Two Dietary Levels of Tea Polyphenols on the Lipid Deposition, Immunity and Antioxidant Capacity of Juvenile GIFT Tilapia (Oreochromis niloticus) Fed a High-Fat Diet. Aquaculture 2021, 542, 736896. [Google Scholar] [CrossRef]
- Deng, H.C.; Yue, H.M.; Ruan, R.; Ye, H.; Li, Z.; Li, C.J. Dietary Epigallocatechin-3-Gallate (EGCG) Improves Nonspecific Immune Response of Chinese Rice Field Eel (Monopterus albus). Aquac. Nutr. 2023, 2023, 6512136. [Google Scholar] [CrossRef]
- Qin, M.; Wang, Z.G.; Liang, M.Z.; Sha, Y.F.; Liu, M.X.; Liu, J.W.; Wang, T.; Zhao, C.X.; Wang, Z.X.; Guo, D.T.; et al. Effects of Dietary Supplementation with Tea Polyphenols and Probiotics on Laying Performance, Biochemical Parameters Intestinal Morphology and Microflora of Laying Hens. Int. J. Biol. Macromol. 2024, 256, 128368. [Google Scholar] [CrossRef]
- Ji, R.L.; Li, Y.C.; Li, X.S.; Xiang, X.J.; Li, Y.N.; Zhu, S.; Yang, B.; Zhang, Y.J.; Mai, K.S.; Ai, Q.H. Effects of Dietary Tea Polyphenols on Growth, Biochemical and Antioxidant Responses, Fatty Acid Composition and Expression of Lipid Metabolism Related Genes of Large Yellow Croaker (Larimichthys crocea). Aquac. Res. 2018, 49, 1210–1218. [Google Scholar] [CrossRef]
- Zhang, C.Y.; Yao, W.X.; Li, X.Q.; Duan, Z.P.; Dang, J.Y.; Cao, K.L.; Leng, X.J. Dietary Emulsifier and Antioxidant Improved Astaxanthin Utilization and Antioxidant Capacity of Rainbow Trout (Oncorhynchus mykiss). Aquac. Nutr. 2021, 27, 2416–2426. [Google Scholar] [CrossRef]
- Zhang, Y.B.P.; Zhou, Y.B.; Sang, B.Y.; Wan, X.C.; Yang, Y.O.; Zhang, J.L.; Welker, T.L.; Liu, K.S. Effect of Dietary Chinese Tea on Growth Performance, Disease Resistance and Muscle Fatty Acid Profile of Channel Catfish (Ictalurus punctatus). Aquac. Int. 2015, 23, 683–698. [Google Scholar] [CrossRef]
- Zhang, Y.R.; Gao, K.D.; Ren, Y.; Zhang, J.M.; Lu, R.H.; Cao, X.L.; Yang, L.P.; Xu, X.X.; Nie, G.X. Broken Xinyang Maojian Tea Supplementation in a High-Fat Diet Improves the Growth Performance, Flesh Quality and Lipid Metabolism of Yellow River Carp (Cyprinus carpio). Aquac. Rep. 2022, 25, 101236. [Google Scholar] [CrossRef]
- Rizwan, M.; Yang, Y.O.; Wan, X.C.; Khan, I.M.; Li, D.X.; Yue, D.D.; Zhong, J.; Huang, S.J. A Transcriptome Analysis Focusing on Growth Performance and Lipid Metabolism-related Genes of Grass Carp (Ctenopharyngodon idella) Fed with Tea Polyphenols Basal Diets. Aquac. Res. 2021, 52, 5044–5055. [Google Scholar] [CrossRef]
- He, Q.; Lv, Y.P.; Yao, K. Effects of Tea Polyphenols on the Activities of α-Amylase, Pepsin, Trypsin and Lipase. Food Chem. 2007, 101, 1178–1182. [Google Scholar] [CrossRef]
- Hossain, M.S.; Small, B.C.; Kumar, V.; Hardy, R. Utilization of Functional Feed Additives to Produce Cost-Effective, Ecofriendly Aquafeeds High in Plant-Based Ingredients. Rev. Aquac. 2024, 16, 121–153. [Google Scholar] [CrossRef]
- Zhang, Q.S.; Yang, H.W.; Teame, T.; Ran, C.; Yang, Y.L.; Yao, Y.Y.; Ding, Q.W.; Liu, S.B.; Li, S.K.; Zhang, Z.; et al. Immune Disorders Induced by Improper Use of Dietary Immunostimulants in Aquatic Animals: Research Progress and Prospective Solutions by Targeting Gut Microbiota. Rev. Aquac. 2024, 16, 608–621. [Google Scholar] [CrossRef]
- Liao, H.P.; Liu, P.Q.; Deng, Y.Y.; Zhang, W.Q.; Pan, C.G.; Jia, Y.M.; Long, F.P.; Tang, H.J. Feeding Effects of Low-Level Fish Meal Replacement by Algal Meals of Schizochytrium limacinum and Nannochloropsis salina on Largemouth Bass (Micropterus salmoides). Aquaculture 2022, 557, 738311. [Google Scholar] [CrossRef]
- Zhang, W.Q.; Deng, Y.Y.; Yang, Z.X.; Kong, Q.; Liu, P.Q.; Liao, H.P.; Tang, H.J. Effects of Partial Replacement of Fishmeal with Spirulina platensis Powder and Addition of Spirulina platensis Polysaccharide on Growth, Nutrition, Antioxidant Capacity and Gut Microbiota of Micropterus salmoides. Aquaculture 2024, 586, 740802. [Google Scholar] [CrossRef]
- Kou, H.Y.; Liu, X.T.; Hu, J.R.; Lin, G.; Zhang, Y.F.; Lin, L. Impact of Dietary Zinc on the Growth Performance, Histopathological Analysis, Antioxidant Capability, and Inflammatory Response of Largemouth Bass Micropterus salmoides. Fish Shellfish Immunol. 2023, 141, 109025. [Google Scholar] [CrossRef]
- Liu, X.; Deng, H.Y.; Xu, Q.Q.; Luo, K.; Zhou, J.; Gao, W.H.; Wang, Z.D.; Zhang, H.T.; Zhou, X.Q. Effects of Tea Tree Essential Oil Supplementation in Low Fish Meal Diet on Growth, Lipid Metabolism, Anti-Oxidant Capacity and Immunity of Largemouth Bass (Micropterus salmoides). Aquac. Rep. 2022, 27, 101380. [Google Scholar] [CrossRef]
- Liu, H.L.; Chen, B.P.; Cao, Y.H.; Geng, Y.; Ouyang, P.; Chen, D.F.; Li, L.Y.; Huang, X.L. High Starch Diets Attenuate the Immune Function of Micropterus salmoides Immune Organs by Modulating Keap1/Nrf2 and MAPK Signaling Pathways. Fish Shellfish Immunol. 2023, 142, 109079. [Google Scholar] [CrossRef]
- Li, S.L.; Dai, M.; Qiu, H.J.; Chen, N. Effects of Fishmeal Replacement with Composite Mixture of Shrimp Hydrolysate and Plant Proteins on Growth Performance, Feed Utilization, and Target of Rapamycin Pathway in Largemouth Bass, Micropterus salmoides. Aquaculture 2021, 533, 736185. [Google Scholar] [CrossRef]
- Zhao, X.Q.; Li, L.L.; Li, C.J.; Liu, E.G.; Zhu, H.; Ling, Q.F. Heat Stress-Induced Endoplasmic Reticulum Stress Promotes Liver Apoptosis in Largemouth Bass (Micropterus salmoides). Aquaculture 2022, 546, 737401. [Google Scholar] [CrossRef]
- Yuan, X.C.; Chen, F.; Yue, D.D.; Xie, S.Q.; Huang, S.J.; Jin, S.Z.; Chen, H.T.; Yang, Y.O. Tea Polyphenols Act as a Natural Antihyperglycemic Feed Additive Candidate in Grass Carp (Ctenopharyngodon idella). Aquac. Nutr. 2021, 27, 2712–2725. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Liu, C.W.; Fang, W.W.; Tang, Q.Q.; Zhan, L.; Shi, Y.; Tang, M.G.; Liu, Z.H.; Zhang, S.; Liu, A.L. Research Progress on the Lipid-Lowering and Weight Loss Effects of Tea and the Mechanism of Its Functional Components. J. Nutr. Biochem. 2023, 112, 109210. [Google Scholar] [CrossRef]
- Ma, D.M.; Fan, J.J.; Zhu, H.P.; Su, H.H.; Jiang, P.; Yu, L.Y.; Liao, G.L.; Bai, J.J. Histologic Examination and Transcriptome Analysis Uncovered Liver Damage in Largemouth Bass from Formulated Diets. Aquaculture 2020, 526, 735329. [Google Scholar] [CrossRef]
- Wang, D.X.; Gao, Q.; Wang, T.T.; Kan, Z.P.; Li, X.; Hu, L.Z.; Peng, C.Y.; Qian, F.; Wang, Y.J.; Granato, D. Green Tea Polyphenols and Epigallocatechin-3-Gallate Protect against Perfluorodecanoic Acid Induced Liver Damage and Inflammation in Mice by Inhibiting NLRP3 Inflammasome Activation. Food Res. Int. 2020, 127, 108628. [Google Scholar] [CrossRef]
- Ye, L.X.; Ding, X.Y.; Liu, C.Q.; Ruan, F.K.; Zhong, H.B.; Lv, R.F.; Yu, Y.; He, C.Y.; Zuo, Z.H.; Huang, J.Y. The Hepatoprotective Effects of Herbt Tea Essences on Phenanthrene-Induced Liver Damage in Mice. Ecotoxicol. Environ. Saf. 2023, 256, 114899. [Google Scholar] [CrossRef]
- Ikarashi, N.; Ogawa, S.; Hirobe, R.; Kon, R.; Kusunoki, Y.; Yamashita, M.; Mizukami, N.; Kaneko, M.; Wakui, N.; Machida, Y.; et al. Epigallocatechin Gallate Induces a Hepatospecific Decrease in the CYP3A Expression Level by Altering Intestinal Flora. Eur. J. Pharm. Sci. 2017, 100, 211–218. [Google Scholar] [CrossRef]
- Zhao, Z.X.; Yang, Q.H.; Tan, B.P.; Lin, H.X.; Yi, Y.M. Effects of Dietary Tea Polyphenols on Intestinal Microflora and Metabonomics in Juvenile Hybrid Sturgeon (Acipenser baerii ♀ × A. schrenckii ♂). Aquac. Rep. 2024, 35, 102020. [Google Scholar] [CrossRef]
- Torrecillas, S.; Montero, D.; Caballero, M.J.; Robaina, L.; Zamorano, M.J.; Sweetman, J.; Izquierdo, M. Effects of Dietary Concentrated Mannan Oligosaccharides Supplementation on Growth, Gut Mucosal Immune System and Liver Lipid Metabolism of European Sea Bass (Dicentrarchus labrax) Juveniles. Fish Shellfish Immunol. 2015, 42, 508–516. [Google Scholar] [CrossRef]
- Ma, Y.B.; Jiang, W.D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Zhou, X.Q.; Feng, L. Tea Polyphenol Alleviate Aeromonas hydrophila—Induced Intestinal Physical Barrier Damage in Grass Carp (Ctenopharyngodon idella). Aquaculture 2021, 544, 737067. [Google Scholar] [CrossRef]
- Jin, Y.Q.; Meng, S.L.; Xu, H.M.; Song, C.; Fan, L.M.; Qiu, L.P.; Li, D.D. Responses of Digestive, Antioxidant, Immunological and Metabolic Enzymes in the Intestines and Liver of Largemouth Bass (Micropterus salmoides) under the Biofloc Model. Antioxidants 2024, 13, 736. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.Z.; Liu, Y.; Qin, G.C.; Wei, C.; Li, Y.M.; Cui, L.; Tian, X.L. Evaluation of Regulatory Capacity of Three Lactic Acid Bacteria on the Growth Performance, Non-Specific Immunity, and Intestinal Microbiota of the Sea Cucumber Apostichopus japonicus. Aquaculture 2024, 579, 740156. [Google Scholar] [CrossRef]
- Wang, H.Q.; Zhang, Z.M.; Li, F.L.; Hu, L.; Xiao, T.Y.; Zhao, Y.R.; Yang, M.X. The Effects of Dietary Fermented Soybean Residue on the Growth, Antioxidant Capacity, Digestive Enzyme Activities, and Microbial Compositions of the Intestine in Furong Crucian Carp (Furong Carp ♀ × Red Crucian Carp ♂). Fishes 2024, 9, 138. [Google Scholar] [CrossRef]
- Del Rio, D.; Stewart, A.J.; Pellegrini, N. A Review of Recent Studies on Malondialdehyde as Toxic Molecule and Biological Marker of Oxidative Stress. Nutr. Metab. Cardiovasc. Dis. 2005, 15, 316–328. [Google Scholar] [CrossRef]
- Ma, Y.B.; Zhou, X.Q.; Jiang, W.D.; Wu, P.; Liu, Y.; Li, S.W.; Tang, L.; Zhang, L.; Mi, H.F.; Feng, L. Tea Polyphenols Protect against Flavobacterium columnare-Induced Gill Injury via Suppression of Oxidative Stress, Inflammation, and Apoptosis in Grass Carp. Int. J. Biol. Macromol. 2024, 254, 127050. [Google Scholar] [CrossRef]
- Perron, N.R.; Brumaghim, J.L. A Review of the Antioxidant Mechanisms of Polyphenol Compounds Related to Iron Binding. Cell Biochem. Biophys. 2009, 53, 75–100. [Google Scholar] [CrossRef]
- Xiong, C.Y.; Chi, Y.Y.; Wang, B.; Yi, J.H.; Yu, Y.Y.; Li, Y.; Ye, H.; Yin, J.Y.; Wu, R.H. Diet with Optimal Glutathione Supplement Improves Growth, Nonspecific Immunity, Intestinal Microbiota, and Antioxidant Ability in Micropterus salmoides. J. Fish Biol. 2024, 104, 1566–1578. [Google Scholar] [CrossRef]
- Giuliani, M.E.; Regoli, F. Identification of the Nrf2–Keap1 Pathway in the European Eel Anguilla anguilla: Role for a Transcriptional Regulation of Antioxidant Genes in Aquatic Organisms. Aquat. Toxicol. 2014, 150, 117–123. [Google Scholar] [CrossRef]
- Ming, J.H.; Ye, J.Y.; Zhang, Y.X.; Xu, Q.Y.; Yang, X.; Shao, X.P.; Qiang, J.; Xu, P. Optimal Dietary Curcumin Improved Growth Performance, and Modulated Innate Immunity, Antioxidant Capacity and Related Genes Expression of NF-κB and Nrf2 Signaling Pathways in Grass Carp (Ctenopharyngodon idella) after Infection with Aeromonas hydrophila. Fish Shellfish Immunol. 2020, 97, 540–553. [Google Scholar] [CrossRef]
- Wang, D.X.; Wang, T.T.; Li, Z.M.; Guo, Y.X.; Granato, D. Green Tea Polyphenols Upregulate the Nrf2 Signaling Pathway and Suppress Oxidative Stress and Inflammation Markers in D-Galactose-Induced Liver Aging in Mice. Front. Nutr. 2022, 9, 836112. [Google Scholar] [CrossRef] [PubMed]
- Sun, F.Y.; Peatman, E.; Li, C.; Liu, S.K.; Jiang, Y.L.; Zhou, Z.C.; Liu, Z.J. Transcriptomic Signatures of Attachment, NF-κB Suppression and IFN Stimulation in the Catfish Gill Following Columnaris Bacterial Infection. Dev. Comp. Immunol. 2012, 38, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.W.; Zhang, P.J.; Yue, X.Y.; Du, X.Y.; Li, W.; Yin, Y.L.; Yi, C.; Li, Y.H. Effect of Sub-Chronic Exposure to Lead (Pb) and Bacillus subtilis on Carassius auratus gibelio: Bioaccumulation, Antioxidant Responses and Immune Responses. Ecotoxicol. Environ. Saf. 2018, 161, 755–762. [Google Scholar] [CrossRef] [PubMed]
- Nootash, S.; Sheikhzadeh, N.; Baradaran, B.; Oushani, A.K.; Moghadam, M.R.M.; Nofouzi, K.; Monfaredan, A.; Aghebati, L.; Zare, F.; Shabanzadeh, S. Green Tea (Camellia sinensis) Administration Induces Expression of Immune Relevant Genes and Biochemical Parameters in Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2013, 35, 1916–1923. [Google Scholar] [CrossRef]
- Han, S.L.; Wang, J.; Li, L.Y.; Lu, D.L.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y. The Regulation of Rapamycin on Nutrient Metabolism in Nile Tilapia Fed with High-Energy Diet. Aquaculture 2020, 520, 734975. [Google Scholar] [CrossRef]
- Yang, H.; Rahman, M.M.; Li, X.Q.; Sharifuzzaman, S.M.; Leng, X.J. Dietary Leucine Requirement of Juvenile Largemouth Bass (Micropterus salmoides) Based on Growth, Nutrient Utilization and Growth-Related Gene Analyses. Aquaculture 2022, 555, 738207. [Google Scholar] [CrossRef]
- Yang, M.; Pan, T.S.; Li, T.; Duan, G.Q.; Jiang, H.; Ling, J. The Effects of Dietary L-Theanine on the Growth Performance, Non-Specific Immunity, Antioxidant Status, and Intestinal Microflora of Female Chinese Mitten Crabs (Eriocheir sinensis). Aquac. Rep. 2024, 34, 101923. [Google Scholar] [CrossRef]
- Wei, Y.H.; Ma, X.; Zhao, J.C.; Wang, X.Q.; Gao, C.Q. Succinate Metabolism and Its Regulation of Host-Microbe Interactions. Gut Microbes 2023, 15, 2190300. [Google Scholar] [CrossRef]
- Neu, J.; Douglas-Escobar, M.; Lopez, M. Microbes and the Developing Gastrointestinal Tract. Nutr. Clin. Pract. 2007, 22, 174–182. [Google Scholar] [CrossRef]
- Chai, Y.Q.; Sun, S.H.; Li, Y.D. Assessing the Effects of Dietary Tea Polyphenols on the Gut Microbiota of Loaches (Paramisgurnus dabryanus) under Chronic Ammonia Nitrogen Stress. Fishes 2024, 9, 180. [Google Scholar] [CrossRef]
- Chen, S.W.; Jiang, X.L.; Liu, N.; Ren, M.C.; Wang, Z.J.; Li, M.K.; Chen, N.S.; Li, S.L. Effects of Dietary Berberine Hydrochloride Inclusion on Growth, Antioxidant Capacity, Glucose Metabolism and Intestinal Microbiome of Largemouth Bass (Micropterus salmoides). Aquaculture 2022, 552, 738023. [Google Scholar] [CrossRef]
- Liu, Y.; Huang, H.J.; Fan, J.T.; Zhou, H.; Zhang, Y.M.; Cao, Y.X.; Jiang, W.; Zhang, W.; Deng, J.M.; Tan, B.P. Effects of Dietary Non-Starch Polysaccharides Level on the Growth, Intestinal Flora and Intestinal Health of Juvenile Largemouth Bass Micropterus salmoides. Aquaculture 2022, 557, 738343. [Google Scholar] [CrossRef]
- Castañeda-Monsalve, V.A.; Junca, H.; García-Bonilla, E.; Montoya-Campuzano, O.I.; Moreno-Herrera, C.X. Characterization of the Gastrointestinal Bacterial Microbiome of Farmed Juvenile and Adult White Cachama (Piaractus brachypomus). Aquaculture 2019, 512, 734325. [Google Scholar] [CrossRef]
- Boachie, J. The Role of Vitamin B12 Deficiency on Hepatic Metabolism of Lipids. Ph.D. Thesis, University of Warwick, Coventry, UK, 2019. [Google Scholar]
- Martens, E.C.; Koropatkin, N.M.; Smith, T.J.; Gordon, J.I. Complex Glycan Catabolism by the Human Gut Microbiota: The Bacteroidetes Sus-like Paradigm. J. Biol. Chem. 2009, 284, 24673–24677. [Google Scholar] [CrossRef]
- Li, X.M.; Yan, Q.Y.; Xie, S.Q.; Hu, W.; Yu, Y.H.; Hu, Z.H. Gut Microbiota Contributes to the Growth of Fast-Growing Transgenic Common Carp (Cyprinus carpio L.). PLoS ONE 2013, 8, e64577. [Google Scholar] [CrossRef]
- Magne, F.; Gotteland, M.; Gauthier, L.; Zazueta, A.; Pesoa, S.; Navarrete, P.; Balamurugan, R. The Firmicutes/Bacteroidetes Ratio: A Relevant Marker of Gut Dysbiosis in Obese Patients? Nutrients 2020, 12, 1474. [Google Scholar] [CrossRef]
- Pérez-Burillo, S.; Navajas-Porras, B.; López-Maldonado, A.; Hinojosa-Nogueira, D.; Pastoriza, S.; Rufián-Henares, J.Á. Green Tea and Its Relation to Human Gut Microbiome. Molecules 2021, 26, 3907. [Google Scholar] [CrossRef]
- Farag, M.A.; Abdelwareth, A.; Sallam, I.E.; El Shorbagi, M.; Jehmlich, N.; Fritz-Wallace, K.; Schäpe, S.S.; Rolle-Kampczyk, U.; Ehrlich, A.; Wessjohann, L.A.; et al. Metabolomics Reveals Impact of Seven Functional Foods on Metabolic Pathways in a Gut Microbiota Model. J. Adv. Res. 2020, 23, 47–59. [Google Scholar] [CrossRef]
- Lu, X.J.; Liu, J.X.; Zhang, N.S.; Fu, Y.H.; Zhang, Z.C.; Li, Y.X.; Wang, W.Q.; Li, Y.Y.; Shen, P.; Cao, Y.G. Ripened Pu-Erh Tea Extract Protects Mice from Obesity by Modulating Gut Microbiota Composition. J. Agric. Food Chem. 2019, 67, 6978–6994. [Google Scholar] [CrossRef]
- Xu, M.Y.; Yang, K.D.; Zhu, J.J. Monitoring the Diversity and Metabolic Shift of Gut Microbes during Green Tea Feeding in an In Vitro Human Colonic Model. Molecules 2020, 25, 5101. [Google Scholar] [CrossRef]
- Li, J.; Chen, C.F.; Yang, H.; Yang, X.P. Tea Polyphenols Regulate Gut Microbiota Dysbiosis Induced by Antibiotic in Mice. Food Res. Int. 2021, 141, 110153. [Google Scholar] [CrossRef]
- Zhao, Z.X.; Zhao, F.; Cairang, Z.M.; Zhou, Z.; Du, Q.; Wang, J.L.; Zhao, F.; Wang, Q.F.; Li, Z.Y.; Zhang, X.P. Role of Dietary Tea Polyphenols on Growth Performance and Gut Health Benefits in Juvenile Hybrid Sturgeon (Acipenser baerii ♀ × A. schrenckii ♂). Fish Shellfish Immunol. 2023, 139, 108911. [Google Scholar] [CrossRef]
Ingredients (%) | C | TP2 | TP4 | TP8 |
---|---|---|---|---|
Fish meal | 45 | 45 | 45 | 45 |
Fermented soybean meal | 14 | 14 | 14 | 14 |
Corn gluten meal | 10 | 10 | 10 | 10 |
Chicken meal | 5 | 5 | 5 | 5 |
Fish oil | 3 | 3 | 3 | 3 |
Soybean oil | 3 | 3 | 3 | 3 |
High-gluten flour | 15 | 15 | 15 | 15 |
Ca(H2PO4)2 | 1 | 1 | 1 | 1 |
Choline chloride | 0.2 | 0.2 | 0.2 | 0.2 |
Tea polyphenols | 0 | 0.02 | 0.04 | 0.08 |
Bentonite | 1.8 | 1.78 | 1.76 | 1.72 |
Vitamin mineral mixture 1 | 2 | 2 | 2 | 2 |
Total | 100 | 100 | 100 | 100 |
Proximate composition | ||||
Moisture (%) | 6.67 | 7.34 | 5.76 | 7.21 |
Crude protein (%) | 47.79 | 47.91 | 48.36 | 48.67 |
Crude lipid (%) | 6.07 | 7.05 | 6.33 | 6.17 |
Crude ash (%) | 12.69 | 12.45 | 13.39 | 12.05 |
Gene | Forward (5-3′) | Reverse (5-3′) | Source |
---|---|---|---|
Keap1 | GCACCTAACCGTGGAACTCAA | CCAGTTTTAGCCAGTCATTGTTCC | [29] |
Nrf2 | TCACCAAAGACAAGCGTAA | CAGGCAGATTGATAATCATAGA | [30] |
CAT | GTTCCCGTCCTTCATCCACT | CAGGCTCCAGAAGTCCCACA | [29] |
SOD1 | CCCCACAACAAGAATCATGC | TCTCAGCCTTCTCGTGGA | [31] |
TOR | TCAGGACCTCTTCTCATTGGC | CCTCTCCCACCATGTTTCTCT | [32] |
IL-1β | AGCACCCTCGTGTCTGTTG | CAGGTTTCAACTCTGACGCT | [33] |
β-actin | ATCGCCGCACTGGTTGTTGAC | CCTGTTGGCTTTGGGGTTC | [32] |
Growth Performance | C | TP2 | TP4 | TP8 | IF |
---|---|---|---|---|---|
SR (%) | 96.67 ± 1.92 | 95.56 ± 2.22 | 100 ± 0.00 | 96.67 ± 1.92 | 100 ± 0.00 |
IBW (g) | 4.29 ± 0.05 | 4.31 ± 0.08 | 4.29 ± 0.04 | 4.22 ± 0.01 | 4.37 ± 0.02 |
FBW (g) | 37.2 ± 0.9 | 37.9 ± 0.9 | 34.2 ± 1.6 | 34.9 ± 1.0 | 35.5 ± 0.9 |
WGR (%) | 737.0 ± 17.0 | 741.6 ± 33.4 | 696.9 ± 31.6 | 697.9 ± 18.7 | 712.4 ± 22.6 |
SGR (%/day) | 3.79 ± 0.04 | 3.8 ± 0.07 | 3.7 ± 0.07 | 3.71 ± 0.04 | 3.74 ± 0.05 |
FCR | 0.8 ± 0.01 | 0.82 ± 0.02 | 0.79 ± 0.01 | 0.8 ± 0.02 | 0.81 ± 0.03 |
FI (%/day) | 2.18 ± 0.03 | 2.21 ± 0.03 | 2.2 ± 0.04 | 2.16 ± 0.06 | 2.26 ± 0.08 |
Biometric parameters | |||||
CF (g/cm3) | 2.02 b ± 0.08 | 2.29 a ± 0.03 | 2.27 a ± 0.02 | 2.2 a ± 0.04 | 2.17 a ± 0.03 |
VSI (%) | 9.64 a ± 0.10 | 9.37 a ± 0.05 | 9.55 a ± 0.34 | 8.38 b ± 0.33 | 9.43 a ± 0.20 |
HIS (%) | 4.5 a ± 0.12 | 3.94 a ± 0.27 | 4.33 a ± 0.48 | 3.24 b ± 0.23 | 4.07 a ± 0.16 |
Whole body composition | |||||
Moisture (%) | 71.7 b ± 0.0 | 72.1 ab ± 0.5 | 72.7 ab ± 0.8 | 71.9 b ± 0.6 | 75.8 a ± 2.2 |
Crude protein (%) | 17.2 ± 0.5 | 18.2 ± 0.1 | 18.0 ± 0.2 | 18.0 ± 0.1 | 16.2 ± 1.5 |
Crude lipid (%) | 6.74 a ± 0.11 | 6.15 ab ± 0.55 | 5.04 bc ± 0.65 | 4.41 c ± 0.57 | 3.88 c ± 0.25 |
Crude ash (%) | 3.66 ± 0.07 | 3.5 ± 0.28 | 3.8 ± 0.32 | 3.66 ± 0.08 | 3.67 ± 0.82 |
Muscle composition | |||||
Moisture (%) | 77.5 ± 0.2 | 77.2 ± 0.3 | 77.4 ± 0.2 | 77.6 ± 0.1 | 77.3 ± 0.1 |
Crude protein (%) | 19.7 b ± 0.25 | 20.3 a ± 0.03 | 20.0 ab ± 0.0 | 20.1 ab ± 0.1 | 20.2 a ± 0.1 |
Crude lipid (%) | 1.9 a ± 0.06 | 1.98 a ± 0.05 | 1.36 b ± 0.21 | 1.04 b ± 0.13 | 1.24 b ± 0.06 |
Crude ash (%) | 1.31 b ± 0.00 | 1.3 b ± 0.09 | 1.44 ab ± 0.04 | 1.49 a ± 0.04 | 1.43 ab ± 0.01 |
Items | C | TP2 | TP4 | TP8 | IF |
---|---|---|---|---|---|
TG, mmol/L | 10.56 ± 1.2 | 9.71 ± 1.9 | 10.79 ± 0.9 | 7.95 ± 0.7 | 10.51 ± 1.6 |
CHO, mmol/L | 11.86 a ± 0.2 | 11.12 ab ± 0.6 | 11.05 ab ± 0.6 | 10.21 b ± 0.3 | 11.73 a ± 0.1 |
HDL, mmol/L | 4.94 ± 0.1 | 4.64 ± 0.2 | 4.42 ± 0.3 | 4.71 ± 0.1 | 4.92 ± 0.2 |
LDL, mmol/L | 2.56 a ± 0.2 | 2.29 ab ± 0.3 | 2.43 ab ± 0.2 | 1.85 b ± 0.1 | 2.33 ab ± 0.2 |
ALT, U/L | 14.01 ± 4.2 | 20.76 ± 1.3 | 17.15 ± 2.1 | 14.54 ± 0.7 | 19.33 ± 2.9 |
AST, U/L | 83.89 ± 8.9 | 74.51 ± 7.9 | 73.46 ± 7.9 | 66.44 ± 5.5 | 71.79 ± 9.8 |
ACP, U/L | 8.85 b ± 0.23 | 10.27 a ± 0.36 | 9.63 ab ± 0.03 | 8.94 b ± 0.27 | 9.24 b ± 0.45 |
ALP, U/L | 251.98 ± 18.8 | 194.46 ± 22.3 | 202.5 ± 13.0 | 246.21 ± 12.4 | 232.49 ± 15.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Z.; Su, Q.; Yang, J.; Li, Z.; Lan, S.; Jia, X.; Ouyang, P.; Tang, H. Effects of Dietary Tea Polyphenols on the Growth, Antioxidant Status, Immune Function, and Intestinal Microbiota of Largemouth Bass (Micropterus salmoides). Animals 2025, 15, 222. https://doi.org/10.3390/ani15020222
Yang Z, Su Q, Yang J, Li Z, Lan S, Jia X, Ouyang P, Tang H. Effects of Dietary Tea Polyphenols on the Growth, Antioxidant Status, Immune Function, and Intestinal Microbiota of Largemouth Bass (Micropterus salmoides). Animals. 2025; 15(2):222. https://doi.org/10.3390/ani15020222
Chicago/Turabian StyleYang, Zixin, Qiuwen Su, Jiafa Yang, Zhijun Li, Shanren Lan, Xu Jia, Paihuai Ouyang, and Huijuan Tang. 2025. "Effects of Dietary Tea Polyphenols on the Growth, Antioxidant Status, Immune Function, and Intestinal Microbiota of Largemouth Bass (Micropterus salmoides)" Animals 15, no. 2: 222. https://doi.org/10.3390/ani15020222
APA StyleYang, Z., Su, Q., Yang, J., Li, Z., Lan, S., Jia, X., Ouyang, P., & Tang, H. (2025). Effects of Dietary Tea Polyphenols on the Growth, Antioxidant Status, Immune Function, and Intestinal Microbiota of Largemouth Bass (Micropterus salmoides). Animals, 15(2), 222. https://doi.org/10.3390/ani15020222