Next Article in Journal
Emergence of a Recombinant Bovine Enterovirus in China: Insights from Phylogenetic and Temporal Analysis
Previous Article in Journal
Hyperglycemia in Pet African Pygmy Hedgehogs (Atelerix albiventris): Prevalence, Clinical Characteristics, and Prognostic Indicators of Severe Hyperglycemia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 10
10.3390/ani15101456
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Decoding the Function of FGFBP1 in Sheep Adipocyte Proliferation and Differentiation

by
Liming Tian
1,2,†,
Zhaohua He
1,2,†,
Guan Wang
1,
Shuhong Zhang
1,
Tenggang Di
1,3,
Menghan Chang
1,3,
Wei Han
1,2,
Jingyi Gao
1,
Meng Li
1,
Ziyi Wang
1,
Huan Zhang
1,3,
Shaobin Li
2,* and
Guangli Yang
1,2,*
1
College of Biology and Food, Shangqiu Normal University, Shangqiu 476000, China
2
Gansu Key Laboratory of Herbivorous Animal Biotechnology, Faculty of Animal Science and Technology, Gansu Agricultural University, Lanzhou 730070, China
3
College of Animal Science and Technology, Henan Agricultural University, Zhengzhou 450046, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2025, 15(10), 1456; https://doi.org/10.3390/ani15101456
Submission received: 2 April 2025 / Revised: 27 April 2025 / Accepted: 15 May 2025 / Published: 18 May 2025
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Simple Summary

Tail adipose deposition is a crucial economic trait in sheep with fat-tailed and fat-rumped characteristics. This study evaluated the regulatory function of the FGFBP1 gene in the proliferation and differentiation of ovine tail preadipocytes based on gene overexpression and knockdown experiments. FGFBP1 overexpression significantly inhibited cellular proliferation and promoted adipocyte differentiation, whereas gene silencing led to the opposite effects. These findings confirm FGFBP1 as a key regulator of ovine tail adipogenesis. This study offers a novel understanding of the mechanisms of adipose tissue development and identifies a potential molecular target for optimizing tail adipose deposition in sheep.

Abstract

Tail adipose deposition in sheep is an economically significant trait that has an impact on meat quality and reproductive performance. This study elucidates the regulatory mechanism of FGFBP1 in the proliferation and differentiation of ovine tail-derived preadipocytes. Overexpression and knockdown methods were used to establish gain- and loss-of-function models, and the biological effects of FGFBP1 on adipocyte dynamics were systematically assessed. FGFBP1 overexpression significantly inhibited cellular proliferation by cell cycle arrest in the G2/M phase, and, at the same time, promoted adipocyte differentiation by upregulating key adipogenic markers (PPARγ, Adiponectin, C/EBPα, and FABP4). In contrast, gene silencing enhanced the proliferative capacity and decreased lipid droplet accumulation, confirming its inhibitory role in adipogenesis. Our findings indicate that FGFBP1 is a key regulator of tail adipogenesis. This discovery enhances our understanding of the mechanisms of adipocyte differentiation and provides theoretical bases and potential therapeutic targets for optimizing lipid deposition traits in livestock production.

1. Introduction

Sheep (Ovis aries), as one of the earliest domesticated species, have significantly contributed to human society through their provision of wool and meat resources [1,2]. Tail morphology, a critical breed characteristic influencing economic outcomes in fat-tailed and fat-rumped sheep husbandry, is classified into the following five categories based on the fat deposition patterns of sheep and their physical conformations: fat-rumped, short–fat-tailed, long–fat-tailed, short–thin-tailed, and long–thin-tailed [3]. Genetic studies substantiate that modern fat-tailed sheep lineages evolved from ancestral thin-tailed breeds via natural selection and artificial breeding [4,5]. These breeds are globally valued in livestock production for their robust environmental adaptability, disease resistance and high productivity, all of which can be further enhanced under optimal nutritional conditions [6,7]. Fat composition and metabolic regulation determine the flavor profiles and nutritional attributes of mutton products [8]. At the biological level, lipid metabolism networks not only maintain systemic homeostasis in sheep but also play critical roles in nutrient assimilation and physiological health [9,10,11]. However, excessive tail adipose deposition leads to a decrease in the market value by compromising meat quality and inducing reproductive dysfunction. From the perspective of animal production, this condition further reduces the feed conversion efficiency, adversely affecting economic returns [3,11]. Increasing consumer demand for healthier meat products has increased the market preference for low-fat mutton. Although tail docking transiently mitigates caudal fat accumulation, it promotes lipid deposition in subcutaneous and visceral compartments, ultimately degrading the meat quality and feed utilization efficiency [12,13]. This necessitates the identification of genetic regulators and molecular markers associated with tail adipogenesis in sheep.
Fibroblast growth factor-binding protein 1 (FGFBP1) is a secreted chaperone that mobilizes extracellular matrix-bound fibroblast growth factors (FGFs) and facilitates the activation of their receptors. Emerging evidence indicates that FGFBP1 functions as a crucial amplifier of FGF signaling cascades [14], which are known to regulate adipocyte development via multiple pathways. While FGFBP1 has been implicated in developmental processes such as angiogenesis and neural differentiation [14,15,16,17], its specific role in adipocyte biology is poorly understood. This knowledge gap motivated our investigation into how FGFBP1 modulates ovine adipose proliferation and differentiation.
Transcriptomic data analysis of tail adipose tissues from Large-tailed Han sheep and Small-tailed Han sheep suggests that FGFBP1 may play a critical role in tail adipose deposition (unpublished). To elucidate its regulatory mechanisms in ovine tail adipogenesis, we employed Real-Time Quantitative PCR (RT-qPCR), Cell-Counting Kit-8 (CCK-8) cell proliferation assays, 5-ethynyl-2′-deoxyuridine (EdU) staining, and Oil Red O lipid staining to systematically evaluate the effects of FGFBP1 on the proliferation and differentiation of tail-derived adipocytes.

