Structural Analysis of the AlkB Family in Poultry
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Classification of Members of the AlkB Family
2.2. Phylogenetic and Structural Analysis of the Chicken AlkB Family
2.3. Chromosomal Localization and Structural Prediction
2.4. Sequence Alignment and Phylogenetic Analysis of AlkB Family Proteins from Different Species
2.5. Experimental Animals and Cells
2.6. RNA Extraction, cDNA Synthesis, and qRT-PCR
3. Results
3.1. Screening and Identification of Chicken AlkB Family Members
3.2. Phylogenetic and Gene Structural Analysis of Chicken AlkB Family Members
3.3. Chromosomal Position Distribution and Collinearity Analysis of the AlkB Family Across Species
3.4. Phylogenetic Analysis of AlkB Family Proteins Across Species
3.5. Protein Characteristics, Structural Insights, and Protein–Protein Interaction Patterns of Chicken AlkB Family Genes
3.6. The Expression Profiles of the AlkB Family Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Peng, B.; Yan, Y.; Xu, Z. The bioinformatics and experimental analysis of AlkB family for prognosis and immune cell infiltration in hepatocellular carcinoma. PeerJ 2021, 9, e12123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aravind, L.; Koonin, E.V. The DNA-repair protein AlkB, EGL-9, and leprecan define new families of 2-oxoglutarate- and iron-dependent dioxygenases. Genome Biol. 2001, 2, research0007.0001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, G.; Yang, C.G.; Yang, S.; Jian, X.; Yi, C.; Zhou, Z.; He, C. Oxidative demethylation of 3-methylthymine and 3-methyluracil in single-stranded DNA and RNA by mouse and human FTO. FEBS Lett. 2008, 582, 3313–3319. [Google Scholar] [CrossRef] [Scilit]
- Jia, G.; Fu, Y.; Zhao, X.; Dai, Q.; Zheng, G.; Yang, Y.; Yi, C.; Lindahl, T.; Pan, T.; Yang, Y.-G.; et al. N6-Methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 2011, 7, 885–887. [Google Scholar] [CrossRef] [Scilit]
- Zheng, G.; Dahl, J.A.; Niu, Y.; Fedorcsak, P.; Huang, C.-M.; Li, C.J.; Vågbø, C.B.; Shi, Y.; Wang, W.-L.; Song, S.-H.; et al. ALKBH5 Is a Mammalian RNA Demethylase that Impacts RNA Metabolism and Mouse Fertility. Mol. Cell 2013, 49, 18–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, C.; Klukovich, R.; Peng, H.; Wang, Z.; Yu, T.; Zhang, Y.; Zheng, H.; Klungland, A.; Yan, W. ALKBH5-dependent m6A demethylation controls splicing and stability of long 3′-UTR mRNAs in male germ cells. Proc. Natl. Acad. Sci. USA 2018, 115, E325–E333. [Google Scholar] [CrossRef] [Scilit]
- Han, S.; Zhao, B.S.; Myers, S.A.; Carr, S.A.; He, C.; Ting, A.Y. RNA–protein interaction mapping via MS2- or Cas13-based APEX targeting. Proc. Natl. Acad. Sci. USA 2020, 117, 22068–22079. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Yang, Y.; Sun, B.-F.; Shi, Y.; Yang, X.; Xiao, W.; Hao, Y.-J.; Ping, X.-L.; Chen, Y.-S.; Wang, W.-J.; et al. FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res. 2014, 24, 1403–1419. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Su, R.; Sheng, Y.; Dong, L.; Dong, Z.; Xu, H.; Ni, T.; Zhang, Z.S.; Zhang, T.; Li, C.; et al. Small-Molecule Targeting of Oncogenic FTO Demethylase in Acute Myeloid Leukemia. Cancer Cell 2019, 35, 677–691.e10. [Google Scholar] [CrossRef] [Scilit]
- Preiss, T.; Chen, L.; Wang, P.; Bahal, R.; Manautou, J.E.; Zhong, X.-B. Ontogenic mRNA expression of RNA modification writers, erasers, and readers in mouse liver. PLoS ONE 2019, 14, e0227102. [Google Scholar] [CrossRef] [Scilit]
