Impact of Salinity Stress on Antioxidant Enzyme Activity, Histopathology, and Gene Expression in the Hepatopancreas of the Oriental River Prawn, Macrobrachium nipponense
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Tissue Collection
2.2. Histological Observation
2.3. Measurement of the Activities of Antioxidant Enzymes
2.4. Transcriptome Profiling Analysis
2.5. qPCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Changes in Antioxidant Enzymes After Salinity Exposure
3.2. Morphological Changes in Hepatopancreas After Salinity Exposure
3.3. Transcriptome Profiling Analysis of Hepatopancreas
3.4. Identification of Candidate Genes Involved in Salinity Acclimation
3.5. qPCR Verification of DEGs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liang, L.Q.; Ren, B.; Chang, Y.M.; Tang, R.; Zhang, L.M. Inland brackish (alkaline-saline) water resources and fisheries utilization in China. Chin. Fish. Econ. 2013, 31, 138–145. [Google Scholar]
- Liu, Y.X.; Fang, H.; Lai, Q.F.; Liang, L.Q. The Current State and Development Strategy for China’s Saline-Alkaline Fisheries. Strateg. Study Chin. Acad. Eng. 2016, 18, 74–78. [Google Scholar]
- Derry, A.M.; Prepas, E.E.; Herbert, P.D.N. A composition of zooplankton communities in saline lakewater with variable anion composition. Hydrobiologia 2003, 505, 199–215. [Google Scholar] [CrossRef]
- Weber-Scannell, P.K.; Duffy, L.K. Effects of total dissolved solids on aquatic organisms; a review of literature and recommendation for salmonid species. Am. J. Environ. Sci. 2007, 3, 1–6. [Google Scholar] [CrossRef]
- Wang, J.L.; Huang, X.J.; Zhong, T.Y.; Chen, Z.G. Review on sustainable utilization of salt-affected land. Acta Geogr. Sin. 2011, 66, 673–684. [Google Scholar]
- Xu, W.; Geng, L.W.; Jiang, H.F.; Tong, G.X. A Review of Development and Utilization of Fish Culture in Saline-alkaline Water. Chin. J. Fish. 2015, 28, 44–47. [Google Scholar]
- Oliveira, A.F.; Marques, S.C.; Pereira, J.; Azeiteiro, U.M. Salinity and temperature influence on the early development of mysid Mesopodopsis slabberi in a temperate estuary: Implications to climate change effect. Mar. Environ. Res. 2025, 209, 107239. [Google Scholar] [CrossRef]
- Chand, B.K.; Trivedi, R.K.; Dubey, S.K.; Rout, S.K.; Beg, M.M.; Das, U.K. Effect of salinity on survival and growth of giant freshwater prawn Macrobrachium rosenbergii (de Man). Aquac. Rep. 2015, 2, 26–33. [Google Scholar] [CrossRef]
- Ye, L.; Jiang, S.; Zhu, X.; Yang, Q.; Wen, W.; Wu, K. Effects of Salinity on Growth and Energy Budget of Juvenile Penaeus monodon. Aquaculture 2009, 290, 140–144. [Google Scholar] [CrossRef]
- Torres, G.; Giménez, L.; Anger, K. Growth, Tolerance to Low-Salinity, and Osmoregulation in Decapod Crustacean Larvae. Aquat. Biol. 2011, 12, 249–260. [Google Scholar] [CrossRef]
- Zhang, X.L.; Cui, L.F.; Li, S.M.; Liu, X.Z.; Han, X.; Jiang, K.Y. Bureau of Fisheries, Ministry of Agriculture, P.R.C. Fisheries Economic Statistics. In China Fishery Yearbook; Beijing China Agricultural: Beijing, China, 2020; p. 24. [Google Scholar]
- Anger, K. Neotropical macrobrachium (Caridea: Palaemonidae): On the biology, origin, and radiation of freshwater-invading shrimp. J. Crustac. Biol. 2013, 33, 151–183. [Google Scholar] [CrossRef]