2. Materials and Methods

2.1. Cell Culture

Cryopreserved preadipocytes were thawed at 37 °C in a water bath, mixed with complete medium (Dulbecco’s Modified Eagle Medium/F12, 10% fetal bovine serum, 1% penicillin–streptomycin), centrifuged at 2500 rpm for 3 min, resuspended, and cultured at 37 °C in an environment of 5% CO2.

2.2. Cell Differentiation

Preadipocytes were cultured in 6-well plates until 80% confluence, then induced with differentiation medium A (1.72 μmol/L insulin, 5.10 μmol/L dexamethasone, 0.122 mmol/L IBMX) for 48 h. Cells were subsequently subjected to RT-qPCR analysis. The medium was subsequently replaced with differentiation medium B (1.72 μmol/L insulin) every 48 h for a 12-day adipogenic induction period.

2.3. Cell Transfection

The old medium was replaced with fresh complete medium to ensure optimal nutrient supply. Cell transfection was performed using the Lipo8000™ transfection kit (Beyotime Biotechnology, Shanghai, China) following the manufacturer’s instructions. After transfection, cells were maintained under standard culture conditions (37 °C, 5% CO2) for 24–48 h before harvesting for subsequent experimental analyses. The transfection plasmids, including pcDNA3.1, pcDNA3.1-FGFBP1, si-NC, and si-FGFBP1, were obtained from GenePharm (Shanghai, China).

2.4. Real-Time Quantitative PCR

Total RNA was isolated from cultured cells, and complementary DNA (cDNA) was synthesized using the PrimeScript™ RT Kit (TaKaRa, Dalian, China) in accordance with the manufacturer’s protocol. Gene-specific primers for qPCR were designed with DNAMAN 6.0 software (Table 1). RT-qPCR amplification was conducted using SYBR Green PCR Master Mix (TaKaRa, Dalian, China) on a QuantStudio™ 5 Real-Time PCR system. The relative gene expression levels were quantified using the 2−ΔΔCt analytical method, with β-actin serving as an endogenous control for data normalization. Three technical replicates were performed for each group (n = 3).

2.5. Cell Proliferation Analysis

Cell viability was evaluated using the CCK-8 (Beyotime, Shanghai, China), and the cell proliferation quantity was determined by the EdU assay (Beyotime, Shanghai, China). Cells were seeded in 96-well plates with six independent replicates per group. At 12, 24, 36, and 48 h after culture, 10 μL of CCK-8 reagent was added to each well and incubated at 37 °C for 1 h. Absorbance was measured at 500 nm using a microplate reader (Perkin Elmer, Singapore). Cell proliferation was also assessed using the EdU assay using the BeyoClick™ EdU-594 Cell Proliferation kit (Beyotime, Shanghai, China) according to the manufacturer’s protocol. Three technical replicates were performed for each group (n = 3).

2.6. Cell Cycle Analysis

Overexpression and knockdown experiments were initiated when the cells reached 80% confluency. After 36–48 h of treatment, the cells were harvested by trypsinization for subsequent analysis. All experimental procedures were performed in strict accordance with the manufacturer’s protocols provided in the Cell Cycle and Apoptosis Detection kit (Beyotime, Shanghai, China).

2.7. Oil Red O Staining

After fixing with 4% paraformaldehyde (PFA) for 20 min, Oil Red O staining was performed using a commercially obtained staining kit (Beyotime, Shanghai, China) to visualize lipid deposition. Quantitative analysis was conducted by measuring the absorbance at 500 nm using a spectrophotometer.

2.8. Western Blotting

Cellular proteins were extracted using a protein extraction kit (Beyotime, Shanghai, China). Protein concentrations were determined using a bicinchoninic acid assay kit (Beyotime, Shanghai, China). Protein samples were denatured by boiling in sodium dodecyl sulfate (SDS) loading buffer at 97 °C for 7 min and subsequently loaded onto 12% SDS-PAGE gels for electrophoretic separation. The separated proteins were electrophoretically transferred to polyvinylidene fluoride (PVDF) membranes using a wet transfer system. After the transfer, the membranes were blocked with 5% skim milk in TBST buffer for 1.5 h at room temperature. Next, the membranes were sequentially incubated overnight with the primary antibodies FGFBP1 Rabbit pAb (Catalog #BS-1768R, Bioss Antibodies, Beijing, China) at 4 °C and horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. β-actin was used as an internal control for normalization purposes. Protein bands were visualized using BeyoECL Star chemiluminescent detection reagent (Beyotime, Shanghai, China).

2.9. Statistical Analysis

The data are presented as the mean ± standard deviation. The SPSS 27 software package was used for statistical analysis. The experimental group served as independent variables, while the measured value was the dependent variable. The data were analyzed using an independent-samples t test. The levels of significance were as follows: ns (p > 0.05), * p < 0.05, ** p < 0.01, and *** p < 0.001. GraphPad Prism 9.5 was used for data visualization.

3. Results

3.1. Determination of FGFBP1 Overexpression and Knockdown Efficiency

Cells were transfected with either overexpression constructs (pcDNA3.1-FGFBP1 and empty pcDNA3.1 vector) or siRNA oligonucleotides (specific si-FGFBP1 and non-targeting si-NC) to determine the biological function of FGFBP1 in preadipocytes. RT-qPCR demonstrated that the FGFBP1 mRNA levels were significantly elevated in the overexpression group compared with those in the empty vector control group (p < 0.001) (Figure 1A). Conversely, FGFBP1 knockdown resulted in a marked reduction in mRNA levels relative to the non-targeting control group (p < 0.05) (Figure 1B). Western blotting confirmed the dose-dependent upregulation of the FGFBP1 protein in the overexpression group and its corresponding downregulation in the knockdown group (Figure 1C,D). These findings validate the successful establishment of the FGFBP1 overexpression and knockdown models, providing a foundation for subsequent functional studies.