- Chang, R.; Tsui, K.-H.; Pan, L.-F.; Li, C.-J. Spatial and single-cell analyses uncover links between ALKBH1 and tumor-associated macrophages in gastric cancer. Cancer Cell Int. 2024, 24, 57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, D.L.; Beharry, A.A.; Srivastava, A.; O’Connor, T.R.; Kool, E.T. Fluorescence Probes for ALKBH2 Allow the Measurement of DNA Alkylation Repair and Drug Resistance Responses. Angew. Chem. Int. Ed. Engl. 2018, 57, 12896–12900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ke, B.; Ye, K.; Cheng, S. ALKBH2 inhibition alleviates malignancy in colorectal cancer by regulating BMI1-mediated activation of NF-κB pathway. World J. Surg. Oncol. 2020, 18, 328. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Zhang, H.; Wang, H. N1-methyladenosine modification in cancer biology: Current status and future perspectives. Comput. Struct. Biotechnol. J. 2022, 20, 6578–6585. [Google Scholar] [CrossRef] [Scilit]
- Duncan, T.; Trewick, S.C.; Koivisto, P.; Bates, P.A.; Lindahl, T.; Sedgwick, B. Reversal of DNA alkylation damage by two human dioxygenases. Proc. Natl. Acad. Sci. USA 2002, 99, 16660–16665. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Mei, C.; Ma, X.; Du, J.; Wang, J.; Zan, L. m6A Methylases Regulate Myoblast Proliferation, Apoptosis and Differentiation. Animals 2022, 12, 773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.-S.; Xiong, Q.-P.; Peña Perez, S.; Liu, C.; Wei, J.; Le, C.; Zhang, L.; Harada, B.T.; Dai, Q.; Feng, X.; et al. ALKBH7-mediated demethylation regulates mitochondrial polycistronic RNA processing. Nat. Cell Biol. 2021, 23, 684–691. [Google Scholar] [CrossRef] [Scilit]
- Leonardi, A.; Kovalchuk, N.; Yin, L.; Endres, L.; Evke, S.; Nevins, S.; Martin, S.; Dedon, P.C.; Melendez, J.A.; Van Winkle, L.; et al. The epitranscriptomic writer ALKBH8 drives tolerance and protects mouse lungs from the environmental pollutant naphthalene. Epigenetics 2020, 15, 1121–1138. [Google Scholar] [CrossRef] [Scilit]
- Multhoff, G.; Yu, J.; Li, Y.; Wang, T.; Zhong, X. Modification of N6-methyladenosine RNA methylation on heat shock protein expression. PLoS ONE 2018, 13, e0198604. [Google Scholar] [CrossRef] [Scilit]
- Lu, Z.; Ma, Y.; Li, Q.; Liu, E.; Jin, M.; Zhang, L.; Wei, C. The role of N6-methyladenosine RNA methylation in the heat stress response of sheep (Ovis aries). Cell Stress Chaperones 2019, 24, 333–342. [Google Scholar] [CrossRef] [Scilit]
- Jin, J.; Xu, C.; Wu, S.; Wu, Z.; Wu, S.; Sun, M.; Bao, W. m6A Demethylase ALKBH5 Restrains PEDV Infection by Regulating GAS6 Expression in Porcine Alveolar Macrophages. Int. J. Mol. Sci. 2022, 23, 6191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Wang, Z.; Chen, Y.; Ding, H.; Fang, Y.; Ma, X.; Liu, H.; Guo, J.; Zhao, J.; Wang, J.; et al. ALKBH5 Reduces BMP15 mRNA Stability and Regulates Bovine Puberty Initiation Through an m6A-Dependent Pathway. Int. J. Mol. Sci. 2024, 25, 11605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; Ju, X.; Li, K.; Cai, D.; Zhou, Z.; Nie, Q. MeRIP sequencing reveals the regulation of N6-methyladenosine in muscle development between hypertrophic and leaner broilers. Poult. Sci. 2024, 103, 103708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chao, X.; Guo, L.; Ye, C.; Liu, A.; Wang, X.; Ye, M.; Fan, Z.; Luan, K.; Chen, J.; Zhang, C.; et al. ALKBH5 regulates chicken adipogenesis by mediating LCAT mRNA stability depending on m6A modification. BMC Genom. 2024, 25, 634. [Google Scholar] [CrossRef] [Scilit]
- van Wijnen, A.; Shao, F.; Wang, X.; Yu, J.; Jiang, H.; Zhu, B.; Gu, Z. Expression of miR-33 from an SREBF2 Intron Targets the FTO Gene in the Chicken. PLoS ONE 2014, 9, e91236. [Google Scholar] [CrossRef] [Scilit]
- Song, T.; Yang, Y.; Wei, H.; Xie, X.; Lu, J.; Zeng, Q.; Peng, J.; Zhou, Y.; Jiang, S.; Peng, J. Zfp217 mediates m6A mRNA methylation to orchestrate transcriptional and post-transcriptional regulation to promote adipogenic differentiation. Nucleic Acids Res. 2019, 47, 6130–6144. [Google Scholar] [CrossRef] [Scilit]
- Wu, G.; Yan, Y.; Cai, Y.; Peng, B.; Li, J.; Huang, J.; Xu, Z.; Zhou, J. ALKBH1-8 and FTO: Potential Therapeutic Targets and Prognostic Biomarkers in Lung Adenocarcinoma Pathogenesis. Front. Cell Dev. Biol. 2021, 9, 633927. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [Scilit]
- Soding, J. Protein homology detection by HMM-HMM comparison. Bioinformatics 2005, 21, 951–960. [Google Scholar] [CrossRef] [Scilit]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef] [Scilit]
- Li, G.; Luo, W.; Abdalla, B.A.; Ouyang, H.; Yu, J.; Hu, F.; Nie, Q.; Zhang, X. miRNA-223 upregulated by MYOD inhibits myoblast proliferation by repressing IGF2 and facilitates myoblast differentiation by inhibiting ZEB1. Cell Death Dis. 2017, 8, e3094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak KJ, S.T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Fedeles, B.I.; Singh, V.; Delaney, J.C.; Li, D.; Essigmann, J.M. The AlkB Family of Fe(II)/α-Ketoglutarate-dependent Dioxygenases: Repairing Nucleic Acid Alkylation Damage and Beyond. J. Biol. Chem. 2015, 290, 20734–20742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bian, K.; Lenz, S.A.P.; Tang, Q.; Chen, F.; Qi, R.; Jost, M.; Drennan, C.L.; Essigmann, J.M.; Wetmore, S.D.; Li, D. DNA repair enzymes ALKBH2, ALKBH3, and AlkB oxidize 5-methylcytosine to 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxylcytosine in vitro. Nucleic Acids Res. 2019, 47, 5522–5529. [Google Scholar] [CrossRef] [Scilit]
- Gebeyew, K.; Yang, C.; Mi, H.; Cheng, Y.; Zhang, T.; Hu, F.; Yan, Q.; He, Z.; Tang, S.; Tan, Z. Lipid metabolism and m6A RNA methylation are altered in lambs supplemented rumen-protected methionine and lysine in a low-protein diet. J. Anim. Sci. Biotechnol. 2022, 13, 85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Zhu, L.; Chen, J.; Wang, Y. mRNA m6A methylation downregulates adipogenesis in porcine adipocytes. Biochem. Biophys. Res. Commun. 2015, 459, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Feng, S.; Xu, Z.; Peng, J.; Zhang, M. The AlkB Family: Potential Prognostic Biomarkers and Therapeutic Targets in Glioblastoma. Front. Oncol. 2022, 12, 847821. [Google Scholar] [CrossRef] [Scilit]
- Yuan, C.; Geting, W.; Bi, P.; Juanni, L.; Shuangshuang, Z.; Yuanliang, Y.; Zhijie, X. Expression and molecular profiles of the AlkB family in ovarian serous carcinoma. Aging 2021, 13, 9679–9692. [Google Scholar]
- Hongxi, C.; Lei, Z.; Juanni, L.; Kuan, H. ALKBH family members as novel biomarkers and prognostic factors in human breast cancer. Aging 2022, 14, 6579–6593. [Google Scholar]
- Ma, L.; Lu, H.; Tian, Z.; Yang, M.; Ma, J.; Shang, G.; Liu, Y.; Xie, M.; Wang, G.; Wu, W.; et al. Structural insights into the interactions and epigenetic functions of human nucleic acid repair protein ALKBH6. J. Biol. Chem. 2022, 298, 101671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.; Zhao, B.S.; Zhou, A.; Lin, K.; Zheng, S.; Lu, Z.; Chen, Y.; Sulman, E.P.; Xie, K.; Bögler, O.; et al. m6A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell 2017, 31, 591–606.e6. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Zhu, Q. The role of demethylase AlkB homologs in cancer. Front. Oncol. 2023, 13, 1153463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, P.; Gao, S.; Wang, L.; Yu, F.; Li, J.; Wang, C.; Li, J.; Wong, J. ABH2 Couples Regulation of Ribosomal DNA Transcription with DNA Alkylation Repair. Cell Rep. 2013, 4, 817–829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Xing, J.; Liu, D.; Song, Y.; Yu, H.; Xu, S.; Zuo, Y. Review and new insights into the catalytic structural domains of the Fe(ll) and 2-Oxoglutarate families. Int. J. Biol. Macromol. 2024, 278, 134798. [Google Scholar] [CrossRef] [Scilit]
- Xu, B.; Liu, D.; Wang, Z.; Tian, R.; Zuo, Y. Multi-substrate selectivity based on key loops and non-homologous domains: New insight into ALKBH family. Cell. Mol. Life Sci. 2020, 78, 129–141. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Song, C.-X.; He, C.; Zhang, Y. Mechanism and Function of Oxidative Reversal of DNA and RNA Methylation. Annu. Rev. Biochem. 2014, 83, 585–614. [Google Scholar] [CrossRef] [Scilit]
- Cai, B.; Ma, M.; Yuan, R.; Zhou, Z.; Zhang, J.; Kong, S.; Lin, D.; Lian, L.; Li, J.; Zhang, X.; et al. MYH1G-AS is a chromatin-associated lncRNA that regulates skeletal muscle development in chicken. Cell. Mol. Biol. Lett. 2024, 29, 9. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Cheng, B.; Jiang, H.; Zhang, H.; Li, H. N6-methyladenosine demethylase ALKBH5: A novel regulator of proliferation and differentiation of chicken preadipocytes. Acta Biochim. Biophys. Sin. 2021, 54, 55–63. [Google Scholar] [CrossRef] [Scilit]
- Li, K.; Huang, W.; Wang, Z.; Nie, Q. m(6)A demethylase FTO regulate CTNNB1 to promote adipogenesis of chicken preadipocyte. J. Anim. Sci. Biotechnol. 2022, 13, 147. [Google Scholar] [CrossRef] [Scilit]






| Gene Name | Primer Sequences (5′ to 3′) | Annealing Temperature (°C) | Size (bp) |
|---|---|---|---|
| ALKBH1 | F: TCGGCTCTTTCGCTTCTACC | 60 | 91 |
| R: CGATCTGAACACCTGTCCCC | |||
| ALKBH2 | F: GGAGAGTGCTTGCTCCAAGA | 60 | 238 |
| R: CCATCACTCGTCCACATGCT | |||
| ALKBH3 | F: AGTGGTGTGCTTTTGGGTGA | 60 | 157 |
| R: AAGTAGGCCAGGCAAACTCC | |||
| ALKBH4 | F: TGGAGACGTTGTCAGGGAGA | 60 | 187 |
| R: AGCTAAGCCCGTTGATGGAC | |||
| ALKBH5 | F: CCGGAGCCGAACCTTTGT | 60 | 121 |
| R: CTCATGGCCGGCTCGC | |||
| ALKBH8 | F: AACATGAGTCTGCCGAGTGG | 60 | 127 |
| R: CGGTGTTTGACGGGTTTTCC | |||
| FTO | F: AATGGAGCTTATGACGAGCCT | 60 | 199 |
| R: GAAGGGATGGCATTCTGGCT | |||
| GAPDH | F: TCCTCCACCTTTGATGCG | 60 | 146 |
| R: GTGCCTGGCTCACTCCTT |
| Gene Name | Protein ID | Protein Molecular Weight (kDa) | Number of Amino Acids | Isoelectric Point |
|---|---|---|---|---|
| ALKBH1 | NP 001026723.1 | 41.39 | 371 | 8.36 |
| ALKBH2 | NP 001264426.2 | 28.61 | 247 | 9.24 |
| ALKBH3 | NP 001269306.2 | 32.83 | 286 | 6.28 |
| ALKBH4 | XP_046758526.1 | 35.59 | 317 | 6.48 |
| ALKBH5 | NP 001244130.1 | 43.35 | 374 | 9.02 |
| ALKBH8 | XP 004938883.2 | 84.46 | 746 | 8.56 |
| FTO | NP 001172076.1 | 58.89 | 507 | 5.74 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niu, Y.; Li, K.; You, X.; Wu, Y.; Du, X.; Zhao, A.; Wang, Z. Structural Analysis of the AlkB Family in Poultry. Animals 2025, 15, 1942. https://doi.org/10.3390/ani15131942
Niu Y, Li K, You X, Wu Y, Du X, Zhao A, Wang Z. Structural Analysis of the AlkB Family in Poultry. Animals. 2025; 15(13):1942. https://doi.org/10.3390/ani15131942
Chicago/Turabian StyleNiu, Yuling, Kan Li, Xuerong You, Yutao Wu, Xue Du, Ayong Zhao, and Zhijun Wang. 2025. "Structural Analysis of the AlkB Family in Poultry" Animals 15, no. 13: 1942. https://doi.org/10.3390/ani15131942
APA StyleNiu, Y., Li, K., You, X., Wu, Y., Du, X., Zhao, A., & Wang, Z. (2025). Structural Analysis of the AlkB Family in Poultry. Animals, 15(13), 1942. https://doi.org/10.3390/ani15131942