- Frolová, P.; Horká, I.; Ďuriš, Z. Molecular phylogeny and historical biogeography of marine palaemonid shrimps (Palaemonidae: Palaemonella–Cuapetes group). Sci. Rep. 2022, 12, 15237. [Google Scholar] [CrossRef]
- Wilder, M.N.; Ikuta, K.; Atmomarsono, M.; Hatta, T.; Komuro, K. Changes in osmotic and ionic concentrations in the hemolymph of Macrobrachium rosenbergii exposed to varying salinities and correlation to ionic and crystalline composition of the cuticle. Comp. Biochem. Physiol. 1998, 119, 941–950. [Google Scholar] [CrossRef]
- Jaffer, Y.; Saraswathy, R.; Ishfaq, M.; Antony, J.; Bundela, D.; Sharma, P. Effect of low salinity on the growth and survival of juvenile pacific white shrimp, Penaeus vannamei: A revival. Aquaculture 2020, 515, 734561. [Google Scholar] [CrossRef]
- Williams, A.B. The influence of temperature on osmotic regulation in two species of estuarine shrimps (Penaeus). Biol. Bull. 1960, 119, 560–571. [Google Scholar] [CrossRef]
- Cheng, X.; Li, J.L.; Feng, J.B.; Nie, S.Z.; Fan, Y.P. Salinity tolerance of juvenile prawn Macrobrachium nipponense. J. Dalian Fish. Uni. 2008, 23, 315–317. [Google Scholar]
- Wang, W.; Gan, L.; Zhang, D.; Mu, F. Effects of Salinity on Survival and Growth of Pseudobagrus vachelli. Fish. Sci. Technol. Inf. 2004, 31, 121–124. [Google Scholar]
- Li, H.; Zhou, W.; Gao, H.; Zhang, G. Joint Toxicity of Salinity and Alkalinity to Procambarus clarkii. J. Aquac. 2006, 27, 1–4. [Google Scholar]
- Chen, K.; Li, E.; Li, T.; Xu, C.; Wang, X.; Lin, H.; Qin, J.G.; Chen, L.Q. Transcriptome and Molecular Pathway Analysis of the Hepatopancreas in the Pacific White Shrimp Litopenaeus vannamei under Chronic Low Salinity Stress. PLoS ONE 2015, 10, e0131503. [Google Scholar] [CrossRef]
- Wan, H.F.; Yu, L.; Cui, X.D.; Guo, S.; Mu, S.M.; Kang, X.J. Comparative transcriptome analysis reveals the different responding mechanisms of ovary and hepatopancreas following polyI:C challenge in Macrobrachium nipponense. Comp. Biochem. Phys. D 2024, 52, 101289. [Google Scholar] [CrossRef]
- Ou, J.; Luan, X.; Chen, H.; Zhou, K.; Wang, Z.; Wang, H.; Lv, L.; Dong, X.; Zhao, W.; Zhang, B.; et al. Transcriptome in combination with experimental validation unveils hub immune-related genes in oriental river prawn Macrobrachium nipponense against Spiroplasma eriocheiris challenge. Aquaculture 2021, 539, 736625. [Google Scholar] [CrossRef]
- Yi, C.; Lv, X.; Chen, D.; Sun, B.; Guo, L.F.; Wang, S.Q.; Ru, Y.Y.; Wang, H.; Zeng, Q. Transcriptome analysis of the Macrobrachium nipponense hepatopancreas provides insights into immunoregulation under Aeromonas veronii infection. Ecotoxicol. Environ. Saf. 2021, 208, 111503. [Google Scholar] [CrossRef] [PubMed]
- Zhu, P.; Wang, H.; Zeng, Q. Comparative transcriptome reveals the response of oriental river prawn (Macrobrachium nipponense) to sulfide toxicity at molecular level. Aquat. Toxicol. 2021, 230, 105700. [Google Scholar] [CrossRef]
- Li, F.; Fu, C.; Li, Z.; Wang, A. MicroRNA transcriptome analysis of oriental river prawn Macrobrachium nipponense in responding to starvation stress. Comp. Biochem. Physiol. D 2021, 38, 100820. [Google Scholar] [CrossRef]
- Iko, R.; Gao, Z.; Jiang, S.; Xiong, Y.; Zhang, W.; Qiao, H.; Jin, S.; Fu, H. Genetic Diversity and Population Structure of Macrobrachium nipponense Populations in the Saline-Alkaline Regions of China. Animals 2025, 15, 158. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.K.; Liu, X.Z.; Wen, H.S.; Xu, Y.J.; Zhang, L.J. Histological observation on gonadal sex differentiation in Cynoglossus semilaevis Günther. Mar. Fish. Res. 2006, 27, 55–61. [Google Scholar]
- Jin, S.B.; Fu, H.T.; Zhou, Q.; Sun, S.M.; Jiang, S.F.; Xiong, Y.W.; Gong, Y.S.; Qiao, H.; Zhang, W.Y. Transcriptome analysis of androgenic gland for discovery of novel genes from the oriental river prawn, Macrobrachium nipponense, using Illumina Hiseq 2000. PLoS ONE 2013, 8, e76840. [Google Scholar] [CrossRef]
- Jin, S.B.; Fu, Y.; Hu, Y.N.; Fu, H.T.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Zhang, W.Y.; Gong, Y.S. Identification of candidate genes from androgenic gland in Macrobrachium nipponense regulated by eyestalk ablation. Sci. Rep. 2021, 11, 1985. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Tatusov, R.L.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Kiryutin, B.; Koonin, E.V.; Krylov, D.M.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; et al. The COG database: An updated version includes eukaryotes. BMC Bioinform. 2003, 4, 41. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Itoh, M. KEGG for linking genomes to life and the environment. Nucleic Acids. Res. 2008, 36, 480–484. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq-A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of Fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, J.A.; Zwinderman, A.H. On the benjamini–hochberg method. Ann. Statist. 2006, 34, 1827–1849. [Google Scholar] [CrossRef]
- Jin, S.B.; Hu, Y.N.; Fu, H.T.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Zhang, W.Y.; Gong, Y.S.; Wu, Y. Potential functions of gem-associated protein 2-like isoform X1 in the oriental river prawn Macrobrachium nipponense: Cloning, qPCR, in situ hybridization, and RNAi analysis. Int. J. Mol. Sci. 2019, 20, 3995. [Google Scholar] [CrossRef]
- Jin, S.B.; Hu, Y.N.; Fu, H.T.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Zhang, W.Y.; Gong, Y.S.; Wu, Y. Identification and characterization of the succinate dehydrogenase complex iron sulfur subunit B gene in the oriental river prawn Macrobrachium nipponense. Front. Genet. 2021, 12, 698318. [Google Scholar] [CrossRef]
- Hu, Y.N.; Fu, H.T.; Qiao, H.; Sun, S.M.; Zhang, W.Y.; Jin, S.B.; Jiang, S.F.; Gong, Y.S.; Xiong, Y.W.; Wu, Y. Validation and evaluation of reference genes for quantitative real-time PCR in Macrobrachium nipponense. Int. J. Mol. Sci. 2018, 19, 2258. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wang, T.; Shan, H.W.; Geng, Z.X.; Yu, P.; Ma, S. Dietary Supplementation with Freeze-Dried Ampithoe Sp. Enhances the Ammonia-N Tolerance of Litopenaeus Vannamei by Reducing Oxidative Stress and Endoplasmic Reticulum Stress and Regulating Lipid Metabolism. Aquac. Rep. 2020, 16, 100264. [Google Scholar] [CrossRef]
- Wang, W.N.; Zhou, J.; Wang, P.; Tian, T.T.; Zheng, Y.; Liu, Y.; Mai, W.J.; Wang, A.L. Oxidative Stress, DNA Damage and Antioxidant Enzyme Gene Expression in the Pacific White Shrimp, Litopenaeus Vannamei when Exposed to Acute pH Stress. Comp. Biochem. Physiol. C 2009, 150, 428–435. [Google Scholar] [CrossRef]
- Paital, B.; Chainy, G.B.N. Antioxidant Defenses and Oxidative Stress Parameters in Tissues of Mud Crab (Scylla serrata) with Reference to Changing Salinity. Comp. Biochem. Physiol. C 2010, 151, 142–151. [Google Scholar] [CrossRef]
- Cheng, W.; Chen, J.C. Effects of pH, Temperature and Salinity on Immune Parameters of the Freshwater Prawn Macrobrachium Rosenbergii. Fish Shellfish Immunol. 2000, 10, 387–391. [Google Scholar] [CrossRef]
- Pan, L.Q.; Jiang, L.X.; Miao, J.J. Effects of Salinity and pH on Immune Parameters of the White Shrimp Litopenaeus vannamei. J. Shellfish Res. 2005, 24, 1223–1228. [Google Scholar]
- Hong, Y.W.; Pan, Y.; Zhu, Q.; Li, Y.; Yang, H.; Lin, B.; Dong, Z.; Lou, Y.; Fu, S. Effect of low-salinity seawater transient on antioxidant capacity, muscle quality and intestinal microorganism of crucian carp (Carassius auratus gibelio). Food Biosci. 2024, 62, 105335. [Google Scholar] [CrossRef]
- Mozanzadeh, M.T.; Safari, O.; Oosooli, R.; Mehrjooyan, S.; Najafabadi, M.Z.; Hoseini, S.J.; Saghavi, H.; Monem, J. The effect of salinity on growth performance, digestive and antioxidant enzymes, humoral immunity and stress indices in two euryhaline fish species: Yellowfin seabream (Acanthopagrus latus) and Asian seabass (Lates calcarifer). Aquaculture 2021, 534, 736329. [Google Scholar] [CrossRef]
- Cohen-Sánchez, A.; Box, A.; Valencia, J.M.; Pinya, S.; Tejada, S.; Sureda, A. Exploring the impact of high salinity and parasite infection on antioxidant and immune systems in Coris julis in the Pityusic Islands (Spain). Sci. Total Environ. 2024, 951, 175848. [Google Scholar] [CrossRef]
- Liu, J.R.; Qu, Y.J.; Li, J.E.; Su, H.; Cao, S.H.; Wang, Y.C. Effects of Salinity and Temperature on the Activity of Antioxidant Enzymes in Livers of Selective Group of Trachinotus ovatus. Chin. J. Zool. 2013, 48, 428–436. [Google Scholar]
- Ursini, F.; Maiorino, M.; Forman, H.J. Redox homeostasis: The Golden Mean of healthy living. Redox Biol. 2021, 42, 101887. [Google Scholar] [CrossRef]
- Rahi, M.L. Understanding the Molecular Basis of Adaptation to Freshwater Environments by Prawns in the Genus Macrobrachium. Doctoral Dissertation, Queensland University of Technology, Queensland, Australia, 2017. [Google Scholar]
- Moshtaghi, A.; Rahi, M.L.; Nguyen, V.T.; Mather, P.B.; Hurwood, D.A. A transcriptomic scan for potential candidate genes involved in osmo-regulation in an obligate freshwater palaemonid prawn (Macrobrachium australiense). PeerJ 2016, 4, e2520. [Google Scholar] [CrossRef] [PubMed]
- Li, E.; Wang, X.; Chen, K.; Xu, C.; Qin, J.G.; Chen, L. Effects of salinity stress on the hepatopancreas morphology and antioxidant enzyme activities in Litopenaeus vannamei. Aquacul. Rep. 2020, 18, 100523. [Google Scholar]
- Wang, L.; Li, S.; Wang, X.; Cheng, Y.; Li, J.; Chen, X. Salinity-induced changes in the hepatopancreas of the mud crab (Scylla paramamosain): Histological and ultrastructural observations. Aquat. Toxicol. 2021, 237, 105901. [Google Scholar]
- Zhang, X.; Liu, Y.; Wang, H.; Li, J.; Chen, Y.; Zhang, Z. Impact of salinity stress on the hepatopancreas of the freshwater prawn Macrobrachium rosenbergii: A histopathological and biochemical study. Comp. Biochem. Physiol. C 2022, 257, 109345. [Google Scholar]
- Ma, L.; Lian, Y.; Li, S.; Fahim, A.M.; Hou, X.; Liu, L.; Pu, Y.; Yang, G.; Wang, W.; Wu, J.; et al. Integrated transcriptome and metabolome analysis revealed molecular regulatory mechanism of saline-alkali stress tolerance and identified bHLH142 in winter rapeseed (Brassica rapa). Int. J. Biol. Macromol. 2025, 295, 139542. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.S.; Tao, Y.F.; Jiang, B.J.; Badran, M.F.; Zhu, J.; Hua, J.X.; Wang, Q.C.; Lu, S.Q.; Saleh, M.H.L.; Aboueleila, R.H.M.; et al. Integrated gill transcriptome and biochemical indices analyses reveal that acute salinity stress induces oxidative stress and immune and metabolic disorders in Red Tilapia (Oreochromis spp.). Aquaculture 2025, 599, 742108. [Google Scholar] [CrossRef]
- Yuan, C.; Zhou, K.Q.; Pan, X.H.; Lin, Y.; Qin, J.Q.; Wang, D.P.; Chen, Z.; Du, X.S.; Huang, Y. Comparative transcriptome analysis reveals potential regulatory mechanisms in response to changes in physiological functions in Oreochromis aureus under salinity stress. Aquac. Rep. 2025, 40, 102608. [Google Scholar] [CrossRef]
- Wang, R.X.; Bu, Y.K.; Xing, K.F.; Yuan, L.B.; Wu, Z.X.; Sun, Y.Y.; Zhang, J.Q. Integrated analysis of transcriptome and metabolome reveals chronic low salinity stress responses in the muscle of Exopalaemon carinicauda. Comp. Biochem. Physiol. D 2024, 52, 101340. [Google Scholar] [CrossRef]
- Xue, C.; Xu, K.; Jin, Y.; Bian, C.; Sun, S. Transcriptome Analysis to Study the Molecular Response in the Gill and Hepatopancreas Tissues of Macrobrachium nipponense to Salinity Acclimation. Front. Physiol. 2022, 13, 926885. [Google Scholar] [CrossRef]
- Wen, X.; Chu, P.; Xu, J.; Wei, X.; Fu, D.; Wang, T.; Yin, S. Combined effects of low temperature and salinity on the immune response, antioxidant capacity and lipid metabolism in the pufferfish (Takifugu fasciatus). Aquaculture 2021, 531, 735866. [Google Scholar] [CrossRef]
- Wang, L.U.; Chen, J.C. The immune response of white shrimp Litopenaeus vannamei and its susceptibility to Vibrio alginolyticus at different salinity levels. Fish Shellfish Immunol. 2005, 18, 269–278. [Google Scholar] [CrossRef]
- Settembre, C.; Fraldi, A.; Medina, D.L.; Ballabio, A. Signals from the lysosome: A control centre for cellular clearance and energy metabolism. Nat. Rev. Mol. Cell Bio. 2013, 14, 283–296. [Google Scholar] [CrossRef] [PubMed]
- Luzio, J.P.; Pryor, P.R.; Bright, N.A. Lysosomes: Fusion and function. Nat. Rev. Mol. Cell Bio. 2007, 8, 622–632. [Google Scholar] [CrossRef]
- Vidak, E.; Javoršek, U.; Vizovišek, M.; Turk, B. Cysteine cathepsins and their extracellular roles: Shaping the microenvironment. Cells 2019, 8, 264. [Google Scholar] [CrossRef]
- Gondi, C.S.; Rao, J.S. Cathepsin B as a cancer target. Expert Opin. Ther. Targets 2013, 17, 281–291. [Google Scholar] [CrossRef]
- Mitrović, A.; Završnik, J.; Mikhaylov, G.; Knez, D.; Fonović, P.U.; Štefin, P.M.; Butinar, M.; Gobec, S.; Turk, B.; Kos, J. Evaluation of novel cathepsin-X inhibitors in vitro and in vivo and their ability to improve cathepsin-B-directed antitumor therapy. Cell. Mol. Life Sci. 2022, 79, 1–14. [Google Scholar] [CrossRef]
- Podgorski, I.; Sloane, B.F. Cathepsin B and Its Role (s) in Cancer Progression. In Biochemical Society Symposia; Portland Press Limited: London, UK, 2003; pp. 263–276. [Google Scholar]
- Sui, H.; Shi, C.; Yan, Z.; Wu, M. Overexpression of Cathepsin L is associated with chemoresistance and invasion of epithelial ovarian cancer. Oncotarget 2016, 7, 45995. [Google Scholar] [CrossRef]
- Malhotra, J.D.; Kaufman, R.J. The endoplasmic reticulum and the unfolded protein response. Semin. Cell Dev. Biol. 2007, 18, 716–731. [Google Scholar] [CrossRef]
- Kapoor, A.; Sanyal, A.J. Endoplasmic reticulum stress and the unfolded protein response. Clin. Liver Dis. 2009, 13, 581–590. [Google Scholar] [CrossRef] [PubMed]
- Fribley, A.; Zhang, K.; Kaufman, R.J. Regulation of apoptosis by the unfolded protein response. Methods Mol. Biol. 2009, 599, 191–204. [Google Scholar]
- Regini, J.W.; Ecroyd, H.; Meehan, S.; Bremmell, K.; Clarke, M.J.; Lammie, D.; Wess, T.; Carver, J.A. The interaction of unfolding alpha-lactalbumin and malate dehydrogenase with the molecular chaperone alpha B-crystallin: A light and X-ray scattering investigation. Mol. Vis. 2010, 16, 2446–2456. [Google Scholar]
- Horwitz, J. Alpha-crystallin can function as a molecular chaperone. Proc. Natl. Acad. Sci. USA 1992, 89, 10449–10453. [Google Scholar] [CrossRef]
- Malik, A.; Almaharfi, H.A.; Khan, J.M.; Hisamuddin, M.; Alamery, S.F.; Haq, S.H.; Ahmed, M.Z. Protection of ζ-crystallin by α-crystallin under thermal stress. Int. J. Biol. Macromol. 2021, 167, 289–298. [Google Scholar] [CrossRef]
- Smith, R.C.; Rosen, K.M.; Pola, R.; Magrané, J. Stress proteins in Alzheimer’s disease. Int. J. Hyperth. 2005, 21, 421–431. [Google Scholar] [CrossRef] [PubMed]
- Biebl, M.M.; Buchner, J. Structure, function, and regulation of the Hsp90 machinery. Cold. Spring. Harb. Perspect. Biol. 2019, 11, a034017. [Google Scholar] [CrossRef] [PubMed]
- Schopf, F.H.; Biebl, M.M.; Buchner, J. The HSP90 chaperone machinery. Nat. Rev. Mol. Cell Biol. 2017, 18, 345–360. [Google Scholar] [CrossRef] [PubMed]
- Koren, J.; Blagg, B.S.J. The right tool for the job: An overview of Hsp90 inhibitors. Adv. Exp. Med. Biol. 2020, 1243, 135–146. [Google Scholar]
- Wu, H.; Liu, X.; Zhang, X.; Ji, C.; Zhao, J.; Yu, J. Proteomic and metabolomic responses of clam Ruditapes philippinarum to arsenic exposure under different salinities. Aquat. Toxicol. 2013, 136–137, 91–100. [Google Scholar] [CrossRef]
- Cao, S.; Li, Y.; Jiang, S.; Yang, Q.; Huang, J.; Yang, L.; Shi, J.; Jiang, S.; Wen, G.; Zhou, F. Transcriptome Analysis Reveals the Regulatory Mechanism of Lipid Metabolism and Oxidative Stress in Litopenaeus vannamei under Low-Salinity Stress. J. Mar. Sci. Eng. 2024, 12, 1387. [Google Scholar] [CrossRef]
- Li, Y.; Ye, Y.; Li, W.; Liu, X.; Zhao, Y.; Jiang, Q.; Che, X. Effects of Salinity Stress on Histological Changes, Glucose Metabolism Index and Transcriptomic Profile in Freshwater Shrimp, Macrobrachium nipponense. Animals 2023, 13, 2884. [Google Scholar] [CrossRef]
- Metón, I.; Fernández, F.; Baanante, I.V. Short- and long-term effects of refeeding on key enzyme activities in glycolysis–gluconeogenesis in the liver of gilthead seabream (Sparus aurata). Aquaculture 2003, 225, 99–107. [Google Scholar] [CrossRef]
- Nordlie, R.C.; Foster, J.D.; Lange, A.J. Regulation OF glucose production BY the liver. Annu. Rev. Nutr. 1999, 19, 379–406. [Google Scholar] [CrossRef]
- Sagar, V.; Sahu, N.P.; Pal, A.K.; Hassaan, M.; Jain, K.K.; Salim, H.S.; Kumar, V.; El-Haroun, E.R. Effect of different stock types and dietary protein levels on key enzyme activities of glycolysis-gluconeogenesis, the pentose phosphate pathway and amino acid metabolism in Macrobrachium rosenbergii. J. Appl. Ichthyol. 2019, 35, 1016–1024. [Google Scholar] [CrossRef]
- Gray, L.R.; Tompkins, S.C.; Taylor, E.B. Regulation of pyruvate metabolism and human disease. Cell. Mol. Life Sci. 2014, 71, 2577–2604. [Google Scholar] [CrossRef] [PubMed]
- Arnold, P.K.; Finley, L.W.S. Regulation and function of the mammalian tricarboxylic acid cycle. J. Biol. Chem. 2023, 299, 102838. [Google Scholar] [CrossRef]
- Davidson, S.M.; Papagiannakopoulos, T.; Olenchock, B.A.; Heyman, J.; Keibler, M.; Luengo, A.; Bauer, M.; Jha, A.; O’Brien, J.; Pierce, K. Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer. Cell Metab. 2016, 23, 517–528. [Google Scholar] [CrossRef] [PubMed]
- Marin-Valencia, I.; Yang, C.; Mashimo, T.; Cho, S.; Baek, H.; Yang, X.L.; Rajagopalan, K.; Maddie, M.; Vemireddy, V.; Zhao, Z. Analysis of tumor metabolism reveals mitochondrial glucose oxidation in genetically diverse human glioblastomas in the mouse brain in vivo. Cell Metab. 2012, 15, 827–837. [Google Scholar] [CrossRef] [PubMed]
- Keller, M.A.; Kampjut, D.; Harrison, S.A.; Ralser, M. Sulfate radicals enable a non-enzymatic Krebs cycle precursor. Nat. Ecol. Evol. 2017, 1, 83. [Google Scholar] [CrossRef]
- Muchowska, K.B.; Varma, S.J.; Moran, J. Synthesis and breakdown of universal metabolic precursors promoted by iron. Nature 2019, 569, 104–107. [Google Scholar] [CrossRef]
- Springsteen, G.; Yerabolu, J.R.; Nelson, J.; Rhea, C.J.; Krishnamurthy, R. Linked cycles of oxidative decarboxylation of glyoxylate as protometabolic analogs of the citric acid cycle. Nat. Commun. 2018, 9, 91. [Google Scholar] [CrossRef]
- Venancio-Brochi, J.C.; Pereira, L.M.; Calil, F.A.; Teixeira, O.; Baroni, L.; Abreu-Filho, P.G.; Braga, G.Ú.L.; Nonato, M.C.; Yatsuda, A.P. Glutathione reductase: A cytoplasmic antioxidant enzyme and a potential target for phenothiazinium dyes in Neospora caninum. Int. J. Biol. Macromol. 2021, 187, 964–975. [Google Scholar] [CrossRef] [PubMed]
- Hanson, R.W.; Hakimi, P. Born to run; the story of the PEPCK-Cmus mouse. Biochimie 2012, 94, 573–575. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hakimi, P.; Yang, J.; Casadesus, G.; Massillon, D.; Tolentino-Silva, F.; Nye, C.K.; Hanson, R.W. Overexpression of the cytosolic form of phosphoenolpyruvate carboxykinase (GTP) in skeletal muscle repatterns energy metabolism in the mouse. J. Biol. Chem. 2012, 287, 19060–19069. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Kalhan, S.C.; Hanson, R.W. What is the metabolic role of phosphoenolpyruvate carboxykinase? J. Biol. Chem. 2011, 286, 25725–25732. [Google Scholar] [CrossRef]
- Kikuchi, D.; Minamishima, Y.A.; Nakayama, K. Prolyl-hydroxylase PHD3 interacts with pyruvate dehydrogenase (PDH)-E1beta and regulates the cellular PDH activity. Biochem. Biophys. Res. Commun. 2014, 451, 288–294. [Google Scholar] [CrossRef]
- Larrieu, C.M.; Storevik, S.; Guyon, J.; Pagano Zottola, A.C.; Bouchez, C.L.; Derieppe, M.A.; Tan, T.Z.; Miletic, H.; Lorens, J.; Tronstad, K.J.; et al. Refining the role of pyruvate dehydrogenase kinases in glioblastoma development. Cancers 2022, 14, 3769. [Google Scholar] [CrossRef] [PubMed]





| Gene | Primer |
|---|---|
| Cathepsin B | F: ATTCCCGAATGCGAGCATCA |
| R: CCTCAACGGGGCCATTAGTC | |
| Cathepsin L | F: GCCGGTTTCTGTTGCTATCG |
| R: CCATGACTTGCTCCACGAGT | |
| alpha-L-fucosidase | F: CCATTGTTCTCCAGTGGCCT |
| R: GTTAATTCCAGCACCCACGC | |
| Legumain | F: TCACTGAACCCAAACCCAGG |
| R: CCCAATTCCTTCCATGGCCT | |
| Solute larrier camily 17, member 5 | F: GCTTGGCGGTTCGTTTTCTT |
| R: AGCTTTTGGCATGAGGACCA | |
| Crystallin, alpha B | F: CGAGTTGCAAGTTCGCGTAG |
| R: GCCTTCCCTCTTTGGAGCAT | |
| Pyruvate dehydrogenase E1 | F: AATGGGGGCATTTGTGTTGC |
| R: AGATGCAGATGCACGGTCAA | |
| Succinate dehydrogenase | F: ACGTGCGCTAATACCTTGTCA |
| R: TACTCGATAGCCGGAGACGG | |
| Eukaryotic translation initiation factor 5A | F: CATGGATGTACCTGTGGTGAAAC |
| R: CTGTCAGCAGAAGGTCCTCATTA |
| Gene | Accession Number | Metabolic Pathway | Log (Fold Change) | ||
|---|---|---|---|---|---|
| S0 vs. S1 | S1 vs. S4 | S4 vs. S7 | |||
| Cathepsin B | MSTRG.22966 | Lysosome | 2.4 | 1.8 | |
| Cathepsin L | ncbi_135220875 | Lysosome | 1.1 | 1.6 | |
| alpha-L-fucosidase | ncbi_135221329 | Lysosome | 1.5 | 1.3 | |
| Legumain | ncbi_135217338 | Lysosome | 1.4 | 1.5 | |
| Solute larrier camily 17, member 5 | ncbi_135224400 | Lysosome | 2.6 | 5.1 | |
| Crystallin, alpha B | ncbi_135198784 | Protein processing in endoplasmic reticulum | 1.9 | 2.4 | |
| Heat shock protein 90A | ncbi_135227160 | Protein processing in endoplasmic reticulum | −1.6 | −1.3 | |
| S-lutathione dehydrogenase | ncbi_135202288 | Pyruvate metabolism, Glycolysis/Gluconeogenesis | −1.4 | −2.1 | −1.6 |
| Phosphoenolpyruvate carboxykinase | ncbi_135220828 | Pyruvate metabolism, Glycolysis/Gluconeogenesis, Citrate cycle | 1.7 | −1.3 | |
| Lactoylglutathione lyase | MSTRG.6143 | Pyruvate metabolism | −2.7 | −2.5 | |
| Pyruvate dehydrogenase E1 | ncbi_135195838 | Glycolysis/Gluconeogenesis, Citrate cycle | 1.2 | 1.1 | |
| Succinate dehydrogenase | ncbi_135196176 | Citrate cycle | 2.1 | 1.3 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, S.; Ye, Z.; Fu, H.; Xiong, Y.; Qiao, H.; Zhang, W.; Jiang, S. Impact of Salinity Stress on Antioxidant Enzyme Activity, Histopathology, and Gene Expression in the Hepatopancreas of the Oriental River Prawn, Macrobrachium nipponense. Animals 2025, 15, 2319. https://doi.org/10.3390/ani15152319
Jin S, Ye Z, Fu H, Xiong Y, Qiao H, Zhang W, Jiang S. Impact of Salinity Stress on Antioxidant Enzyme Activity, Histopathology, and Gene Expression in the Hepatopancreas of the Oriental River Prawn, Macrobrachium nipponense. Animals. 2025; 15(15):2319. https://doi.org/10.3390/ani15152319
Chicago/Turabian StyleJin, Shubo, Zhenghao Ye, Hongtuo Fu, Yiwei Xiong, Hui Qiao, Wenyi Zhang, and Sufei Jiang. 2025. "Impact of Salinity Stress on Antioxidant Enzyme Activity, Histopathology, and Gene Expression in the Hepatopancreas of the Oriental River Prawn, Macrobrachium nipponense" Animals 15, no. 15: 2319. https://doi.org/10.3390/ani15152319
APA StyleJin, S., Ye, Z., Fu, H., Xiong, Y., Qiao, H., Zhang, W., & Jiang, S. (2025). Impact of Salinity Stress on Antioxidant Enzyme Activity, Histopathology, and Gene Expression in the Hepatopancreas of the Oriental River Prawn, Macrobrachium nipponense. Animals, 15(15), 2319. https://doi.org/10.3390/ani15152319