3.2. Effects of FGFBP1 on the Proliferation of Sheep Preadipocytes

3.2.1. Determination of Proliferation Marker Genes After FGFBP1 Overexpression and Knockdown

The expression patterns of cell proliferation marker genes (CCNB1, Cyclin B3, Cyclin D, and PCNA) in response to FGFBP1 modulation were systematically analyzed. FGFBP1 overexpression significantly downregulated PCNA mRNA expression compared with that in the control group, whereas CCNB1 and Cyclin D exhibited nonsignificant downward trends (Figure 2A). Conversely, FGFBP1 knockdown induced a significant upregulation of CCNB1, Cyclin D, and PCNA expression, with Cyclin B3 levels remaining unaltered (Figure 2B). Notably, changes in PCNA expression, a core component of the DNA replication complex, showed a significant association with alterations in the cell proliferation status.

3.2.2. CCK-8 Assay Results After FGFBP1 Overexpression and Knockdown

The viability of preadipocytes was quantified using the CCK-8 assay. After FGFBP1 overexpression, a statistically significant reduction in cell viability was noted at both the 12 and 48 h time points relative to the corresponding controls (Figure 3A). Conversely, FGFBP1 knockdown led to a progressive increase in cell viability under similar experimental conditions (Figure 3B).

3.2.3. EdU Assay Results After FGFBP1 Overexpression and Knockdown

The EdU assay was used to further evaluate the effects of FGFBP1 on cell proliferation. The fluorescence intensity was determined using a microplate reader approximately 24 h after transfection. A significant increase in the number of proliferating cells was noted in si-FGFBP1-transfected cells (Figure 4B), whereas no statistically significant changes in proliferation were observed in cells transfected with pcDNA3.1-FGFBP1 (Figure 4A).

3.3. Effects of FGFBP1 Overexpression and Knockdown on the Cell Cycle

Flow cytometry was used to determine the effects of FGFBP1 on cell cycle progression. FGFBP1 overexpression did not induce significant changes in the G1 phase population, but resulted in a decreased proportion of cells in the S phase and an accumulation of cells in the G2 phase compared to that in the control group (Figure 5A–C). These findings suggest that FGFBP1 overexpression promoted cell cycle arrest in the G2/M phase, suppressing cellular proliferation. Conversely, FGFBP1 knockdown led to no notable changes in the G1 phase population, but a significant reduction in the G2 phase population along with an increase in the S phase fraction population were noted (Figure 5D–F). This finding indicates accelerated DNA replication and premature entry into mitosis, collectively demonstrating an enhanced proliferative capacity. Thus, FGFBP1 overexpression inhibited cellular proliferation, whereas FGFBP1 knockdown alleviated this inhibitory effect.

3.4. Effects of FGFBP1 on the Differentiation of Sheep Preadipocytes

3.4.1. Effects of FGFBP1 Overexpression and Knockdown on Cell Differentiation

Gain- and loss-of-function experiments were conducted using FGFBP1 overexpression and knockdown to elucidate the regulatory role of FGFBP1 in ovine preadipocyte differentiation. The expression dynamics of key adipogenic markers, including PPARγ, Adiponectin, C/EBPα, and FABP4, were systematically monitored at 48 h. FGFBP1 overexpression significantly upregulated the PPARγ and FABP4 transcripts (Figure 6A), whereas FGFBP1 knockdown substantially suppressed the expression of PPARγ, Adiponectin, C/EBPα, and FABP4 (Figure 6B).

3.4.2. Oil Red O Staining Analysis After FGFBP1 Overexpression and Knockdown

Oil Red O was used to stain lipid droplets and assess the adipogenic differentiation of preadipocytes. FGFBP1 overexpression significantly promoted lipid droplet accumulation in preadipocytes (Figure 7A–C). Conversely, FGFBP1 knockdown markedly reduced the lipid droplet content (Figure 7D–F). These findings indicated the critical regulatory role of FGFBP1 in preadipocyte differentiation. Changes in its expression levels directly modulated the extent of lipid droplet accumulation, thereby influencing adipocyte differentiation.

4. Discussion

This study is the first of its kind to present evidence of the dual regulatory function of FGFBP1 in modulating the proliferation and differentiation processes in ovine tail adipocytes. FGFBP1 knockdown significantly upregulated the expression of the proliferation-associated genes (CCNB1, Cyclin D, and PCNA) in preadipocytes, whereas its overexpression suppressed the levels of these proliferative markers. These findings were in accordance with the S-phase arrest determined using flow cytometry and were validated using complementary CCK-8 and EdU assays. These assays collectively confirmed the inhibitory role of FGFBP1 in preadipocyte proliferation. Notably, while genetic manipulation elicited significant transcriptional effects, the corresponding protein-level alterations were undetected in this study. Therefore, subsequent studies should use western blotting to elucidate the potential post-transcriptional regulatory mechanisms.
As a member of the FGFBP family [17,18], FGFBP1 functions as a critical modulator of FGF signaling [19,20,21]. Its capacity to bind multiple FGF ligands (including FGF1, FGF2, FGF7, FGF10, and FGF22) enhances FGF receptor interaction and subsequent signal transduction [22]. Several studies have established FGFBP1 as an oncogenic factor within the tumor microenvironment by virtue of its activation of proliferative FGFR signaling pathways [23,24,25,26], a mechanism consistent with the well-documented pro-proliferative effects observed in various cancer models [27,28]. In contrast, our finding uncovered a distinct biological role of FGFBP1 in adipocytes, demonstrating its potential to regulate adipocyte differentiation through the preferential activation of FGFR subtypes associated with differentiation control. This tissue-dependent functional dichotomy may arise from the selective engagement of microenvironment-specific FGFR isoforms by FGFBP1, as supported by previous findings [22,29,30]. Furthermore, our findings revealed that FGFBP1 overexpression significantly upregulated PPARγ expression, which was contradictory to the established adipogenesis inhibition mediated by Twist1 [31]. We hypothesized that FGFBP1 might circumvent the inhibitory influence of Twist1 through activation of the PI3K/AKT-mTOR signaling cascade, thereby directly enhancing the transcriptional activation of adipocyte-specific genes.
In contrast to its antiproliferative activity, FGFBP1 exhibits potent pro-differentiation effects. Knockdown attenuated key adipogenic markers (PPARγ, Adiponectin, C/EBPα, FABP4) and lipid droplet formation, whereas overexpression amplified differentiation markers and lipid accumulation. Temporal discrepancies between the gene expression patterns and Oil Red O staining outcomes suggested that lipid droplet maturation required the accumulation of differentiation regulators at a certain threshold. From the perspective of meat science, balanced adipocyte differentiation facilitates optimal intra-muscular fat distribution, whereas excessive proliferation may induce connective tissue hyperplasia [32,33,34,35]. The dual regulatory capacity of FGFBP1—simultaneously curbing proliferation while enhancing differentiation—could critically influence the meat quality of sheep by modulating the intramuscular versus tail fat ratio, thereby affecting tenderness and the deposition of flavor compounds. Despite these mechanistic insights, several paradoxes warrant resolution. First, the concurrent enhancement of proliferation and the impairment of differentiation after knockdown implies potential stage-specific regulatory functions that are reminiscent of developmental gene expression patterns [36]. Second, the pro-adipogenic activity of FGFBP1 contradicts the antiadipogenic effects of classical FGF signaling [37,38], possibly reflecting the selective mobilization of specific FGF isoforms rather than the activation of canonical mitogenic pathways.
From the viewpoint of livestock breeding applications, the current study presents a groundbreaking perspective regarding the development of low-adiposity sheep varieties. The targeted modulation of FGFBP1 expression can fine-tune caudal adipose deposition, potentially addressing the challenges of ectopic lipid accumulation associated with conventional tail docking practices [39,40], demonstrating substantial practical applications. However, critical consideration must be given to the pleiotropic functions of the gene in regulating angiogenesis and systemic metabolism [15,41,42], which may exert collateral effects on multiple physiological processes. Consequently, further studies should prioritize the development of transgenic animal models to comprehensively assess the longitudinal impacts on myofiber development and meat characteristics for the thorough evaluation of its potential use in breeding applications while maintaining genomic safety.

5. Conclusions

This study elucidates the dual regulatory function of FGFBP1 in ovine caudal adipose tissue dynamics, demonstrating inhibitory effects on preadipocyte proliferation and promoting adipocyte differentiation. From an agricultural standpoint, the strategic modulation of FGFBP1 expression may enable the precise regulation of ovine adipose distribution by selectively reducing caudal fat deposition while maintaining intramuscular adipogenesis, a critical determinant of meat palatability and market value. This molecular approach presents a potential alternative to traditional tail-docking practices, thereby circumventing the adverse effects associated with conventional physical interventions on lipid homeostasis. However, the pleiotropic nature of FGFBP1 signaling necessitates the comprehensive evaluation of potential off-target effects before practical implementation in a real-world setting.

Author Contributions

Conceptualization, L.T., Z.H., and G.W.; methodology, G.W.; validation, M.L., L.T., Z.W., and J.G.; formal analysis, H.Z. and M.C.; data curation, L.T., W.H., and T.D.; writing—original draft preparation, L.T. and Z.H.; writing—review and editing, S.L. and G.Y.; visualization, L.T. and S.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32202620), the Henan Province Basic and Frontier Project (102300410143, 132300410398), the Henan Province Science and Technology Tackle Key Problems Project (09210211088, 212102110001, 222102110422, 252102110076), Henan Provincial Department of Education Key Research and Development Project (25A230006), the Science and Technology Project of Gansu Province (23JDKA0010).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets produced or examined in the course of this research are fully contained within the manuscript. The data supporting the conclusions of this study can be obtained from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ma, Z.; Wang, W.; Zhang, D.; Zhang, Y.; Zhao, Y.; Li, X.; Zhao, L.; Lin, C.; Wang, J.; Zhou, B.; et al. Ovine Rap1gap and Rbat Gene Polymorphisms and Their Association with Tail Fat Deposition in Hu Sheep. Front. Vet. Sci. 2022, 9, 974513. [Google Scholar] [CrossRef] [PubMed]
  2. Ma, R.; Lu, Y.; Li, M.; Gao, Z.; Li, D.; Gao, Y.; Deng, W.; Wang, B. Whole-Genome Resequencing in Sheep: Applications in Breeding, Evolution, and Conservation. Genes 2025, 16, 363. [Google Scholar] [CrossRef] [PubMed]
  3. Lu, Z.; Liu, J.; Han, J.; Yang, B. Association between Bmp2 Functional Polymorphisms and Sheep Tail Type. Animals 2020, 10, 739. [Google Scholar] [CrossRef] [PubMed]
  4. Moradi, M.H.; Nejati-Javaremi, A.; Moradi-Shahrbabak, M.; Dodds, K.G.; McEwan, J.C. Genomic Scan of Selective Sweeps in Thin and Fat Tail Sheep Breeds for Identifying of Candidate Regions Associated with Fat Deposition. BMC Genet. 2012, 13, 10. [Google Scholar] [CrossRef]
  5. Mansourizadeh, H.; Bakhtiarizadeh, M.R.; de Almeida Regitano, L.C.; Bruscadin, J.J. Fat-Tail Allele-Specific Expression Genes May Affect Fat Deposition in Tail of Sheep. PLoS ONE 2024, 19, e0316046. [Google Scholar] [CrossRef]
  6. Li, B.; Qiao, L.; An, L.; Wang, W.; Liu, J.; Ren, Y.; Pan, Y.; Jing, J.; Liu, W. Transcriptome Analysis of Adipose Tissues from Two Fat-Tailed Sheep Breeds Reveals Key Genes Involved in Fat Deposition. BMC Genom. 2018, 19, 338. [Google Scholar] [CrossRef]
  7. Amane, A.; Belay, G.; Kebede, A.; Dessie, T.; Worku, S.; Hanotte, O.; Vila, E. Analysis of Tail Morphology and Osteology in Ethiopian Indigenous Sheep. J. Archaeol. Sci. Rep. 2023, 47, 103776. [Google Scholar] [CrossRef]
  8. Ding, W.; Lu, Y.; Xu, B.; Chen, P.; Li, A.; Jian, F.; Yu, G.; Huang, S. Meat of Sheep: Insights into Mutton Evaluation, Nutritive Value, Influential Factors, and Interventions. Agriculture 2024, 14, 1060. [Google Scholar] [CrossRef]
  9. Chu, Y.; Gómez Rosso, L.; Huang, P.; Wang, Z.; Xu, Y.; Yao, X.; Bao, M.; Yan, J.; Song, H.; Wang, G. Liver Med23 Ablation Improves Glucose and Lipid Metabolism Through Modulating FOXO1 Activity. Cell Res. 2014, 24, 1250–1265. [Google Scholar] [CrossRef]
  10. Bandyopadhyay, G.K.; Lu, M.; Avolio, E.; Siddiqui, J.A.; Gayen, J.R.; Wollam, J.; Vu, C.U.; Chi, N.W.; O’Connor, D.T.; Mahata, S.K. Pancreastatin-Dependent Inflammatory Signaling Mediates Obesity-Induced Insulin Resistance. Diabetes 2015, 64, 104–116. [Google Scholar] [CrossRef]
  11. Jiang, Y.; Xie, M.; Chen, W.; Talbot, R.; Maddox, J.F.; Faraut, T.; Wu, C.; Muzny, D.M.; Li, Y.; Zhang, W.; et al. The Sheep Genome Illuminates Biology of the Rumen and Lipid Metabolism. Science 2014, 344, 1168–1173. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, Q.; Wang, Y.; Hussain, T.; Dai, C.; Li, J.; Huang, P.; Li, Y.; Ding, X.; Huang, J.; Ji, F.; et al. Effects of Dietary Energy Level on Growth Performance, Blood Parameters and Meat Quality in Fattening Male Hu Lambs. J. Anim. Physiol. Anim. Nutr. 2020, 104, 418–430. [Google Scholar] [CrossRef] [PubMed]
  13. Schumacher, M.; DelCurto-Wyffels, H.; Thomson, J.; Boles, J. Fat Deposition and Fat Effects on Meat Quality—A Review. Animals 2022, 12, 1550. [Google Scholar] [CrossRef]
  14. Schmidt, M.O.; Garman, K.A.; Lee, Y.G.; Zuo, C.; Beck, P.J.; Tan, M.; Aguilar-Pimentel, J.A.; Ollert, M.; Schmidt-Weber, C.; Fuchs, H.; et al. The Role of Fibroblast Growth Factor-Binding Protein 1 in Skin Carcinogenesis and Inflammation. J. Investig. Dermatol. 2018, 138, 179–188. [Google Scholar] [CrossRef] [PubMed]
  15. Cottarelli, A.; Corada, M.; Beznoussenko, G.V.; Mironov, A.A.; Globisch, M.A.; Biswas, S.; Huang, H.; Dimberg, A.; Magnusson, P.U.; Agalliu, D.; et al. Fgfbp1 Promotes Blood-Brain Barrier Development by Regulating Collagen IV Deposition and Maintaining Wnt/β-Catenin Signaling. Development 2020, 147, dev185140. [Google Scholar] [CrossRef]
  16. Ben-Zvi, A.; Liebner, S. Developmental Regulation Of Barrier- and Non-Barrier Blood Vessels in the CNS. J. Intern. Med. 2022, 292, 31–46. [Google Scholar] [CrossRef]
  17. Taetzsch, T.; Brayman, V.L.; Valdez, G. FGF Binding Proteins (FGFBPs): Modulators of FGF Signaling in the Developing, Adult, and Stressed Nervous System. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 2983–2991. [Google Scholar] [CrossRef]
  18. Hindson, J. Fgfbp1(+) Cells: Upper Crypt Intestinal Epithelial Regeneration. Nat. Rev. Gastroenterol. Hepatol. 2024, 21, 534. [Google Scholar] [CrossRef]
  19. Wang, F.; Luo, M.; Qu, H.; Cheng, Y. BAP1 Promotes Viability and Migration of ECA109 Cells Through KLF5/CyclinD1/FGF-BP1. FEBS Open Bio 2021, 11, 1497–1503. [Google Scholar] [CrossRef]
  20. Qiu, T.; Hou, L.; Zhao, L.; Wang, X.; Zhou, Z.; Yang, C.; Zhang, H.; Jiang, D.; Jiao, B.; Chen, C. SGCE Promotes Breast Cancer Stemness by Promoting the Transcription of FGF-BP1 by Sp1. J. Biol. Chem. 2023, 299, 105351. [Google Scholar] [CrossRef]
  21. Zhang, L.; Li, L.; Chen, X.; Yuan, S.; Xu, T.; Zhao, W.; Li, M.; Wang, F.; Hoffman, R.M.; Jia, L. Evodiamine Inhibits ESCC by Inducing M-Phase Cell-Cycle Arrest via CUL4A/p53/p21 Axis and Activating Noxa-Dependent Intrinsic and DR4-Dependent Extrinsic Apoptosis. Phytomedicine 2023, 108, 154493. [Google Scholar] [CrossRef] [PubMed]
  22. Varier, K.M.; Dan, G.; Li, X.; Liu, W.; Jiang, F.; Linghu, K.G.; Li, Y.; Ben-David, Y.; Zhang, N.; Xiao, C.; et al. B4 Suppresses Lymphoma Progression by Inhibiting Fibroblast Growth Factor Binding Protein 1 Through Intrinsic Apoptosis. Front. Pharmacol. 2024, 15, 1408389. [Google Scholar] [CrossRef] [PubMed]
  23. Qi, M.; Fan, S.; Huang, M.; Pan, J.; Li, Y.; Miao, Q.; Lyu, W.; Li, X.; Deng, L.; Qiu, S.; et al. Targeting FAPα-Expressing Hepatic Stellate Cells Overcomes Resistance to Antiangiogenics in Colorectal Cancer Liver Metastasis Models. J. Clin. Investig. 2022, 132, e157399. [Google Scholar] [CrossRef] [PubMed]
  24. Ruan, R.; Li, L.; Li, X.; Huang, C.; Zhang, Z.; Zhong, H.; Zeng, S.; Shi, Q.; Xia, Y.; Zeng, Q.; et al. Unleashing the Potential of Combining FGFR Inhibitor and Immune Checkpoint Blockade for FGF/FGFR Signaling in Tumor Microenvironment. Mol. Cancer 2023, 22, 60. [Google Scholar] [CrossRef]
  25. Yang, Y.; Zhang, L.; Munyurangabo, G.; Zhou, Y.; He, S.; Zhang, P.; Yu, X.; Kong, G. Deficiency of the Histone H3K36 Methyltransferase SETD2 Inhibits the Proliferation and Migration of Hepatocellular Carcinoma Cells. J. Cancer 2024, 15, 6479–6489. [Google Scholar] [CrossRef]
  26. Lin, H.; Hassan Safdar, M.; Washburn, S.; Akhand, S.S.; Dickerhoff, J.; Ayers, M.; Monteiro, M.; Solorio, L.; Yang, D.; Wendt, M.K. Fibroblast Growth Receptor 1 is Regulated by G-Quadruplex in Metastatic Breast Cancer. Commun. Biol. 2024, 7, 963. [Google Scholar] [CrossRef]
  27. Huang, W.; Chen, Z.; Shang, X.; Tian, D.; Wang, D.; Wu, K.; Fan, D.; Xia, L. Sox12, a Direct Target of FoxQ1, Promotes Hepatocellular Carcinoma Metastasis Through Up-Regulating Twist1 and FGFBP1. Hepatology 2015, 61, 1920–1933. [Google Scholar] [CrossRef]
  28. Baba, H.; Kanda, M.; Sawaki, K.; Nakamura, S.; Ueda, S.; Shimizu, D.; Koike, M.; Kodera, Y.; Fujii, T. SLC7A9 as a Potential Biomarker for Lymph Node Metastasis of Esophageal Squamous Cell Carcinoma. Ann. Surg. Oncol. 2022, 29, 2699–2709. [Google Scholar] [CrossRef]
  29. Edirisinghe, O.; Ternier, G.; Alraawi, Z.; Suresh Kumar, T.K. Decoding FGF/FGFR Signaling: Insights into Biological Functions and Disease Relevance. Biomolecules 2024, 14, 1622. [Google Scholar] [CrossRef]
  30. Edirisinghe, O.; Kumar, T.K.S. Pathology and Therapeutic Significance of Fibroblast Growth Factors. Targets 2025, 3, 5. [Google Scholar] [CrossRef]
  31. Sun, L.; Ji, S.; Xie, X.; Si, L.; Liu, S.; Lin, Y.; Wang, Y.; Song, Z.; Fang, N.; An, Y.; et al. Deciphering the Interaction between Twist1 and PPARγ during Adipocyte Differentiation. Cell Death Dis. 2023, 14, 764. [Google Scholar] [CrossRef] [PubMed]
  32. Lee, M.; Park, S.; Choi, B.; Choi, W.; Lee, H.; Lee, J.M.; Lee, S.T.; Yoo, K.H.; Han, D.; Bang, G.; et al. Cultured Meat with Enriched Organoleptic Properties by Regulating Cell Differentiation. Nat. Commun. 2024, 15, 77. [Google Scholar] [CrossRef]
  33. Horwitz, A.; Birk, R. Adipose Tissue Hyperplasia and Hypertrophy in Common and Syndromic Obesity—The Case of BBS Obesity. Nutrients 2023, 15, 3445. [Google Scholar] [CrossRef] [PubMed]
  34. Pierezan, M.D.; Verruck, S. Cattle, Swine, Poultry and Fish Cells for Meat Production: Addressing Challenges of Co-Culture and the Innovative Approaches for Muscle and Fat Integration. Curr. Opin. Food Sci. 2024, 60, 101230. [Google Scholar] [CrossRef]
  35. Muir, L.A.; Neeley, C.K.; Meyer, K.A.; Baker, N.A.; Brosius, A.M.; Washabaugh, A.R.; Varban, O.A.; Finks, J.F.; Zamarron, B.F.; Flesher, C.G.; et al. Adipose Tissue Fibrosis, Hypertrophy, and Hyperplasia: Correlations with Diabetes in Human Obesity. Obesity 2016, 24, 597–605. [Google Scholar] [CrossRef]
  36. Qu, L.; Shen, M.; Guo, J.; Wang, X.; Dou, T.; Hu, Y.; Li, Y.; Ma, M.; Wang, K.; Liu, H. Identification of Potential Genomic Regions and Candidate Genes for Egg Albumen Quality by a Genome-Wide Association Study. Arch. Anim. Breed. 2019, 62, 113–123. [Google Scholar] [CrossRef]
  37. Struik, D.; Dommerholt, M.B.; Jonker, J.W. Fibroblast Growth Factors in Control of Lipid Metabolism: From Biological Function to Clinical Application. Curr. Opin. Lipidol. 2019, 30, 235–243. [Google Scholar] [CrossRef]
  38. Nies, V.J.; Sancar, G.; Liu, W.; van Zutphen, T.; Struik, D.; Yu, R.T.; Atkins, A.R.; Evans, R.M.; Jonker, J.W.; Downes, M.R. Fibroblast Growth Factor Signaling in Metabolic Regulation. Front. Endocrinol. 2015, 6, 193. [Google Scholar] [CrossRef]
  39. Yue, Y.; Cheng, X.; Zhao, S.G.; Liu, Z.; Liu, L.S.; Zhou, R.; Wu, J.P.; Brown, M.A. Effects of Tail Docking on the Expression of Genes Related to Lipid Metabolism in Lanzhou Fat-Tailed Sheep. Genet. Mol. Res. 2016, 15, gmr.15017323. [Google Scholar] [CrossRef]
  40. Janssen, J. The Causal Role of Ectopic Fat Deposition in the Pathogenesis of Metabolic Syndrome. Int. J. Mol. Sci. 2024, 25, 13238. [Google Scholar] [CrossRef]
  41. Zhu, H.Y.; Bai, W.D.; Liu, J.Q.; Zheng, Z.; Guan, H.; Zhou, Q.; Su, L.L.; Xie, S.T.; Wang, Y.C.; Li, J.; et al. Up-Regulation of FGFBP1 Signaling Contributes to miR-146a-Induced Angiogenesis in Human Umbilical Vein Endothelial Cells. Sci. Rep. 2016, 6, 25272. [Google Scholar] [CrossRef] [PubMed]
  42. Tassi, E.; McDonnell, K.; Gibby, K.A.; Tilan, J.U.; Kim, S.E.; Kodack, D.P.; Schmidt, M.O.; Sharif, G.M.; Wilcox, C.S.; Welch, W.J.; et al. Impact of Fibroblast Growth Factor-Binding Protein-1 Expression on Angiogenesis and Wound Healing. Am. J. Pathol. 2011, 179, 2220–2232. [Google Scholar] [CrossRef] [PubMed]
Animals 15 01456 g001
Figure 1. Validation of FGFBP1 overexpression and knockdown efficiency in cultured cells. (A) Quantitative analysis of FGFBP1 mRNA levels following genetic overexpression. (B) Assessment of FGFBP1 mRNA reduction efficiency after targeted knockdown. (C,D) Protein validation after overexpression and knockdown. Statistical significance is denoted as follows: * p < 0.05, and *** p < 0.001.
Figure 1. Validation of FGFBP1 overexpression and knockdown efficiency in cultured cells. (A) Quantitative analysis of FGFBP1 mRNA levels following genetic overexpression. (B) Assessment of FGFBP1 mRNA reduction efficiency after targeted knockdown. (C,D) Protein validation after overexpression and knockdown. Statistical significance is denoted as follows: * p < 0.05, and *** p < 0.001.
Animals 15 01456 g001
Animals 15 01456 g002
Figure 2. Proliferation of marker genes. (A) Effect of FGFBP1 overexpression on proliferation marker genes. (B) Effect of FGFBP1 knockdown on proliferation marker genes. Statistical significance is denoted as follows: ns (p > 0.05), * p < 0.05, and *** p < 0.001.
Figure 2. Proliferation of marker genes. (A) Effect of FGFBP1 overexpression on proliferation marker genes. (B) Effect of FGFBP1 knockdown on proliferation marker genes. Statistical significance is denoted as follows: ns (p > 0.05), * p < 0.05, and *** p < 0.001.
Animals 15 01456 g002
Animals 15 01456 g003
Figure 3. CCK-8 assay results following FGFBP1 overexpression and knockdown. (A) Effect of FGFBP1 overexpression on pre-adipocyte viability. (B) Effect of FGFBP1 knockdown on pre-adipocyte viability. Statistical significance is denoted as follows: * p < 0.05.
Figure 3. CCK-8 assay results following FGFBP1 overexpression and knockdown. (A) Effect of FGFBP1 overexpression on pre-adipocyte viability. (B) Effect of FGFBP1 knockdown on pre-adipocyte viability. Statistical significance is denoted as follows: * p < 0.05.
Animals 15 01456 g003
Animals 15 01456 g004
Figure 4. Changes in cell number following FGFBP1 overexpression and knockdown as detected by EdU assay. (A) Cell proliferation following FGFBP1 overexpression. (B) Cell proliferation following FGFBP1 knockdown. Statistical significance is denoted as follows: ns (p > 0.05), * p < 0.05.
Figure 4. Changes in cell number following FGFBP1 overexpression and knockdown as detected by EdU assay. (A) Cell proliferation following FGFBP1 overexpression. (B) Cell proliferation following FGFBP1 knockdown. Statistical significance is denoted as follows: ns (p > 0.05), * p < 0.05.
Animals 15 01456 g004
Animals 15 01456 g005
Figure 5. Flow cytometry analysis of cell cycle changes following FGFBP1 overexpression and knockdown. (A) Cell cycle profile of pcDNA3.1-transfected cells. (B) Cell cycle profile of pcDNA3.1-FGFBP1-transfected cells. (C) Quantitative analysis of the cell cycle after FGFBP1 overexpression. (D) Cell cycle profile of si-NC-transfected cells. (E) Cell cycle profile of si-FGFBP1-transfected cells. (F) Quantitative analysis of the cell cycle after FGFBP1 knockdown. Statistical significance is denoted as follows: ** p < 0.01 and *** p < 0.001.
Figure 5. Flow cytometry analysis of cell cycle changes following FGFBP1 overexpression and knockdown. (A) Cell cycle profile of pcDNA3.1-transfected cells. (B) Cell cycle profile of pcDNA3.1-FGFBP1-transfected cells. (C) Quantitative analysis of the cell cycle after FGFBP1 overexpression. (D) Cell cycle profile of si-NC-transfected cells. (E) Cell cycle profile of si-FGFBP1-transfected cells. (F) Quantitative analysis of the cell cycle after FGFBP1 knockdown. Statistical significance is denoted as follows: ** p < 0.01 and *** p < 0.001.
Animals 15 01456 g005
Animals 15 01456 g006
Figure 6. Changes in differentiation marker genes following FGFBP1 overexpression and knockdown. (A) Effect of FGFBP1 overexpression on differentiation marker genes. (B) Effect of FGFBP1 knockdown on differentiation marker genes. Statistical significance is denoted as follows: * p < 0.05, ** p < 0.01 and *** p < 0.001.
Figure 6. Changes in differentiation marker genes following FGFBP1 overexpression and knockdown. (A) Effect of FGFBP1 overexpression on differentiation marker genes. (B) Effect of FGFBP1 knockdown on differentiation marker genes. Statistical significance is denoted as follows: * p < 0.05, ** p < 0.01 and *** p < 0.001.
Animals 15 01456 g006
Animals 15 01456 g007
Figure 7. Results of Oil Red O staining after FGFBP1 overexpression and knockdown. (A) Image of pcDNA3.1 transfection. (B) Image of pcDNA3.1-FGFBP1 transfection. (C) Quantitative analysis of adipogenesis via spectrophotometric measurement of Oil Red O content at 500 nm wavelength. (D) Image of si-NC transfection. (E) Image of si-FGFBP1 transfection. (F) Quantitative analysis of adipogenesis via spectrophotometric measurement of Oil Red O content at 500 nm wavelength. Statistical significance is denoted as follows: * p < 0.05 and ** p < 0.01.
Figure 7. Results of Oil Red O staining after FGFBP1 overexpression and knockdown. (A) Image of pcDNA3.1 transfection. (B) Image of pcDNA3.1-FGFBP1 transfection. (C) Quantitative analysis of adipogenesis via spectrophotometric measurement of Oil Red O content at 500 nm wavelength. (D) Image of si-NC transfection. (E) Image of si-FGFBP1 transfection. (F) Quantitative analysis of adipogenesis via spectrophotometric measurement of Oil Red O content at 500 nm wavelength. Statistical significance is denoted as follows: * p < 0.05 and ** p < 0.01.
Animals 15 01456 g007
Table 1. RT-qPCR primers.
Table 1. RT-qPCR primers.
GeneGene IDPrimer Sequence (5′–3′)
FGFBP1XM_004010004.5F: CCTCCTCCTTCTGGCTGTTCTG
R: TGCTTGGTTGGCTGGCTCCT
CCNB1XM_027980034.1F: CCCTCCAGAAATCGGTGACT
R: AGCTCAACATCAACCTCTCCA
Cyclin B3XM_012106700.4F: GCTTGTCCAACACCGTCACCAT
R: ACCTCCACCAACCAGTCCACAA
Cyclin DNM_001127289.1F: GGGATTGGGAGGTGCTGGTCTT
R: AGGTCTGGGCGTGCTTCTTGA
PCNAXM_004014340.5F: GCTCAAGTGGCGTGAACCTACA
R: TACGGTCGCAGCGGTAAGTGT
PPARγNM_001100921.1F: TGCCGATTCCAGAAGTGCCTTG
R: TCGCCCTCGCCTTTGCTTTG
AdiponectinNM_001308565.1F: AACCACTATGACGGCACCACTG
R: ATAGAGGAGCACGGAGCCAGAG
C/EBPαNM_001308574.1F: ATGAGCAGCCACCTCCAGAG
R: GCCAGGAACTCGTCGTTGAAG
FABP4NM_001114667.1F: AGGAAAGTGGCTGGCATGGC
R: CTGGTAGCAGTGACACCGTTCA
β-actinNM_001009784.3F: GCAGGTCATCACCATCGGCAAT
R: CGTGTTGGCGTAGAGGTCCTTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tian, L.; He, Z.; Wang, G.; Zhang, S.; Di, T.; Chang, M.; Han, W.; Gao, J.; Li, M.; Wang, Z.; et al. Decoding the Function of FGFBP1 in Sheep Adipocyte Proliferation and Differentiation. Animals 2025, 15, 1456. https://doi.org/10.3390/ani15101456

AMA Style

Tian L, He Z, Wang G, Zhang S, Di T, Chang M, Han W, Gao J, Li M, Wang Z, et al. Decoding the Function of FGFBP1 in Sheep Adipocyte Proliferation and Differentiation. Animals. 2025; 15(10):1456. https://doi.org/10.3390/ani15101456

Chicago/Turabian Style

Tian, Liming, Zhaohua He, Guan Wang, Shuhong Zhang, Tenggang Di, Menghan Chang, Wei Han, Jingyi Gao, Meng Li, Ziyi Wang, and et al. 2025. "Decoding the Function of FGFBP1 in Sheep Adipocyte Proliferation and Differentiation" Animals 15, no. 10: 1456. https://doi.org/10.3390/ani15101456

APA Style

Tian, L., He, Z., Wang, G., Zhang, S., Di, T., Chang, M., Han, W., Gao, J., Li, M., Wang, Z., Zhang, H., Li, S., & Yang, G. (2025). Decoding the Function of FGFBP1 in Sheep Adipocyte Proliferation and Differentiation. Animals, 15(10), 1456. https://doi.org/10.3390/ani15101456

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop