Next Article in Journal
Optimizing Enzymatic Pretreatment of Wet-Grade Maize Distiller’s Dried Grains with Solubles and Maize Germ Meal for Enhanced Metabolizable Energy Utilization in Broilers
Previous Article in Journal
Voluntary Additional Welfare Monitoring of Farm Animals Used in Research: Maximising Benefits Requires Sustained Support
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 19
10.3390/ani15192818
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Influence of the Dietary Lipid Level on Growth Performance, Lipid Metabolism, Oxidative Response and Hepatopancreatic Health in Macrobrachium rosenbergii

by
Haoyue Guo
1,
Jie Xu
1,
Kangyu Deng
2,
Anran Wang
1,
Chungui Huang
3,
Min Zhang
3,
Deng Deng
2,
Huangen Chen
3 and
Shuyan Miao
1,*
1
College of Animal Science and Technology, Yangzhou University, 48 Wenhui East Road, Yangzhou 225009, China
2
Shenzhen Alpha Feed Co., Ltd., 10E, Haiwang Building, Nanhai Avenue, Nanshan District, Shenzhen 518054, China
3
Jiangsu Fishery Technology Promotion Center, 302 Hanzhongmen Street, Gulou District, Nanjing 210003, China
*
Author to whom correspondence should be addressed.
Animals 2025, 15(19), 2818; https://doi.org/10.3390/ani15192818
Submission received: 31 August 2025 / Revised: 21 September 2025 / Accepted: 23 September 2025 / Published: 26 September 2025
(This article belongs to the Section Animal Physiology)
Browse Figures
Versions Notes

Simple Summary

Although the input of high-fat feed is a nutritional guarantee for the good growth of prawns under high-density farming, excessive lipid intake may have a negative impact on the hepatopancreas health. This study aims to investigate the effects of dietary lipid levels on the growth, oxidative stress and hepatopancreatic health of Macrobrachium rosenbergii under high-density rearing conditions (70 prawns/m3). The results of this research suggest that a dietary lipid level of 8% is beneficial for promoting growth rates, increasing antioxidant capabilities, stimulating the immune system, and preserving the physiological homeostasis of prawns; however, excessive lipid levels have been shown to adversely affect hepatopancreatic functionality by inhibiting the degradation and transportation of lipids. These findings provide data support for the precise nutritional requirements and technical guidance of efficient breeding of Macrobrachium rosenbergii.

Abstract

This study examined how the dietary lipid levels influence growth performance, lipid metabolism, oxidative response and hepatopancreatic health in Macrobrachium rosenbergii. A total of 720 post-larvae (0.86 ± 0.01 g) were divided into 4 groups according to the lipid levels in 43% protein-contained diets: 6% (L6), 8% (L8), 10% (L10), and 12% (L12). The results exhibited a significant increase in both the weight gain rate (WGR) and specific growth rate (SGR) in the L8 group (p < 0.05). Hepatopancreatic lipid metabolism genes (fas, acc, srebp1, and fabp) showed increased expression at higher dietary lipid levels (p < 0.05). The expression of ampk was significantly reduced, whereas the expression of atgl was increased in the L8 group (p < 0.05). Additionally, the activities of total superoxide dismutase (SOD), glutathione S-transferase (GST), and total antioxidant capacity (T-AOC) level were significantly higher in the L8 group, while the content of malondinaldehyde (MDA) was significantly reduced (p < 0.05). H&E staining of the hepatopancreas revealed that high-lipid diets resulted in severe hepatopancreas damage. Moreover, the L8 group exhibited consistently high cumulative survival rates under both ammonia nitrogen and high-temperature stress (p < 0.05). In conclusion, this study recommends a dietary lipid level of 8% to optimize growth performance in M. rosenbergii under high-density rearing conditions (70 prawns/m3).

1. Introduction

Macrobrachium rosenbergii is a key aquaculture species in China, prized for its palatable and nutrient-rich meat [1]. Annual production of M. rosenbergii has increased steadily, indicating its substantial market demand and economic value. It is evident that M. rosenbergii farmers aim to increase profitability by decreasing breeding costs and increasing breeding output through the optimization of feed formulations and increases in feed conversion rates [2,3].
Aquatic animals rely heavily on lipids as essential nutrients, which play indispensable roles in various physiological processes [4]. Under these circumstances, lipid intake has emerged as a critical area for exploration [5]. Appropriate lipid intake provides necessary energy and nutrition [6], improves feed palatability and increases feed consumption [7], potentially resulting in greater farming benefits. However, significant discrepancies exist in the current research regarding the optimal dietary lipid requirement of M. rosenbergii. Specifically, the optimal lipid requirement for the postlarval stage of this prawn is reported to be 8–10% [8,9], while that for the adult stage ranges from 6 to 9% [10,11]. Generally, the requirement of dietary lipid depends on many factors, including the culture models and water quality indexes, which make precision nutrition research necessary. Jiangsu, as the main production area, adopts a unique high-density aquaculture model. Taking Gaoyou area as an example, the traditional pond aquaculture density reaches 1.05 to 1.8 million prawns per hectare (about 70 to 120 prawns/m3), which is much higher than that of production areas such as Guangdong and Thailand (typically 50 prawns/m3) [12]. To maintain rapid growth under high-density stress, high-protein nutrient-intensive feed is commonly used in aquaculture. In our previous research, it was demonstrated that the appropriate protein level in high-density mode is 42.5%. Excessive lipid intake amid high-density rearing stress may adversely affect prawn health, inducing oxidative stress and hepatopancreatic damage [13,14]. In this mode, the precise lipid requirement of M. rosenbergii become the focus of our research.
This study therefore investigated the effects of dietary lipid levels on the growth, oxidative stress, and hepatopancreatic health in prawns reared with high-density conditions (70 prawns/m3 was suggested), to provide data support for the precise nutritional requirements for the high efficiency of prawn culture.

2. Materials and Methods

2.1. Diets of the Experimental Groups

The ingredient formulation and nutritional profile of diets are provided in Table 1, and the fatty acid content of the diets is shown in Table 2. The primary protein sources included fish meal, soybean meal, poultry by-product meal, shrimp meal, and peanut meal, while the lipid components were supplied by soybean and fish oil. Four experimental groups were fed diets with different lipid levels: 6% (L6), 8% (L8), 10% (L10) and 12% (L12). All components were crushed and sieved through a 100 μm mesh, and then fully blended with the oil mixture. Then, it was made using a feed pellet machine (South China University of Technology, Guangzhou, China, F-26), dried in a ventilated oven at 45 °C, and stored at −20 °C until use [15].

2.2. Experimental Design and Management of Animals

The experimental M. rosenbergii were provided by the Sufeng Shrimp Factory in Yangzhou City. Before the feeding trial, all prawns were reared in a cement tank inside a greenhouse for a temporary period of 2 weeks. A total of 720 prawns (0.86 ± 0.01 g) were randomly divided into four groups. Each group contained four replicates, and each replicate contained 45 prawns reared in a nylon mesh cage. Prawns were provided with feed twice per day, at 06:30 and 18:30, until they reached satiation. A daily water exchange ranging from 30% to 50% was carried out. Throughout the period, water temperature fluctuated between 25 and 31 °C, while pH values remained within 7.8–8.0. Dissolved oxygen concentrations were kept above 5 mg/L, nitrite nitrogen levels did not exceed 0.1 mg/L, and total ammonia nitrogen was maintained below 0.2 mg/L.

2.3. Specimen Collection and Examination

The prawns were fasted for 24 h after the feeding trial, counted, and weighed. The growth index of prawn was calculated according to the formula listed in 2.6 [16].
For each of the four replicate cages per group, muscle tissue specimens from six prawns per cage were stored at −20 °C to maintain biochemical integrity for subsequent compositional analysis using the AOAC standard method [17]. In this experiment, the content of fatty acids in diets was analyzed by using high performance gas chromatography combined with mass spectrometry (Agilent Technologies, Santa Clara, CA, USA, GC-MS). First, prepare the standard solution, and then extract the fatty acids from the feed. Take 200 mg of the feed sample into a 2 mL centrifuge tube, then add 1 mL of chloroform solution, and extract for 30 min in an ultrasonic environment. Then take the supernatant and add 2 mL of 1% sulfuric acid-methanol solution, add 1 mL of n-hexane, and place it in an 80 °C water bath for extraction for 30 min. Finally, wash with pure water. Finally, 25 μL of methyl salicylate was added as the internal standard, mixed well and then added to the injection bottle for GC-MS detection.
Furthermore, hepatopancreatic samples were collected from five prawns and stored in liquid nitrogen for RNA extraction. We designed the gene-specific primers using Primer Express software v3.0.1 (Table 3). The β-actin gene functioned as the internal reference. Quantitative analysis of transcriptional levels was conducted through real-time PCR, with data normalization and relative quantification performed according to the 2−ΔΔCt computational model [18].
Haemolymph samples were collected from the pericardial sinuses of the prawns. The haemolymph was mixed with an anticoagulant (Sodium citrate 13.2 g/L, citric acid 4.8 g/L, glucose 14.7 g/L) at a 1:1 ratio and then centrifuged to obtain the haemolymph [19].
Commercial kits supplied by Nanjing Jiancheng (China) were used to evaluate various biochemical parameters in the haemolymph and hepatopancreas, including the activities of triglyceride (TG) and total cholesterol (TCHO) in the haemolymph, the activity of glutathione S-transferase (GST), total superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), the total antioxidant capacity (T-AOC) level, the content of malondinaldehyde (MDA), as well as the activity of trypsin and lipase in hepatopancreas [20].

2.4. Histological Evaluation

The hepatopancreases were fixed in 4% neutral buffered formaldehyde and subsequently processed, sectioned, and stained following established protocols [21]. Histological characteristics were examined using biological microscope (Olympus, Tokyo, Japan, BX53).

2.5. Stress Tests

During the feeding trial, samples were collected to assess ammonia nitrogen stress. From each treatment group, 32 prawns (10.59 ± 0.19 g) were randomly allocated into four replicate tanks (10 L; n = 8 prawns/replicate). The prawns were exposed to ammonia nitrogen stress. The concentrations, which were determined according to preliminary tests and LC50 data, were applied to the prawns for a 48 h period [20]. Survival rates were recorded at 12 h intervals.
Finally, the prawns (10.59 ± 0.19 g) were subjected to acute heat stress at 38.5 °C. Each dose group comprised four replicate groups and 8 prawns/replicate. The prawn mortality rate was assessed at 4, 8, 12, 16, 20, and 24 h.

2.6. Statistical Analysis and Calculation Formula

The growth indicators were calculated via the following formula:
Weight gain rate (WGR, %) = 100 × (Wt − Wi)/Wi
Specific growth rate (SGR, %/d) = 100 × (ln Wt − ln Wi)/t
Hepatosomatic index (HSI, %) = 100 × Wh/Wt
Feed conversion ratio (FCR) = F/(Wt − Wi)
Condition factor (CF, %) = 100 × Wt/Lt3
F: weight of feed consumed (g); Wt: final mean weight (g); Lt: final mean length; Wi: initial mean weight (g); t: duration of the feeding trial (d); Wh: hepatopancreas weight (g).
SPSS 27.0 software was used for all the analyses, and the test results are presented as the means ± SD of four replicates. One-way ANOVA and Duncan’s tests were used to compare multiple groups [22]. Differences for p < 0.05 were considered statistically significant.

3. Results

3.1. Growth Performance, Feed Utilization, and the Hepatopancreas Index of M. rosenbergii

Different lipid levels had significant effects on multiple growth parameters and feed utilization in M. rosenbergii (Table 4). Specifically, prawns in the L8 group exhibited significantly greater FW, WGR, and SGR values (p < 0.05). Conversely, the FCR in the L6 group was notably elevated relative to that of the other groups. Additionally, CF of the prawns in the L6 group was significantly lower (p < 0.05).

3.2. Nutritional Composition of Muscles

Results showed that the data revealed no significant differences in the composition of different lipid levels groups (p > 0.05) (Table 5).

3.3. Activity of Hepatopancreatic Digestive Enzymes

Prawns in the L8 group demonstrated significantly higher trypsin activity (p < 0.05) (Figure 1A). Specifically, the L10 group exhibited greater trypsin activity than that of the L6 and L12 groups (p < 0.05). Additionally, the lipase activity of the prawns in groups L6 and L8 significantly increased (p < 0.05) (Figure 1B).

3.4. Haemolymphatic Biochemical Indices

As shown in Figure 2, the findings revealed that increasing dietary lipid levels led to significant increases in the activities of TG and TCHO in the haemolymph of the prawns (p < 0.05). Notably, the L12 group exhibited the highest levels of both TG and TCHO (p < 0.05).

3.5. Expression of Lipid Metabolism-Associated Genes

As shown in Figure 3, the L12 group demonstrated significantly greater expression levels of fas, acc, srebp1, and fabp (p < 0.05). With increasing dietary lipid levels, an increasing trend was observed in the expression of srebp1 and fabp, and the expression of ampk decreased but then increased. The expression of ampk was significantly reduced in the L8 group, whereas the expression of atgl was increased (p < 0.05).

3.6. Antioxidant Capacity

As shown in Figure 4, the L12 group exhibited a statistically significant reduction in the activities of GSH-Px and CAT (p < 0.05). Additionally, the activities of GST and T-SOD were significantly greater in the L8 group (p < 0.05). Furthermore, the content of MDA was significantly lower in both the L8 and L10 groups (p < 0.05). Finally, T-AOC level was significantly increased in the L8 and L10 groups (p < 0.05).

3.7. Histological Examination

H&E staining revealed that the lumen of hepatopancreas in L12 group was significantly enlarged, star-shaped lumen deformed and vacuolated. In contrast, while the hepatopancreas tissues of the L6 and L10 groups showed partial vacuolation, their overall tissue structure remained well-defined and intact, with relatively normal hepatopancreatic morphology and structure. Notably, the hepatopancreas tissues in the L8 group displayed normal star-shaped lumens with clear boundaries and tightly arranged structures, indicating superior preservation of hepatopancreatic morphology and structure (Figure 5).

3.8. Cumulative Survival Rate

The survival curve of M. rosenbergii individuals that were subjected to ammonia nitrogen stress demonstrated notable variations among prawns that were fed different levels of lipids over the 48 h period. The cumulative survival rates of the prawns in the L8 and L10 groups were lower (Figure 6A). The 24-hour mortality rate of prawns under ammonia nitrogen stress in L6 group was significantly increased, while the 48-hour mortality rates of prawns in L8 and L10 group were significantly lower than those in the other groups (p < 0.05) (Table 6).
The cumulative survival rate of the prawns in the L8 group was clearly higher under high-temperature stress (Figure 6B). The 8-hour mortality rate of prawns in L8 and L10 group was significantly reduced under high-temperature stress (p < 0.05). The 20-hour mortality rate of prawns in L8 group was significantly lower than that in the other groups, while the mortality rates of prawns in L6 and L12 group were significantly increased (p < 0.05) (Table 7). Moreover, the expression levels of hsp70 were significantly elevated in the L6 and L8 groups (p < 0.05) (Figure 6C).

4. Discussion

The rapid advancement of aquaculture and the increasing use of precision feeding technology have made reducing feed waste and enhancing environmental sustainability key priorities for many farmers [23]. Precision feeding not only optimizes feed lipid levels but also offers innovative solutions for sustainable farming practices and improved economic returns [24]. The hepatopancreas is a critical digestive gland and immune organ [25,26]. High-fat feeding induces significant lipid accumulation in the hepatopancreas [14,27], leading to steatosis that not only disrupts the organ’s normal structure and function but also can cause cellular dysfunction and apoptosis [28,29]. Conversely, a low-fat diet may not provide enough energy, leading to possible atrophy and cell dysfunction in the hepatopancreas [4]. H&E staining revealed lipid-level-associated vacuolization in the hepatopancreas. This may lead to a series of negative effects, including decreased hepatopancreas immunity [30,31], and digestive function in the prawns.
Above all, antioxidant enzyme activity could be suppressed [32], resulting in the accumulation of free radicals and peroxides within the cells, which in turn trigger immune-regulatory dysfunction [33,34]. GPX and CAT play crucial roles as antioxidant enzymes [35]. Although CAT and GPX participate in different pathways to catalyze the decomposition of hydrogen peroxide, and they work together to maintain the intracellular redox balance [36]. The elevated lipid levels in feed resulted in trends of decreasing GPX and CAT activity; however, this does not mean that lower feed lipid contents can avoid causing hepatopancreatic injury. Moreover, the increase in the GST activity indicated an improvement in the detoxification function of the hepatopancreas [37]. However, the decrease in GST activity suggests that a low-fat diet could cause a decrease in the detoxification function of the hepatopancreas. The antioxidant enzymes of an organism, namely, SOD, GPX and CAT, work in coordination with each other [38,39]. Hydrogen peroxide that is generated by the disproportionation of superoxide anions by SOD can be further decomposed by GPX and CAT, thus eliminating hydrogen peroxide [40]. In addition, hepatopancreatic injury may lead to a decreased T-AOC, reflecting an overall decrease in antioxidant capacity [41,42].
Under intensive M. rosenbergii aquaculture, ammonia nitrogen generated from the decomposition of uneaten feed, feces, and organic matter can easily accumulate to a toxic concentration in the water [43]. In May and June, which is a period of rapid development, water temperatures frequently exceed 33–35 °C, exacerbating the effects of high stocking densities. The mortality rates observed in both anti-stress tests indicated that hepatopancreatic injury may reduce immunity and decrease resistance to environmental factors.
Generally, hepatopancreatic injury can lead to an imbalance in lipid synthesis, degradation and transport [44]. As the extent of hepatopancreatic injury worsened, an increase in the serum contents of TG and TCHO were observed. During hepatopancreatic injury, the reduced expression of atgl may exacerbate lipid metabolism disorders. In addition, the reduced expression of fabp may impair fatty acid transport and triglyceride degradation. In summary, feeding high-fat diet leads to hepatopancreas injury in prawns, which affects the decomposition ability of lipids in the hepatopancreas [45].
Additionally, the hepatopancreas’s capacity to secrete digestive enzymes is also influenced by hepatopancreas injury [46]. The enhanced trypsin activity suggests that moderate lipid supplementation may stimulate digestion through lipid-mediated regulation of hepatopancreatic secretion [47]. However, excess lipids may have an inhibitory effect on the hydrolase system, possibly due to oxidative stress caused by lipid overload [48]. However, lipase synthesis capacity is saturated or negatively feedback regulated under high lipid intake [49]. This result is similar to that study in Litopenaeus vannamei, where high-fat diets promoted hepatopancreatic lipid accumulation, increased inflammatory responses, and inhibited mitochondrial autophagy [14]. Notably, the reduction in enzyme output at slightly higher lipid levels emphasizes the physiological limits of lipid utilization in crustaceans, which may be related to endoplasmic reticulum stress or mitochondrial dysfunction in response to excess lipid supply [50].
The content of all fatty acids in L10 and L12 has increased significantly, and the negative effects of some of these fatty acids will be magnified. The content of C18:2 in group L12 was as high as 34.65 g/kg, which was a huge potential source of oxidative stress. Polyunsaturated fatty acids are highly prone to lipid peroxidation due to the presence of multiple unsaturated double bonds [51], which can lead to the formation of harmful substances. These peroxides can attack the cell membrane, causing damage to mitochondrial function and inducing apoptosis or necrosis of cells [52]. Although the C20:4 content in the feed is not high, a high level of C18:2 can be used as a substrate to be converted into ARA, which may aggravate the inflammatory response and damage the hepatopancreas tissue [53]. Previous studies have shown that C22:1 is toxic to the heart and hepatopancreas [54]. The content of C22:1 in this feed increased from 1.95 g/kg in group L6 to 8.64 g/kg in group L12. A high level of C22:1 is very likely to be an important factor leading to hepatopancreatic injury. The accumulation of excessive free saturated fatty acids within cells can cause lipid toxicity damage to cells [55] and increase the metabolic pressure on the hepatopancreas, and the content of C16:0 in the L12 group is higher than that in other groups. In conclusion, the negative impact of fatty acid composition in feed on the hepatopancreas is consistent with the results of our previous detection indicators.

5. Conclusions

Overall, the results of this research suggest that a dietary lipid level of 8% is beneficial for promoting growth rates, increasing antioxidant capabilities, stimulating the immune system, and preserving the physiological homeostasis of prawns. Moreover, it is recommended that the dietary lipid levels for M. rosenbergii do not surpass 10%, as excessive levels have been shown to adversely affect hepatopancreatic functionality by inhibiting the degradation and transportation of lipids.

Author Contributions

Writing—original draft preparation, H.G.; conceptualization, S.M.; software, C.H.; validation, A.W. and J.X.; project administration, S.M.; methodology, H.G.,H.C.,D.D. and S.M.; formal analysis, H.G., J.X. and K.D.; investigation, M.Z.; resources, S.M.; data curation, H.G. and K.D.; visualization, H.G., J.X. and K.D.; writing—review and editing, A.W.; supervision, A.W., C.H., M.Z., D.D. and H.C.; funding acquisition, S.M. All authors have read and agreed to the published version of the manuscript.

Funding

The Major Agricultural Technology Collaborative Promotion Program funded by the Ministry of Agriculture and Rural Affairs (No. 2023-ZYXT-10) furnished the financial backing for this research.

Institutional Review Board Statement

Subsequent approval was also obtained from the Ethics Committee of Laboratory Animals at the same institution (YZUDWSY 2017-09-06).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data will be supplied when requested.

Conflicts of Interest

Authors Kangyu Deng and Deng Deng were employed by the company Shenzhen Alpha Feed Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Miao, S.Y.; Han, B.; Zhao, C.Z.; Hu, J.T.; Zhu, J.Y.; Zhang, X.; Sun, L.S. Effects of dietary Pediococcus acidilactici GY2 single or combined with Saccharomyces cerevisiae or/and β-glucan on the growth, innate immunity response and disease resistance of Macrobrachium rosenbergii. Fish Shellfish Immunol. 2020, 98, 68–76. [Google Scholar] [CrossRef] [PubMed]
  2. Hooper, C.; Debnath, P.P.; Stentiford, G.D.; Bateman, K.S.; Salin, K.R.; Bass, D. Diseases of the giant river prawn Macrobrachium rosenbergii: A review for a growing industry. Rev. Aquac. 2023, 15, 738–758. [Google Scholar] [CrossRef]
  3. Ma, H.W.; Lv, M.; Lin, Y.; Chen, X.L.; Wang, D.P.; Du, X.S.; Li, J.B. Prawn (Macrobrachium rosenbergii)-plant (Hydrilla verticillata) co-culture system improves water quality, prawn production and economic benefit through stocking density and feeding regime manage. Aquac. Res. 2020, 51, 2169–2178. [Google Scholar] [CrossRef]
  4. Chen, C.; Tian, H.Y.; Liu, X.B.; Dai, Y.S.; Wen, X.B.; Zhao, H.H.; Wu, K. Effects of dietary lipid levels on growth, lipid metabolism, fatty acid composition and antioxidant capacity of juvenile greasyback shrimp (Metapenaeus ensis). Aquac. Rep. 2024, 36, 102146. [Google Scholar] [CrossRef]
  5. Huang, D.; Wu, Y.B.; Lin, Y.Y.; Chen, J.M.; Karrow, N.; Ren, X.; Wang, Y. Dietary Protein and Lipid Requirements for Juvenile Largemouth Bass, Micropterus salmoides. J. World Aquacu. Soc. 2017, 48, 782–790. [Google Scholar] [CrossRef]
  6. Li, S.L.; Yin, J.; Zhang, H.T.; Liu, Z.K.; Chen, N.S. Effects of dietary carbohydrate and lipid levels on growth performance, feed utilization, body composition and non-specific immunity of large yellow croaker (Larimichthys crocea). Aquac. Nutr. 2019, 25, 995–1005. [Google Scholar] [CrossRef]
  7. Elvy, J.E.; Symonds, J.E.; Hilton, Z.; Walker, S.P.; Tremblay, L.A.; Casanovas, P.; Herbert, N.A. The relationship of feed intake, growth, nutrient retention, and oxygen consumption to feed conversion ratio of farmed saltwater Chinook salmon (Oncorhynchus tshawytscha). Aquaculture 2022, 554, 738184. [Google Scholar] [CrossRef]
  8. Felix, N.; Jeyaseelan, M.J.P. Influence of dietary lipid to carbohydrate ratios on the growth and food conversion of postlarvae of Macrobrachium rosenbergii (de Man). Indian J. Fish. 2005, 52, 55–60. [Google Scholar]
  9. Goda, A. Effect of dietary protein and lipid levels and protein-energy ratio on growth indices, feed utilization and body composition of freshwater prawn, Macrobrachium rosenbergii (de Man 1879) post larvae. Aquac. Res. 2008, 39, 891–901. [Google Scholar] [CrossRef]
  10. Sun, L.S.; Wang, H.; Wei, K.; An, Z.H.; Wang, Y.X. Effects of different dietary fat levels on growth and tissue composition of Macrobrachium rosenbergii. Feed Ind. 2012, 33, 28–32. [Google Scholar]
  11. Hari, B.; Kurup, B.M. The Effect of Dietary Lipid Levels on the Nutrition and Growth of Juveniles of Macrobmchium rosenbergii (de Man). Fish. Technol. 2012, 43, 65–72. [Google Scholar]
  12. Uthairat, N.; Orapint, J. Current status & prospects of farming the giant river prawn (Macrobrachium rosenbergii de Man 1879) in Thailand. Aquac. Res. 2012, 43, 959–1063. [Google Scholar] [CrossRef]
  13. Zheng, X.C.; Xu, X.D.; Liu, M.Y.; Yang, J.; Yuan, M.; Sun, C.X.; Zhou, Q.L.; Chen, J.M.; Liu, B. Bile acid and short chain fatty acid metabolism of gut microbiota mediate high-fat diet induced intestinal barrier damage in Macrobrachium rosenbergii. Fish Shellfish Immunol. 2024, 146, 109376. [Google Scholar] [CrossRef] [PubMed]
  14. Dai, T.M.; Lu, J.J.; Tao, X.Y.; Zhang, X.; Li, M.; Jin, M.; Sun, P.; Liu, W.J.; Jiao, L.F.; Zhou, Q.C. Vitamin D3 alleviates high-fat induced hepatopancreas lipid accumulation and inflammation by activating AMPKka/PINK1/Parkin-mediated mitophagy in Litopenaeus vannamei. Aquac. Rep. 2022, 25, 101272. [Google Scholar] [CrossRef]
  15. Zhao, C.Z.; Zhu, J.Y.; Hu, J.T.; Dong, X.J.; Sun, L.S.; Zhang, X.J.; Miao, S.Y. Effects of dietary Bacillus pumilus on growth performance, innate immunity and digestive enzymes of giant freshwater prawns (Macrobrachium rosenbergii). Aquac. Nutr. 2019, 25, 712–720. [Google Scholar] [CrossRef]
  16. Xue, H.B.; Liu, C.; Liu, Y.; Wang, W.N.; Xu, B. Roles of surface layer proteins in the regulation of Pediococcus pentosaceus on growth performance, intestinal microbiota, and resistance to Aeromonas hydrophila in the freshwater prawn Macrobrachium rosenbergii. Aquac. Int. 2021, 29, 1373–1391. [Google Scholar] [CrossRef]
  17. AOAC. Official Methods of Analysis of Official Analytical Chemists International, 16th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1995. [Google Scholar]
  18. Miao, S.Y.; Hu, J.T.; Wan, W.L.; Han, B.; Zhou, Y.C.; Xin, Z.M.; Sun, L.S. Biofloc technology with addition of different carbon sources altered the antibacterial and antioxidant response in Macrobrachium rosenbergii to acute stress. Aquaculture 2020, 525, 735280. [Google Scholar] [CrossRef]
  19. Naksing, T.; Rattanavichai, W.; Teeka, J.; Kaewpa, D.; Borthong, J.; Areesirisuk, A. Biological activities and potential of organic banana (Musa acuminata) peel extract in enhancing the immunity of giant freshwater prawn (Macrobrachium rosenbergii). Aquac. Res. 2022, 53, 2645–2656. [Google Scholar] [CrossRef]
  20. Xu, J.; Deng, K.Y.; Chang, E.H.; Zhang, X.; Fu, Y.; Guo, H.Y.; Wu, Y.H.; Wang, A.R.; Deng, D.; Miao, S.Y. Effects of freshness of poultry by-product meal on the growth performance, immune response, and hepatopancreatic health of Macrobrachium rosenbergii. Aquac. Rep. 2024, 39, 102443. [Google Scholar] [CrossRef]
  21. Liu, X.R.; Wan, W.L.; Li, M.G.; Shi, J.Y.; Xu, J.; Zhou, Z.H.; Wang, A.R.; Miao, S.Y. Dietary Niacin Requirement of Juvenile Chinese Mitten Crab, Eriocheir sinensis. Aquac. Nutr. 2022, 1, 8348000. [Google Scholar] [CrossRef]
  22. Dong, X.J.; Xue, W.; Hua, J.; Hang, Y.; Sun, L.S.; Miao, S.Y.; Wei, W.Z.; Wu, X.S.; Du, X.D. Effects of dietary betaine in allogynogenetic gibel carp (Carassius auratus gibelio): Enhanced growth, reduced lipid deposition and depressed lipogenic gene expression. Aquac. Res. 2018, 49, 1967–1972. [Google Scholar] [CrossRef]
  23. Bu, X.Y.; Li, Y.R.; Lai, W.C.; Yao, C.W.; Liu, Y.T.; Wang, Z.; Zhao, Z.Q.; Han, S.Z.; Du, J.L.; Yao, X.; et al. Innovation and development of the aquaculture nutrition research and feed industry in China. Rev. Aquac. 2024, 16, 759–774. [Google Scholar] [CrossRef]
  24. Bouraoui, Z.; Amri, A.; Jebali, J.; Gharred, T.; Guerbej, H. Effects of dietary lipid reduction on lipid composition, fatty acid profile, plasma lipoproteins and antioxidant status in gilthead seabream (Sparus aurata). J. Appl. Aquac. 2023, 35, 878–895. [Google Scholar] [CrossRef]
  25. Chen, Y.Y.; Pan, P.K.; Wu, Y.S.; Nan, F.H. Transcriptome analysis reveal the effect of freshwater sediments containing 2,3,7,8-tetrachlorodibenzo-p-dioxin on the Macrobrachium rosenbergii hepatopancreas, intestine, and muscle. Fish Shellfish Immunol. 2024, 144, 109297. [Google Scholar]
  26. Peng, X.; Zhong, Z.X.; Zhong, H.; Gong, J.L.; Du, T.T.; Ding, L.; Lan, X.; Tu, H.H.; Tang, Q.Y.; Xia, Z.L.; et al. Histopathological observation and comparative transcriptome analysis reveal immune response mechanisms to Aeromonas dhakensis infection in Macrobrachium rosenbergii. Fish Shellfish Immunol. 2023, 142, 109151. [Google Scholar] [CrossRef]
  27. Cao, H.Q.; Luo, Q.J.; Xie, S.C.; Cui, Y.H.; Zhan, W.H.; Deng, Y.; Peng, H.Y.; Tang, Z.; Tian, Y.Q.; Jin, M.; et al. Vitamin D3 alleviates the damage caused by high-fat and maintains lipid metabolism homeostasis in hepatopancreas by promoting fatty acid β-oxidation of Portunus trituberculatus. Aquac. Rep. 2024, 38, 102320. [Google Scholar] [CrossRef]
  28. Gou, N.N.; Jin, T.Z.; Yang, B.; Wang, K.F. Influences of dietary sodium butyrate on growth, digestion, antioxidant capacity and health in juvenile Onychostoma macrolepis fed on high-fat diet. Aquac. Rep. 2023, 33, 101808. [Google Scholar] [CrossRef]
  29. Liu, G.H.; Yu, H.B.; Wang, C.; Li, P.J.; Liu, S.; Zhang, X.T.; Zhang, C.; Qi, M.; Ji, H. Nano-selenium supplements in high-fat diets relieve hepatopancreas injury and improve survival of grass carp Ctenopharyngodon Idella by reducing lipid deposition. Aquaculture 2021, 538, 736580. [Google Scholar] [CrossRef]
  30. Song, Y.T.; Song, L.F.; Soomro, M.A.; Dong, X.Z.; Hu, G.B. Transcriptome analysis reveals immune-related differentially expressed genes in the hepatopancreas and gills of Penaeus vannamei after Vibrio anguillarum infection. Aquac. Res. 2021, 52, 4303–4316. [Google Scholar] [CrossRef]
  31. Li, Y.M.; Ye, Y.C.; Yuan, H.J.; Li, S.W.; Rihan, N.; Liu, X.G.; Zhao, Y.L.; Che, X. Dietary lipid supplementation alleviated the impacts of polystyrene nanoplastic exposure in Litopenaeus vannamei. Aquat. Toxicol. 2024, 272, 106974. [Google Scholar] [CrossRef]
  32. Fang, H.H.; Zhuang, Z.X.; Huang, L.D.; Zhao, W.; Niu, J. Dietary Klebsormidium sp. Supplementation Improves Growth Performance, Antioxidant and Anti-Inflammatory Status, Metabolism, and Mid-Intestine Morphology of Litopenaeus Vannamei. Front. Nutr. 2022, 9, 857351. [Google Scholar] [CrossRef]
  33. Hou, M.N.; Pang, Y.Y.; Niu, C.; Zhang, D.X.; Zhang, Y.; Liu, Z.Q.; Song, Y.M.; Shi, A.Y.; Chen, Q.; Zhang, J.Y.; et al. Effects of Dietary L-TRP on Immunity, Antioxidant Capacity and Intestinal Microbiota of the Chinese Mitten Crab (Eriocheir sinensis) in Pond Culture. Metabolites 2023, 13, 1. [Google Scholar] [CrossRef] [PubMed]
  34. Zhou, L.; Chu, L.L.; Du, J.L.; Nie, Z.J.; Cao, L.P.; Gao, J.C.; Xu, G.C. Oxidative stress and immune response of hepatopancreas in Chinese mitten crab Eriocheir sinensis under lipopolysaccharide challenge. Comp. Biochem. Phys. C 2023, 263, 109495. [Google Scholar] [CrossRef]
  35. Liu, J.; Du, H.; Liu, T.; Chen, C.; Yan, Y.; Liu, T.Q.; Liu, L.; Wang, E.R. Accurate reflection of hepatopancreas antioxidation and detoxification in Procambarus clarkii during virus infection and drug treatment: Reference gene selection, evaluation and expression analysis. Aquaculture 2022, 556, 738283. [Google Scholar] [CrossRef]
  36. Estrada-Cárdenas, P.; Peregrino-Uriarte, A.B.; Yepiz-Plascencia, G. Glutathione peroxidase 4 knock-down triggers ferroptosis in Penaeus vannamei hepatopancreas during hypoxia and reoxygenation. Fish Shellfish Immunol. 2023, 143, 109201. [Google Scholar] [CrossRef]
  37. Cai, M.L.; Qiu, X.Y.; Zhang, H.J.; Wang, A.M.; Xu, W.C.; Chen, K.J.; He, Z.G.; Hu, Y. Effects of replacing fishmeal with soybean meal on the immune and antioxidant capacity, and intestinal metabolic functions of red swamp crayfish Procambarus clarkii. Fish Shellfish Immunol. 2024, 149, 109600. [Google Scholar] [CrossRef] [PubMed]
  38. Tang, Z.; Xie, S.C.; Cui, Y.H.; Zhan, W.H.; Deng, Y.; Peng, H.Y.; Cao, H.Q.; Tian, Y.Q.; Jin, M.; Sun, P.; et al. Vitamin C as a functional enhancer in the non-specific immune defense, antioxidant capacity and resistance to low-temperature stress of juvenile mud crab, Scylla paramamosain. Fish Shellfish Immunol. 2024, 153, 109834. [Google Scholar] [CrossRef] [PubMed]
  39. Zhang, R.Q.; Shi, X.Y.; Liu, J.S.; Jiang, Y.; Wu, Y.P.; Xu, Y.L.; Yang, C.M. The effects of bamboo leaf flavonoids on growth performance, immunity, antioxidant status, and intestinal microflora of Chinese mitten crabs (Eriocheir sinensis). Anim. Feed Sci. Tech. 2022, 288, 115297. [Google Scholar] [CrossRef]
  40. Ortiz, C.; Müller, L.; Borges, L.; Pinto, L.A.D.; Cadaval, T.R.S., Jr.; Tesser, M.B.; Pedrosa, V.F.; Romano, L.A.; Wasielesky, W.; Ventura-Lima, J. The use of chitosan as an antioxidant in the feed of cultivated P. vannamei shrimp against oxidative stress induced by exposure to microplastics. Mar. Environ. Res. 2024, 202, 106747. [Google Scholar] [CrossRef]
  41. Lu, Y.P.; Zhang, X.X.; Zheng, P.H.; Zhang, Z.L.; Li, J.T.; Wang, D.M.; Xian, J.A.; Wang, A.L.; Wang, L. Effects of air exposure on survival, histological structure, non-specific immunity and gene expression of red claw crayfish (Cherax quadricarinatus). Aquac. Rep. 2021, 21, 100898. [Google Scholar] [CrossRef]
  42. Xie, X.D.; Cao, M.X.; Chen, Q.; Yu, M.L.; Liu, Q.Y.; Zhao, Y.Z.; Zhang, L.; Hu, T.J. Effect of medical herbs in Tian-Dong-Tang-Gan powder on the oxidative stress induced by ammonia and nitrite in Litopenaeus vannamei. Aquaculture 2022, 548, 737584. [Google Scholar] [CrossRef]
  43. Zhuo, H.B.; Lin, L.T.; Zhang, Y.; Fu, S.; Li, J.Y.; Zhou, X.X.; Wu, G.B.; Guo, C.A.; Liu, J.Y. The shrimp NF-κB pathway is activated to mediate the antioxidant defense and apoptosis under ammonia-N stress. Fish Shellfish Immunol. 2025, 161, 110295. [Google Scholar] [CrossRef] [PubMed]
  44. Luo, N.; Ding, Z.L.; Kong, Y.Q.; Zhang, R.F.; Zhang, Y.X.; Wu, C.L.; Jiang, Z.Q.; Ye, J.Y. An evaluation of increasing linolenic acid level in the diet of Macrobrachium nipponense: Lipid deposition, fatty acid composition and expression of lipid metabolism-related genes. Aquac. Nutr. 2018, 24, 758–767. [Google Scholar] [CrossRef]
  45. Araújo, B.C.; Flores-Galvez, K.; Honji, R.M.; Barbosa, V.M.; Viana, M.T.; Tinajero, A.; Mata-Sotres, J.A. Arachidonic acid effects on the overall performance, fatty acid profile, hepatopancreas morphology and lipid-relevant genes in Litopenaeus vannamei juveniles. Aquaculture 2020, 523, 735207. [Google Scholar] [CrossRef]
  46. Liu, H.L.; Feng, Y.; Yang, M.; Huang, Y.; Li, M.H.; Geng, Y.; Ouyang, P.; Chen, D.F.; Yang, S.Y.; Yin, L.Z.; et al. Starvation induces hepatopancreas atrophy in Chinese mitten crab (Eriocheir sinensis) by inhibiting angiogenesis. Bmc Genom. 2023, 24, 612. [Google Scholar] [CrossRef]
  47. Trenzado, C.E.; Carmona, R.; Merino, R.; García-Gallego, M.; Furné, M.; Domezain, A.; Sanz, A. Effect of dietary lipid content and stocking density on digestive enzymes profile and intestinal histology of rainbow trout (Oncorhynchus mykiss). Aquaculture 2018, 497, 10–16. [Google Scholar] [CrossRef]
  48. Furukawa, S.; Fujita, T.; Shimabukuro, M.; Iwaki, M.; Yamada, Y.; Nakajima, Y.; Nakayama, O.; Makishima, M.; Matsuda, M.; Shimomura, I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Investig. 2004, 114, 1752–1761. [Google Scholar] [CrossRef]
  49. Mir, I.N.; Srivastava, P.P.; Bhat, I.A.; Dar, J.Y.; Agarwal, D. Expression profiling of lipolytic and long-chain fatty acid biosynthesis genes in catfish larvae fed with graded lipid levels. Front. Mar. Sci. 2020, 7, 561402. [Google Scholar] [CrossRef]
  50. Zhong, X.Y.; Zeng, L.W.; Cai, Y.N.; Zhu, Y.; Ma, Q.Y.; Shen, O.X.; Song, X.Y.; Zhang, J. Carbon dots induce endoplasmic reticulum stress-mediated lipid dysregulation and embryonic developmental toxicity in zebrafish. Ecotoxicol. Environ. Saf. 2024, 288, 117361. [Google Scholar] [CrossRef]
  51. Michael, S.M.; Jimena, R.; Jennifer, L.W. Polyunsaturated Fatty Acids Drive Lipid Peroxidation during Ferroptosis. Cells 2023, 12, 804. [Google Scholar] [CrossRef]
  52. Liu, Y.; Han, S.L.; Luo, Y.; Li, L.Y.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y. Impaired peroxisomal fat oxidation induces hepatic lipid accumulation and oxidative damage in Nile tilapia. Fish Physiol. Biochem. 2020, 46, 1229–1242. [Google Scholar] [CrossRef] [PubMed]
  53. Jessie, L.B.; Manabu, T.N.; David, W.L.M. Differentiating the biological effects of linoleic acid from arachidonic acid in health and disease. Prostag. Leukotr. Ess. 2018, 135, 1–4. [Google Scholar]
  54. Ma, D.F.; Li, Q.W.; Xie, Y.Y.; Kong, Y.Q.; Ding, Z.L.; Ye, J.Y.; Wu, C.L.; Liu, Y. Dietary Erucic Acid Induces Fat Accumulation, Hepatic Oxidative Damage, and Abnormal Lipid Metabolism in Nile Tilapia (Oreochromis niloticus). Aquac. Nutr. 2024, 1, 6670740. [Google Scholar] [CrossRef]
  55. Liu, W.; Zhu, M.; Gong, M.; Zheng, X.; Zheng, Q.; Li, X.Y.; Fu, F.D.; Chen, Y.Y.; Cheng, J.Q.; Rao, Z.Y.; et al. Comparison of the Effects of Monounsaturated Fatty Acids and Polyunsaturated Fatty Acids on Liver Lipid Disorders in Obese Mice. Nutrients 2023, 15, 3200. [Google Scholar] [CrossRef] [PubMed]
Animals 15 02818 g001
Figure 1. Effects of different lipid levels on hepatopancreas digestive enzymes activities of M. rosenbergii (n = 4). (A) Trypsin activity; (B) Lipase activity. Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Figure 1. Effects of different lipid levels on hepatopancreas digestive enzymes activities of M. rosenbergii (n = 4). (A) Trypsin activity; (B) Lipase activity. Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Animals 15 02818 g001
Animals 15 02818 g002
Figure 2. Effects of different lipid levels on hemolymphatic lipid metabolite parameters of M. rosenbergii (n = 4). (A) Triglyceride (TG); (B) Total cholesterol (TCHO). Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Figure 2. Effects of different lipid levels on hemolymphatic lipid metabolite parameters of M. rosenbergii (n = 4). (A) Triglyceride (TG); (B) Total cholesterol (TCHO). Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Animals 15 02818 g002
Animals 15 02818 g003
Figure 3. Effects of different lipid levels on relative expression of lipid metabolism in hepatopancreas of M. rosenbergii (n = 4). (A) fatty acid synthase (fas); (B) acetyl-CoA carboxylase (acc); (C) sterol regulatory element-binding protein 1 (srebp1); (D) fatty acid binding protein (fabp); (E) adenylate activated protein kinase (ampk); (F) adipose triacylglyceride lipase (atgl). Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Figure 3. Effects of different lipid levels on relative expression of lipid metabolism in hepatopancreas of M. rosenbergii (n = 4). (A) fatty acid synthase (fas); (B) acetyl-CoA carboxylase (acc); (C) sterol regulatory element-binding protein 1 (srebp1); (D) fatty acid binding protein (fabp); (E) adenylate activated protein kinase (ampk); (F) adipose triacylglyceride lipase (atgl). Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Animals 15 02818 g003
Animals 15 02818 g004
Figure 4. Effects of different lipid levels on hepatopancreas antioxidant capacity of M. rosenbergii (n = 4). (A) Glutathione peroxidase (GPx); (B) Glutathione S-transferase (GST); (C) catalase (CAT); (D) Total superoxide dismutase (T-SOD); (E) Malondinaldehyde (MDA); (F) Total antioxidant capacity (T-AOC). Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Figure 4. Effects of different lipid levels on hepatopancreas antioxidant capacity of M. rosenbergii (n = 4). (A) Glutathione peroxidase (GPx); (B) Glutathione S-transferase (GST); (C) catalase (CAT); (D) Total superoxide dismutase (T-SOD); (E) Malondinaldehyde (MDA); (F) Total antioxidant capacity (T-AOC). Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Animals 15 02818 g004
Animals 15 02818 g005
Figure 5. H&E-staining hepatopancreatic tissue sections of prawns under varying lipid levels (magnification × 100). (A) 6% lipid diet; (B) 8% lipid diet; (C) 10% lipid diet; (D) 12% lipid diet. Lumen: Undigested lipid accumulates in the lumen of the hepatic tubules, compressing the structure of the glandular ducts and causing deformation of the lumen. Vacuolation: Triglycerides abnormally accumulate in hepatopancreas cells, forming lipid droplet vacuoles. Boundary: The boundary of a healthy hepatopancreas is a sharp and clear valve-like structure.
Figure 5. H&E-staining hepatopancreatic tissue sections of prawns under varying lipid levels (magnification × 100). (A) 6% lipid diet; (B) 8% lipid diet; (C) 10% lipid diet; (D) 12% lipid diet. Lumen: Undigested lipid accumulates in the lumen of the hepatic tubules, compressing the structure of the glandular ducts and causing deformation of the lumen. Vacuolation: Triglycerides abnormally accumulate in hepatopancreas cells, forming lipid droplet vacuoles. Boundary: The boundary of a healthy hepatopancreas is a sharp and clear valve-like structure.
Animals 15 02818 g005
Animals 15 02818 g006
Figure 6. Impact of dietary lipid levels on M. rosenbergii survival under ammonia-N and high-temperature stress (n = 4). (A) Effects of Ammonia-N stress on the lifespan of M. rosenbergii; (B) Effects of high-temperature stress on the lifespan of M. rosenbergii; (C) Expression of hsp70 in hepatopancreas of M. rosenbergii. Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Figure 6. Impact of dietary lipid levels on M. rosenbergii survival under ammonia-N and high-temperature stress (n = 4). (A) Effects of Ammonia-N stress on the lifespan of M. rosenbergii; (B) Effects of high-temperature stress on the lifespan of M. rosenbergii; (C) Expression of hsp70 in hepatopancreas of M. rosenbergii. Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Animals 15 02818 g006
Table 1. Nutritional formulation and chemical composition profiles of study diets (% DM).
Table 1. Nutritional formulation and chemical composition profiles of study diets (% DM).
Ingredients
(g/100 g)		Groups
L6
(6%)		L8
(8%)		L10
(10%)		L12
(12%)
Soybean meal-43%23.0023.0023.0023.00
Fish meal-Imported Japanese grade-70%16.0016.0016.0016.00
Fish meal-Domestic semi-skimmed-65%12.0012.0012.0012.00
Shrimp meal-61%7.507.507.507.50
Peanut meal-53%5.005.005.005.00
Poultry by-product meal-65%2.002.002.002.00
Squid paste2.002.002.002.00
Wheat flour19.0019.0019.0019.00
Shrimp paste2.002.002.002.00
Soybean lecithin2.502.502.502.50
Ca(H2PO4)21.501.501.501.50
Soybean oil0.001.002.003.00
Fish oil0.001.002.003.00
Choline chloride-60%0.250.250.250.25
Vitamin premix 10.200.200.200.20
Mineral premix 20.200.200.200.20
Vitamin C—phosphatidic0.100.100.100.10
Organic acid0.050.050.050.05
Bentonite6.504.502.500.50
Guar gum0.200.200.200.20
Total100.00100.00100.00100.00
Proximate composition (% dry matter)
Moisture9.739.299.449.59
Crude protein42.8143.1943.0643.00
Crude lipid5.948.069.9712.14
Ash content16.0014.1412.2410.52
1 Vitamin mixture (IU or g/kg): thiamine, 0.5 g; riboflavin, 0.7 g; cyanocobalamin, 0.002 g; menadione, 0.5 g; retinol, 450,000 IU; pyridoxine HCl, 0.6 g; cholecalciferol, 150,000 IU; vitamin E, 5 g; nicotinic acid, 3.5 g; folic acid, 0.15 g; biotin, 0.060 g. 2 Mineral mixture (g/kg): Calcium phosphate monobasic: 10; Magnesium sulfate heptahydrate: 2.4; Potassium chloride: 4.5; Sodium chloride: 2.1; Ferrous sulfate monohydrate: 0.155; Cupric sulfate pentahydrate: 0.040; Zinc sulfate monohydrate: 0.080; Manganese sulfate monohydrate: 0.030; Potassium iodide: 0.0117; Cobalt chloride hexahydrate: 0.0048; Sodium selenite: 0.0024.
Table 2. Composition of feed fatty acids (% total fatty acid methyl esters).
Table 2. Composition of feed fatty acids (% total fatty acid methyl esters).
Content (g/kg)L6L8L10L12
C14:02.252.983.714.44
C16:010.0512.8815.7118.54
C16:12.413.414.415.41
C18:02.413.183.954.72
C18:112.0215.3918.7622.13
C18:218.3923.8129.2334.65
C18:33.063.884.705.52
C20:11.733.264.796.32
C20:40.770.800.830.86
C22:11.954.186.418.64
C22:50.670.750.830.91
C22:62.473.324.175.02
Sum58.1777.8397.49117.15
Table 3. Oligonucleotide primer sequences employed for RT-qPCR amplification of target genes.
Table 3. Oligonucleotide primer sequences employed for RT-qPCR amplification of target genes.
Primer NamePositionPrimer SequenceLength
fasF (5′-3′)TCACTTCTCAACACCCAATCCA22
R (5′-3′)TTGCAGACCGAAGAAGGACG20
accF (5′-3′)GATGAGGGATTCAAGCCCAGTT22
R (5′-3′)TCCCTGTCTTCACCCCACGA20
srebp-1F (5′-3′)CAGACACTGGCCGAGATGTG20
R (5′-3′)GAGCTGGAGCATGTCTTCGAT21
fabpF (5′-3′)AACGACGAATGGACGCTGAA20
R (5′-3′)TTCCCTTAGTGGCGTTCTGG20
ampkF (5′-3′)TGGAAAGTGAGCATTGACGAAG22
R (5′-3′)CATTGGGGTCACGCAACAGA20
atglF (5′-3′)TTGTATCGCTTTGCCCGTAT20
R (5′-3′)CAAAGGGTAAGACATAAGGCAAT23
hsp70F (5′-3′)TGACAAGGGTCGCCTCAGTA20
R (5′-3′)CATTATCTTGTTGCGATCCTC21
β-actinF (5′-3′)TCCGTAAGGACCTGTATGCC20
R (5′-3′)TCGGGAGGTGCGATGATTTT20
Table 4. Effects of different lipid levels on the survival, growth performance, and feed utilization of M. rosenbergii (n = 4).
Table 4. Effects of different lipid levels on the survival, growth performance, and feed utilization of M. rosenbergii (n = 4).
TreatmentDiets (Lipid Level %)
L6 (6%)L8 (8%)L10 (10%)L12 (12%)
IW (g)0.85 ± 0.010.85 ± 0.010.86 ± 0.010.86 ± 0.01
FW (g)11.31 ± 0.40 a12.67 ± 0.32 b12.42 ± 0.17 b12.16 ± 0.49 b
WGR (%)1230.63 ± 48.75 a1386.03 ± 30.61 c1340.59 ± 19.62 bc1306.79 ± 56.87 b
SGR (%/d)4.17 ± 0.06 a4.35 ± 0.03 c4.30 ± 0.02 bc4.26 ± 0.06 b
HSI (%)3.46 ± 0.232.92 ± 0.362.93 ± 0.583.29 ± 0.45
FCR2.82 ± 0.15 b2.55 ± 0.11 a2.58 ± 0.07 a2.59 ± 0.17 a
CF (%)11.45 ± 0.34 a12.29 ± 0.24 b12.14 ± 0.19 b11.96 ± 0.39 b
Abbreviations: IW, initial individual weight; HSI, hepatosomatic index; FW, final individual weight; SGR, specific growth rate; CF, condition factor; WGR, weight gain rate; FCR, feed conversion ratio. Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Table 5. Effects of different dietary lipid levels on muscle nutritional composition of M. rosenbergii (n = 4).
Table 5. Effects of different dietary lipid levels on muscle nutritional composition of M. rosenbergii (n = 4).
L6 (6%)L8 (8%)L10 (10%)L12 (12%)
Moisture (%)77.45 ± 0.3677.53 ± 0.2477.46 ± 0.7477.36 ± 0.55
Crude protein (%)21.04 ± 0.0621.30 ± 0.2421.38 ± 0.4921.24 ± 0.27
Crude lipid (%)0.83 ± 0.010.87 ± 0.040.85 ± 0.030.84 ± 0.03
Ash (%)1.38 ± 0.061.43 ± 0.081.42 ± 0.051.41 ± 0.07
Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where the absence of lowercase letters indicated no significant difference (p > 0.05). Uniform annotation conventions persist across subsequent data presentations.
Table 6. Effects of dietary lipid levels on survival of M. rosenbergii under ammonia-N stress (n = 4).
Table 6. Effects of dietary lipid levels on survival of M. rosenbergii under ammonia-N stress (n = 4).
L6 (6%)L8 (8%)L10 (10%)L12 (12%)
24 h mortality rate (%)43.75 ± 7.22 b6.25 ± 7.22 a12.50 ± 0.00 a6.25 ± 7.22 a
48 h mortality rate (%)75.00 ± 10.21 c18.75 ± 7.22 a21.88 ± 6.25 a50.00 ± 17.68 b
Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Table 7. Effects of dietary lipid levels on survival of M. rosenbergii under high-temperature stress (n = 4).
Table 7. Effects of dietary lipid levels on survival of M. rosenbergii under high-temperature stress (n = 4).
L6 (6%)L8 (8%)L10 (10%)L12 (12%)
4 h mortality rate (%)9.38 ± 6.253.13 ± 6.253.13 ± 6.259.38 ± 6.25
8 h mortality rate (%)28.13 ± 6.25 b12.50 ± 0.00 a18.75 ± 7.22 a28.13 ± 6.25 b
12 h mortality rate (%)46.88 ± 6.25 b25.00 ± 10.21 a40.63 ± 6.25 b50.00 ± 10.21 b
16 h mortality rate (%)68.75 ± 7.22 b40.63 ± 11.97 a56.25 ± 7.22 b71.88 ± 6.25 c
20 h mortality rate (%)84.38 ± 6.25 c53.13 ± 6.25 a71.88 ± 6.25 b84.38 ± 6.25 c
24 h mortality rate (%)96.88 ± 6.25 c56.25 ± 7.22 a81.25 ± 7.22 b93.75 ± 7.22 c
Experimental outcomes demonstrate arithmetic means ± SD derived from quadruplicate experimental repetitions (n = 4). Distinct alphabetic superscripts identify statistical groupings through Duncan’s multiple range test, where differentiated lowercase characters signify significant divergence (p < 0.05). Uniform annotation conventions persist across subsequent data presentations.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, H.; Xu, J.; Deng, K.; Wang, A.; Huang, C.; Zhang, M.; Deng, D.; Chen, H.; Miao, S. The Influence of the Dietary Lipid Level on Growth Performance, Lipid Metabolism, Oxidative Response and Hepatopancreatic Health in Macrobrachium rosenbergii. Animals 2025, 15, 2818. https://doi.org/10.3390/ani15192818

AMA Style

Guo H, Xu J, Deng K, Wang A, Huang C, Zhang M, Deng D, Chen H, Miao S. The Influence of the Dietary Lipid Level on Growth Performance, Lipid Metabolism, Oxidative Response and Hepatopancreatic Health in Macrobrachium rosenbergii. Animals. 2025; 15(19):2818. https://doi.org/10.3390/ani15192818

Chicago/Turabian Style

Guo, Haoyue, Jie Xu, Kangyu Deng, Anran Wang, Chungui Huang, Min Zhang, Deng Deng, Huangen Chen, and Shuyan Miao. 2025. "The Influence of the Dietary Lipid Level on Growth Performance, Lipid Metabolism, Oxidative Response and Hepatopancreatic Health in Macrobrachium rosenbergii" Animals 15, no. 19: 2818. https://doi.org/10.3390/ani15192818

APA Style

Guo, H., Xu, J., Deng, K., Wang, A., Huang, C., Zhang, M., Deng, D., Chen, H., & Miao, S. (2025). The Influence of the Dietary Lipid Level on Growth Performance, Lipid Metabolism, Oxidative Response and Hepatopancreatic Health in Macrobrachium rosenbergii. Animals, 15(19), 2818. https://doi.org/10.3390/ani15192818

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop