Next Article in Journal
Association Analysis of SLC11A1 Polymorphisms with Somatic Cell Score in Chinese Holstein Cows
Previous Article in Journal
Innovative Approaches to Avoid Antibiotic Use in Equine Semen Cryopreservation: Advancing Sustainable Reproductive Technologies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 10
10.3390/ani15101369
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Weaning Stress Aggravates Defense Response and the Burden of Protein Metabolism in Low-Birth-Weight Piglets

by
Peipei Wang
1,2,†,
Jinwei Zhang
3,†,
Yihang Tian
1,2,
Bing Yu
1,2,
Jun He
1,2,
Jie Yu
1,2 and
Ping Zheng
1,2,*
1
Institute of Animal Nutrition, Sichuan Agricultural University, Chengdu 611130, China
2
Key Laboratory of Animal Disease-Resistant Nutrition, Chengdu 611130, China
3
Department of Quality Management and Inspection & Quarantine, Yibin University, Yibin 644000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2025, 15(10), 1369; https://doi.org/10.3390/ani15101369
Submission received: 18 April 2025 / Revised: 4 May 2025 / Accepted: 7 May 2025 / Published: 9 May 2025
(This article belongs to the Section Animal Nutrition)
Browse Figures
Versions Notes

Simple Summary

The reasons for the significant decline in growth performance of low-birth-weight piglets after weaning remain incompletely characterized. This study aimed to investigate the underlying mechanism of this phenomenon. The results demonstrated that the stress resistance capacity of low-birth-weight piglets reached its peak at weaning. Furthermore, weaning stress increased the protein metabolic burden in low-birth-weight piglets, leading to metabolic dysregulation and further impairment of intestinal barrier function. This study suggests that low-birth-weight piglets exhibit impaired weaning adaptability, and strategies such as delaying weaning and reducing dietary protein levels may help alleviate this condition.

Abstract

The effect of low birth weight (LBW) on piglet development has been widely demonstrated. However, the reasons for the significant decline in the growth performance of LBW piglets after weaning remain poorly understood. This study aimed to investigate the underlying mechanisms of this phenomenon. At 21 days of age, 24 normal-birth-weight (NBW) piglets and 24 LBW piglets were selected and divided into four groups—NBW control, NBW weaning, LBW control, and LBW weaning—with 12 replicates per group (1 piglet per replicate). Control groups were euthanized on the same day, while weaning groups were weaned and sampled 3 days later. The results showed that the body weight of NBW piglets increased, whereas that of LBW piglets decreased, after 3 days of weaning. Compared with NBW piglets, LBW piglets exhibited higher serum cortisol concentrations and lower villus height (p < 0.05). Weaning stress significantly increased serum cortisol and C-reactive protein concentrations in NBW piglets (p < 0.05), while no significant changes were observed in LBW piglets. However, weaning stress significantly increased serum blood urea nitrogen (BUN) concentrations (p < 0.05) in LBW piglets but not in NBW piglets. Additionally, weaning stress reduced the mRNA expressions of Occludin, Claudin-1, and Claudin-2 in the jejunum of NBW piglets (p < 0.05), as well as Occludin in the jejunum of LBW piglets (p < 0.05). Furthermore, weaning stress reduced the mRNA expressions of IL-6, TLR9, MyD88, TRIF and p65 NF-κB in the jejunum of NBW piglets (p < 0.05). In LBW piglets, weaning stress decreased the mRNA expressions of IL-2, TNF-α, NLRP3, TLR9, and NOD2 (p < 0.05). In conclusion, compared to NBW piglets, LBW piglets are more susceptible to weaning stress-induced protein metabolic disorders and intestinal barrier dysfunction, ultimately leading to impaired immune function and reduced growth performance. The results underscore the importance of tailored management strategies for piglets based on birth weight to mitigate weaning stress impacts.

1. Introduction

With the development of the livestock industry and the genetic selection for high reproductive performance, the average litter size of sows has significantly increased. Elevated litter sizes exert increased demands on sow uterine capacity [1,2]. Insufficient maternal provision to meet fetal developmental requirements may induce intrauterine growth restriction (IUGR), consequently resulting in a significantly higher proportion of low-birth-weight (LBW) piglets within the affected litter [3,4,5,6,7]. LBW piglets, typically defined as those with a birth weight below 1.0 kg, have a higher mortality rate before weaning [8,9]. This condition has led to substantial economic losses in the pig industry.
The small intestine plays a pivotal role in nutrient metabolism, serving as the primary site for digestion and absorption, as well as acting as a critical defense barrier. It is generally believed that improving animal production performance is closely related to improving intestinal function [10]. Currently, the impact of LBW on the intestinal health of piglets has received extensive attention. Previous studies have indicated that the growth retardation in LBW piglets is partly caused by impaired small intestine function [11]. Subsequent studies have demonstrated that intestinal dysfunction in LBW piglets is associated with impaired intestinal morphology and physical barriers, as well as increased intestinal permeability [12,13,14]. Greater villus height and a higher villus height-to-crypt depth (V/C) ratio indicate more advanced development of the digestive tract in piglets, enhancing their growth performance and digestive capacity [15]. In addition, the intestinal tract is recognized as the largest immune organ in piglets, containing a higher number of immune cells and tissues, which are significant for maintaining the intestinal health of piglets. Recent studies have shown that elevated levels of pro-inflammatory cytokines in the intestine and reduced expression of immune-related genes might be partly responsible for intestinal dysfunction in LBW piglets [16,17]. The impaired intestinal function of LBW piglets reduces nutrient absorption capacity [18]. This leads to excess nutrients reaching the hindgut, promoting the overgrowth of harmful microorganisms and disrupting microbial homeostasis [19,20]. Since the intestinal immune system maintains microbial homeostasis under normal conditions [21], this microbial imbalance indicates further deterioration of intestinal immune function in LBW piglets.
Weaning stress is one of the greatest challenges that piglets encounter. Many studies have reported the effects of weaning on normal-birth-weight (NBW) piglets, including reduced feed intake, impaired intestinal function, and weakened immune function [22,23]. In contrast, research on the impact of weaning stress on LBW piglets is limited. Although all piglets have difficulty adapting to a post-weaning diet, this is particularly prominent in LBW piglets. A comparative analysis of feed intake, growth rate, and feed conversion rate between NBW and LBW piglets after weaning demonstrated that LBW piglets were prone to negative growth after weaning [24,25]. Michiels et al. found that LBW piglets suffer from delayed gastrointestinal maturation after weaning stress [26], manifested by lower small intestine weight-to-length ratios, reduced oxidation capacity, and lower digestive capacity. Therefore, the effects of weaning stress may vary depending on the birth weight of the piglets, with lighter piglets inherently more susceptible to weaning stress than heavier ones. However, the reasons for the different effects of weaning stress on LBW piglets and NBW piglets remain unclear. Therefore, this study aims to explore why LBW piglets perform poorly after weaning and how weaning stress exacerbates the adverse effects of LBW in piglets.

2. Materials and Methods

2.1. Experimental Design and Animal Management

The study protocol received approval from the Animal Experimental Committee of Sichuan Agricultural University (SAU20200321). The study was conducted at the Animal Experiment Center of Sichuan Tieqi Breeding Co., Ltd., located in Mianyang, China.
LBW piglets are defined as piglets with birth weights below 1.0 kg, while NBW piglets are defined as those whose birth weights within the mean range of the entire litter (within ± 1.0 SEM), as detailed in our previous study [27]. A total of 30 NBW and 30 LBW piglets were selected from 30 sows with similar parity (3rd–5th parity). On day 1, each piglet was ear-tagged and subjected to routine procedures, including tail docking and tooth clipping. To minimize inter-group variation caused by differences between litters, 24 NBW piglets (6.16 ± 0.03 kg) and 24 LBW piglets (3.65 ± 0.07 kg) were selected. The piglets were grouped based on similar average body weights, with litters randomized and a sex ratio of 1:1. The groups included the NBW control group, NBW weaning group, LBW control group, and LBW weaning group, with 12 replicates per group, each consisting of 1 piglet. All sows and piglets used in the experiment were healthy, vaccinated, and free of infectious diseases. The control groups were sampled at 21 days old, while the weaning groups were sampled 3 days after weaning. During the experiment, the experimental piglets were uniformly fed with creep feed (Supplementary Table S1) as supplementary feeding treatment.

2.2. Sample Collection

Blood samples were collected from the anterior vena cava into non-heparinized vacuum tubes. After centrifugation (3500× g, 10 min, 4 °C), the serum was separated and stored at −20 °C for subsequent analysis of serum parameters. Following blood collection, piglets were euthanized with a lethal dose of sodium pentobarbital (200 mg/kg of BW) following procedures outlined in a previous study [28], and the abdomens were immediately incised to collect intestinal samples. The entire small intestine was excised and divided into three segments: duodenum, jejunum, and ileum, as previously described by Zheng et al. [29]. Approximately 2 cm segments of the proximal jejunum were immediately isolated, and preserved in 4% paraformaldehyde solution after being rinsed, for histological analysis. Subsequently, 10 cm segments of jejunum were emptied, rinsed, and placed on an ice-cold surface. The jejunal mucosa was scraped using glass microscope slide, and the samples were frozen in liquid nitrogen and stored at −80 °C for further analysis. Additionally, digesta from the middle of cecum and colon were collected and stored at −80 °C for microbial and metabolite analysis.

2.3. Serum Physiochemical Parameters

Serum cortisol (COR), blood urea nitrogen (BUN), and C-reactive protein (CRP) concentrations were measured using enzymatic colorimetric methods, following the instructions provided by commercial assay kits (Nanjing Jiancheng Co., Ltd., Nanjing, China).

2.4. Determination of Histological Analysis

Jejunum morphology was analyzed according to the method described by Wang et al. [30]. Briefly, samples were fixed in neutral buffered formaldehyde, dehydrated, and embedded in paraffin. Four transverse sections (5 μm) were cut, mounted on slides, and stained with hematoxylin-eosin. Villus height and crypt depth were quantified using an Olympus CK 40 microscope (Olympus Optical Company, Shenzhen, China). A minimum of 10 intact villi and associated crypts from each intestinal segment were measured.

2.5. Total RNA Extraction and Real-Time Quantitative PCR

Jejunum mucosal samples (approximately 0.1 g) were homogenized in 1 mL RNAiso Plus reagent (TaKaRa, Dalian, China) to extract total RNA according to the manufacturer’s instructions. RNA concentration and quality were assessed using a Beckman Coulter DU 800 spectrophotometer (Beckman Coulter Inc., Brea, CA, USA). First-strand complementary DNA (cDNA) was synthesized from each sample using the Prime ScriptTM RT reagent kit (TaKaRa, Dalian, China) following the manufacturer’s protocol.
Specific primers for zonula occludens-1 (ZO-1), zonula occludens-2 (ZO-2), Occludin, Claudin-1, Claudin-2, interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), NOD-like receptor thermal protein domain associated protein 3 (NLRP3), interleukin-18 (IL-18), Caspase-1, Toll-like receptor 4 (TLR4), Toll-like receptor 9 (TLR9), nucleotide binding oligomerization domain (NOD)-like receptor 1 (NOD1), NOD-like receptor 2 (NOD2), myeloid differentiation factor 88 (MyD88), tumor necrosis factor receptor-associated factor 6 (TRAF6), TIR domain–containing adaptoc–inducing IFN-β (TRIF), p38 mitogen-activated protein kinase (p38 MAPK), interferon regulatory factor 3 (IRF3), and p65 nuclear factor kappa B (p65 NF-κB) were designed and purchased from Invitrogen (Shanghai, China). Primer sequences are listed in Table 1.
Real-time PCR reactions were conducted using a CFX96TM Real-Time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with a SYBR Green PCR reagent kit (TaKaRa, Dalian, China). The amplification was carried out with the following cycling conditions: an initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s (denaturation), annealing at the appropriate temperature for 25 s, and a final extension at 72 °C for 5 s. Melting curve analysis was performed after each quantitative PCR to confirm the specificity and purity of the PCR products.
The β-actin gene was employed as the reference gene to normalize cDNA loading. To calculate amplification efficiencies, a 10-fold serial dilution was performed to generate standard curves for both the target and reference genes, using six different concentrations. After verification, the primers exhibited an amplification efficiency of approximately 100%. The results were calculated using the 2−ΔΔCt method [31]. Analysis of each standard and sample was run in triplicate simultaneously on the same PCR plate, and the average of each triplicate value expressed as the number of copies was used for subsequent statistical analysis.

2.6. DNA Extraction and Quantification of Intestinal Microflora

Microbial genomic DNA was extracted from approximately 0.2 g of digesta samples using the E.Z.N.A stool DNA kit (Omega Bio-tek, Doraville, GA, USA) according to the manufacturer’s instructions. Primers and probes (Table 2) targeting total bacteria, Escherichia coli (E. coli), Lactobacillus, and Bacillus were designed based on the studies by Fierer et al. and Qi et al. [32,33], and were commercially synthesized by Invitrogen (Shanghai, China). Quantitative real-time PCR was conducted using a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
To determine the total bacteria, the thermal cycling conditions were as follows: an initial pre-denaturation at 95 °C for 10 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 25 s, and extension at 72 °C for 60 s.
Real-time PCR for the quantification of Lactobacillus, E. coli, Bifidobacterium, and Bacillus was performed in a 20 μL reaction volume, consisting of 1 μL probe enhancer solution, 0.3 μL probe, 1 μL forward primer, 1 μL reverse primer, 8 μL RealMasterMix (Tiangen, Beijing, China), 1 μL template DNA, and 7.7 μL ultrapure water. The PCR protocol included an initial denaturation at 95 °C for 10 s, followed by 50 cycles consisting of 5 s at 95 °C, 25 s at the annealing temperature, and 60 s at 72 °C. Copies per sample were calculated using the threshold cycle (CT) values and standard curve based on previous work by Xiang et al. [34].

2.7. Statistical Analysis

The data were analyzed using Tukey’s multiple comparisons for the 2 × 2 factorial experimental design, using the General Linear Model (GLM) procedure in SPSS statistical software (Ver.20.0 for Windows, SPSS; IBM, Armonk, NY, USA) with pen as the experimental unit (n = 12). The results are presented as means ± standard error of the mean (SEM). Statistical significance was determined with an α-level of 0.05, where p < 0.05 indicated a significant difference and 0.05 ≤ p < 0.10 indicated a tendency.

3. Results

3.1. Body Weight of Piglets

Compared with NBW piglets, LBW piglets had lower (p < 0.05) body weight. After 3 days of weaning, the weight of NBW piglets increased by 210 g, while LBW piglets’ body weight decreased by 100 g (Table 3).

3.2. Physicochemical Parameters in Serum

Figure 1 shows the serum physicochemical parameters in NBW and LBW piglets. Compared with NBW piglets, LBW piglets had higher (p < 0.05) concentrations of serum COR. Weaning stress increased serum COR and CRP concentrations in NBW piglets (p < 0.05) but had no significant effect on LBW piglets (p > 0.05). Weaning stress increased BUN concentrations in LBW piglets (p < 0.05) but had no significant impact on NBW piglets (p > 0.05). However, the concentrations of BUN of LBW weaning piglets were higher (p < 0.05) than that of NBW weaning piglets.

3.3. Intestinal Morphology

The morphological data of the jejunum are summarized in Table 4. Compared with NBW piglets, LBW piglets had lower (p < 0.05) villus height. Weaning stress significantly reduced both jejunal villus height and villus height/crypt depth in NBW piglets (p < 0.05), with a concurrent significant reduction in villus height/crypt depth observed in LBW piglets (p < 0.05).

3.4. Gene Expression of Tight Junction Proteins

As shown in Figure 2, it was found that compared with NBW piglets, LBW piglets had lower (p < 0.05) mRNA expression of Claudin-1 in the jejunum. Weaning stress significantly decreased the mRNA expression of Occludin, Claudin-1, and Claudin-2 in the jejunum of NBW piglets (p < 0.05), and also reduced jejunum Occludin mRNA expression of LBW piglets (p < 0.05). There was a significant (p < 0.05) interaction effect of birth weight and weaning stress on the mRNA expression of Claudin-2.

3.5. Gene Expression of Inflammation-Related Genes

As shown in Figure 3, the results showed that compared with NBW piglets, LBW piglets had higher (p < 0.05) mRNA expression of Caspase-1 and TNF-α in the jejunum. Weaning stress decreased (p < 0.05) mRNA expressions of IL-6 in the jejunum of NBW piglets. Weaning stress increased (p < 0.05) mRNA expressions of IFN-γ, and decreased (p < 0.05) mRNA expressions of IL-2, TNF-α, and NLRP3 in the jejunum of LBW piglets. There was a significant interaction (p < 0.05) effect of birth weight and weaning stress on mRNA expressions of TNF-α.

3.6. Gene Expression of Immune-Related Genes

As shown in Figure 4, the results showed that birth weight had no significant effect on the expression of immune-related genes in the jejunum of piglets. After weaning, the mRNA expressions of TLR9, MyD88, TRIF, and p65 NF-κB in the jejunum of NBW piglets were significantly decreased (p < 0.05). The mRNA expressions of TLR9 and NOD2 in the jejunum of LBW piglets were significantly decreased (p < 0.05).

3.7. Intestinal Microbiota

As shown in Table 5, the results showed birth weight had a significant effect (p < 0.05) on the abundance of E. coli in the cecal digesta of piglets. Compared with pre-weaning levels, post-weaning LBW piglets showed a significant increase in E. coli abundance in cecal digesta (p < 0.05). Furthermore, the abundance of E. coli in the cecal digesta of LBW weaned piglets was higher (p < 0.05) than that of NBW weaned piglets.

4. Discussion

In order to reduce the sow production cycle and improve the breeding efficiency, early weaning is usually adopted in the pig industry. Typically, early weaning occurs between 21 and 28 days of age [35]. Early weaning exposes piglets to a variety of health challenges, including maternal and littermate separations, changes in diet, intestinal damage, digestive disorders, energy metabolism disturbances, and immune dysfunction [23,36,37]. These challenges are particularly pronounced in LBW piglets, which exhibit a higher risk of infection and a lower overall survival rate compared to NBW piglets [38,39]. Our results demonstrated that the weight of NBW piglets increased after weaning, while the weight of LBW piglets decreased. This disparity in post-weaning growth performance between LBW and NBW piglets may be attributed to their distinct physiological and molecular responses to weaning stress. The potential reasons for the huge difference in growth between NBW and LBW piglets after weaning are as follows:
First, the anti-stress ability of LBW piglets peaks at weaning. Previous studies have revealed that weaning stress can change the endocrine system of piglets, thereby affecting the function of the hypothalamic–pituitary–adrenal axis, increasing serum COR concentrations [40,41,42]. Consequently, changes in cortisol levels can serve as an indicator for diagnosing stress in piglets [43]. Similarly, CRP, an acute-phase serum protein, plays a role in innate and adaptive immunity [44]. Serum CRP levels can reflect the presence of inflammation and infection in pigs [45]. According to Wang et al., piglets with post-weaning diarrhea exhibit higher stress levels, as indicated by elevated concentrations of CRP and COR, compared to healthy piglets [46]. Our study revealed that the serum COR concentrations of LBW piglets were significantly higher than those of NBW piglets before weaning. This result indicates that LBW piglets are already under stress before weaning. The concentrations of COR and CRP in NBW piglet serum increased significantly 3 days after weaning. This indicates that NBW piglets were subjected to weaning stress, consistent with a previous study [47]. However, the concentrations of COR and CRP in LBW piglets did not significantly increase after weaning, likely because their stress tolerance had already peaked prior to weaning and they were in a state of immune exhaustion, rendering them incapable of coping with additional weaning stress.
Second, weaning stress can further increase the protein metabolism load of LBW piglets, resulting in abnormal protein metabolism. BUN is a serum by-product of protein catabolism, and its level reflects the body’s protein metabolism and amino acid utilization efficiency [48,49]. This research showed that BUN concentrations were higher in LBW piglets than in NBW piglets. Moreover, weaning stress significantly increased BUN concentrations in LBW piglets. Increased BUN concentrations are associated with decreased protein synthesis and increased protein catabolism [50]. Therefore, it can be speculated that LBW increases nitrogen metabolism in piglets, which negatively affects protein deposition. Furthermore, weaning stress can increase BUN concentrations in piglets [51,52]. Combined with the post-weaning weight loss observed in LBW piglets, these findings suggest that weaning stress impairs dietary protein utilization. Excessive dietary protein will further aggravate the metabolic burden, suggesting that LBW piglets should not be fed high-protein diets.
Third, weaning stress leads to a further weakening in the intestinal functions of LBW piglets. Our study demonstrated significantly reduced jejunum villus height in LBW piglets, indicating delayed intestinal morphological development that likely compromises nutrient absorption capacity. Normal epithelial barrier function primarily relies on tight junctions (TJs), which serve as both ion channels and barriers against harmful molecules [53]. After weaning, the mRNA expression levels of tight junction proteins, including Occludin, Claudin-1, and Claudin-2, were significantly downregulated in NBW piglets, while Occludin expression levels were also decreased in LBW piglets. Due to the strong correlation between mRNA expression and tight junction protein levels, the observed downregulation of these markers suggests that weaning stress impairs intestinal barrier function in piglets [54,55]. Previous studies found that the expression of tight junction proteins in the jejunum of NBW and LBW piglets decreased significantly [56,57]. However, the damaged proteins of NBW and LBW piglets were different, which may have different mechanisms. Furthermore, the gut microbiota is often referred to as an “additional forgotten organ,” playing a crucial role in maintaining intestinal barrier integrity in animals. Weaning stress compromises intestinal barrier function by reducing the expression of tight junction proteins, which makes the intestinal tract of piglets more vulnerable to the invasion of pathogenic microorganisms such as E. coli [58,59,60,61]. Additionally, during the early weaning phase, the immature digestive system of piglets limits their capacity to fully digest and absorb dietary nutrients. This incomplete digestion provides a substrate for the overgrowth of pathogenic bacteria, which further disrupts the intestinal microbial barrier and exacerbates intestinal dysfunction [17,62]. Studies have found that pathogenic Escherichia coli is more likely to colonize the intestinal tract of piglets, thereby triggering the occurrence of intestinal immune and inflammatory responses and reducing intestinal health [63,64]. In this study, the abundance of E. coli in cecal digesta of LBW piglets increased significantly after weaning compared to pre-weaning levels, and the abundance of E. coli in cecal digesta of LBW weaned piglets was significantly higher than that of NBW weaned piglets. Thus, it is hypothesized that weaning stress in LBW piglets disrupts intestinal barrier function and gut microbiota balance, particularly E. coli abundance, further impairing intestinal development. Compared to NBW piglets, LBW piglets show more severe responses to weaning stress, indicating their greater vulnerability.
Meanwhile, weaning stress leads to an imbalance in inflammation and immune response in LBW piglets. Caspase-1, a best-characterized inflammatory caspase, serves as the central effector protein of the inflammasome and plays a critical role in mediating inflammatory responses [65]. In the present study, we observed elevated expression of Caspase-1 in LBW piglets before weaning, which may indicate an activated inflammasome pathway and a potential state of low-grade intestinal inflammation [66]. Following weaning stress, distinct patterns of inflammatory responses were observed between NBW and LBW piglets. In NBW piglets, weaning led to a reduction in the expression of IL-6, suggesting a potential attenuation of pro-inflammatory signaling. In contrast, LBW piglets exhibited increased expression of IFN-γ alongside inhibition of the TNF-α and NLRP3 pathways, as evidenced by the downregulation of IL-2, TNF-α and NLRP3. These findings suggest that LBW piglets may experience immune suppression or immune depletion after weaning, whereas NBW piglets may mount a more localized or transient inflammatory response. Further analysis revealed that LBW piglets may mitigate excessive inflammation through the inhibition of TNF-α, albeit at the cost of compromised immune defense capabilities. Additionally, weaning stress differentially impacted immune signaling pathways in NBW and LBW piglets. In NBW piglets, the TLR9/MyD88/NF-κB pathway was suppressed, while NOD1 expression exhibited an upregulation trend, suggesting a potential shift toward intracellular pathogen recognition [67]. The inhibition of the TLR9/NOD2 pathway in LBW piglets may impair innate immune responses, thereby increasing susceptibility to infections [68,69]. These results demonstrate the divergent immune adaptations of NBW and LBW piglets to weaning stress and underscore the need for targeted nutritional or management strategies to support LBW piglets during this critical period. In summary, our findings indicate that LBW adversely affects intestinal structure, immune function, and inflammatory status in piglets, and weaning stress exacerbates these adverse effects. LBW impairs the development of the small intestine, leading to reduced digestion and absorption of nutrients [70]. Previous research by De Vos et al. demonstrated that milk-derived bioactive compounds promote gastrointestinal development, suggesting that supplementing LBW piglets with milk replacers could enhance gastrointestinal maturation and function [7]. Furthermore, dietary supplementation with L-arginine has been shown to improve intestinal development and support growth performance in LBW piglets [27]. Therefore, to address the challenges associated with LBW, we recommend providing LBW piglets with milk replacers or supplementing their diet with L-arginine.

5. Conclusions

This study confirmed that LBW negatively impacts intestinal mucosal structure, immunity, and inflammatory status in piglets. Meanwhile, the anti-stress ability of LBW piglets peaked at weaning. Furthermore, weaning stress increases the protein metabolism load of LBW piglets, leading to metabolic abnormalities, and further weakened intestinal function. These results contribute to a better understanding of the reasons for the poor growth performance of LBW piglets after weaning. Based on our findings, the intestinal barrier dysfunction of LBW piglets is particularly pronounced at weaning, concomitant with increased metabolic burden. Therefore, it is necessary to improve LBW piglets’ weaning adaptation either through delayed weaning or by reducing dietary protein levels to support their healthy development.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani15101369/s1, Table S1: Composition and nutrient levels of creep feed.

Author Contributions

P.Z. and B.Y. conceived and designed the trial; Y.T. and P.W. performed animal experiments; J.H., J.Y. and P.W. assisted with all the data analyses; P.W. and J.Z. wrote the manuscript. J.Z. revised the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Sichuan Science and Technology Program (2021ZDZX0009).

Institutional Review Board Statement

All animal work of this study was approved by the Sichuan Agricultural University animal welfare committee and carried out in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data generated and analyzed during this study can be obtained from the corresponding author upon reasonable request. The data are not publicly accessible to safeguard privacy and protect intellectual property.

Acknowledgments

We would like to express sincere gratitude to the Sichuan Science and Technology Program (2021ZDZX0009) and all the people who helped us in the experiment.

Conflicts of Interest

This manuscript has not been published, presented, or considered for publication elsewhere, either in part or in whole. We have reviewed and fully understand the journal’s policies, and we affirm that neither the manuscript nor the study violates any of these policies. There are no conflicts of interest to declare.

References

  1. Yuan, T.L.; Zhu, Y.H.; Shi, M.; Li, T.T.; Li, N.; Wu, G.Y.; Bazer, F.W.; Zhang, J.J.; Wang, F.L.; Wang, J.J. Within-litter variation in birth weight: Impact of nutritional status in the sow. J. Zhejiang Univ. Sci. B 2015, 16, 417–435. [Google Scholar] [CrossRef]
  2. Foxcroft, G.R.; Dixon, W.T.; Novak, S.; Putman, C.T.; Town, S.C.; Vinsky, M.D.A. The biological basis for prenatal programming of postnatal performance in pigs. J. Anim. Sci. 2006, 84 (Suppl. 13), E105–E112. [Google Scholar] [CrossRef] [PubMed]
  3. Wu, G.; Bazer, F.W.; Wallace, J.M.; Spencer, T.E. Board-invited review: Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci. 2006, 84, 2316–2337. [Google Scholar] [CrossRef]
  4. Riddersholm, K.V.; Bahnsen, I.; Bruun, T.S.; de Knegt, L.V.; Amdi, C. Identifying risk factors for low piglet birth weight, high within-litter variation and occurrence of intrauterine growth-restricted piglets in hyperprolific sows. Animals 2021, 11, 2731. [Google Scholar] [CrossRef] [PubMed]
  5. Bazer, F.W.; Spencer, T.E.; Wu, G.; Cudd, T.A.; Meininger, C.J. Maternal nutrition and fetal development. J. Nutr. 2004, 134, 2169–2172. [Google Scholar] [CrossRef] [PubMed]
  6. Li, Y.; Zhang, H.; Chen, Y.P.; Ying, Z.X.; Su, W.P.; Zhang, L.L.; Wang, T. Effects of dietary l-methionine supplementation on the growth performance, carcass characteristics, meat quality, and muscular antioxidant capacity and myogenic gene expression in low birth weight pigs. J. Anim. Sci. 2017, 95, 3972–3983. [Google Scholar]
  7. De Vos, M.; Che, L.; Huygelen, V.; Willemen, S.; Michiels, J.; Van Cruchten, S.; Van Ginneken, C. Nutritional interventions to prevent and rear low-birthweight piglets. J. Anim. Physiol. Anim. Nutr. 2014, 98, 609–619. [Google Scholar] [CrossRef]
  8. Alonso-Spilsbury, M.; Ramírez-Necoechea, R.; González-Lozano, M.; Mota-Rojas, D.; Trujillo-Ortega, M.E. Piglet survival in early lactation: A review. J. Anim. Vet. Adv. 2007, 6, 76–86. [Google Scholar]
  9. Milligan, B.N.; Dewey, C.E.; de Grau, A.F. Neonatal-piglet weight variation and its relation to pre-weaning mortality and weight gain on commercial farms. Prev. Vet. Med. 2002, 56, 119–127. [Google Scholar] [CrossRef]
  10. Dowarah, R.; Verma, A.K.; Agarwal, N.; Singh, P.; Singh, B.R. Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets. PLoS ONE 2018, 13, e0192978. [Google Scholar] [CrossRef]
  11. Wiyaporn, M.; Thongsong, B.; Kalandakanond-Thongsong, S. Growth and small intestine histomorphology of low and normal birth weight piglets during the early suckling period. Livest. Sci. 2013, 158, 215–222. [Google Scholar] [CrossRef]
  12. D’Inca, R.; Gras-Le Guen, C.; Che, L.; Sangild, P.T.; Le Huërou-Luron, I. Intrauterine growth restriction delays feeding-induced gut adaptation in term newborn pigs. Neonatology 2011, 99, 208–216. [Google Scholar] [CrossRef]
  13. Alvarenga, A.L.N.; Chiarini-Garcia, H.; Cardeal, P.C.; Moreira, L.P.; Foxcroft, G.R.; Fontes, D.O.; Almeida, F.R.C.L. Intra-uterine growth retardation affects birthweight and postnatal development in pigs, impairing muscle accretion, duodenal mucosa morphology and carcass traits. Reprod. Fert. Develop. 2013, 25, 387–395. [Google Scholar] [CrossRef]
  14. Ayuso, M.; Irwin, R.; Walsh, C.; Van Cruchten, S.; Van Ginneken, C. Low birth weight female piglets show altered intestinal development, gene expression, and epigenetic changes at key developmental loci. FASEB J. 2021, 35, e21522. [Google Scholar] [CrossRef] [PubMed]
  15. Anonye, B.O. General commentary on: Alternatives to antibiotic growth promoters in animals. Front. Vet. Sci. 2016, 3, 74. [Google Scholar] [CrossRef]
  16. Fouhse, J.M.; Tsoi, S.; Clark, B.; Gartner, S.; Patterson, J.L.; Foxcroft, G.R.; Willing, B.P.; Dyck, M.K. Outcomes of a low birth weight phenotype on piglet gut microbial composition and intestinal transcriptomic profile. Can. J. Anim. Sci. 2019, 100, 47–58. [Google Scholar] [CrossRef]
  17. Tang, X.; Xiong, K. Intrauterine growth retardation affects intestinal health of suckling piglets via altering intestinal antioxidant capacity, glucose uptake, tight junction, and immune responses. Oxid. Med. Cell Longev. 2022, 2022, 2644205. [Google Scholar] [CrossRef]
  18. Li, N.; Wang, W.; Wu, G.; Wang, J. Nutritional support for low birth weight infants: Insights from animal studies. Brit. J. Nutr. 2017, 117, 1390–1402. [Google Scholar] [CrossRef]
  19. Li, N.; Huang, S.; Jiang, L.; Wang, W.; Li, T.; Zuo, B.; Li, Z.; Wang, J. Differences in the gut microbiota establishment and metabolome characteristics between low-and normal-birth-weight piglets during early-life. Front. Microbiol. 2018, 9, 1798. [Google Scholar] [CrossRef]
  20. Ming, D.; Wang, W.; Huang, C.; Wang, Z.; Shi, C.; Ding, J.; Liu, H.; Wang, F. Effects of weaning age at 21 and 28 days on growth performance, intestinal morphology and redox status in piglets. Animals 2021, 11, 2169. [Google Scholar] [CrossRef]
  21. Nowland, T.L.; Plush, K.J.; Barton, M.; Kirkwood, R.N. Development and function of the intestinal microbiome and potential implications for pig production. Animals 2019, 9, 76. [Google Scholar] [CrossRef] [PubMed]
  22. Moeser, A.J.; Ryan, K.A.; Nighot, P.K.; Blikslager, A.T. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 293, G413–G421. [Google Scholar] [CrossRef]
  23. Upadhaya, S.D.; Kim, I.H. The impact of weaning stress on gut health and the mechanistic aspects of several feed additives contributing to improved gut health function in weanling piglets—A review. Animals 2021, 11, 2418. [Google Scholar] [CrossRef]
  24. Gondret, F.; Lefaucheur, L.; Louveau, I.; Lebret, B.; Pichodo, X.; Le Cozler, Y. Influence of piglet birth weight on postnatal growth performance, tissue lipogenic capacity and muscle histological traits at market weight. Livest. Prod. Sci. 2005, 93, 137–146. [Google Scholar] [CrossRef]
  25. Nissen, P.M.; Oksbjerg, N. Birth weight and postnatal dietary protein level affect performance, muscle metabolism and meat quality in pigs. Animal 2011, 5, 1382–1389. [Google Scholar] [CrossRef] [PubMed]
  26. Michiels, J.; De Vos, M.; Missotten, J.; Ovyn, A.; De Smet, S.; Van Ginneken, C. Maturation of digestive function is retarded and plasma antioxidant capacity lowered in fully weaned low birth weight piglets. Brit. J. Nutr. 2013, 109, 65–75. [Google Scholar] [CrossRef]
  27. Zheng, P.; Song, Y.; Tian, Y.; Zhang, H.; Yu, B.; He, J.; Mao, X.; Yu, J.; Luo, Y.; Luo, J.; et al. Dietary arginine supplementation affects intestinal function by enhancing antioxidant capacity of a nitric oxide–independent pathway in low-birth-weight piglets. J. Nutr. 2018, 148, 1751–1759. [Google Scholar] [CrossRef]
  28. Chen, H.; Mao, X.; He, J.; Yu, B.; Huang, Z.; Yu, J.; Zheng, P.; Chen, D. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Brit. J. Nutr. 2013, 110, 1837–1848. [Google Scholar] [CrossRef]
  29. Zheng, P.; Yu, B.; He, J.; Yu, J.; Mao, X.; Luo, Y.; Luo, J.; Huang, Z.; Tian, G.; Zeng, Q.; et al. Arginine metabolism and its protective effects on intestinal health and functions in weaned piglets under oxidative stress induced by diquat. Brit. J. Nutr. 2017, 117, 1495–1502. [Google Scholar] [CrossRef]
  30. Wang, X.; Zhu, Y.; Feng, C.; Lin, G.; Wu, G.; Li, D.; Wang, J. Innate differences and colostrum-induced alterations of jejunal mucosal proteins in piglets with intra-uterine growth restriction. Br. J. Nutr. 2018, 119, 734–747. [Google Scholar] [CrossRef]
  31. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  32. Fierer, N.; Jackson, J.A.; Vilgalys, R.; Jackson, R.B. Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assays. Appl. Environ. Microb. 2005, 71, 4117–4120. [Google Scholar] [CrossRef] [PubMed]
  33. Qi, H.; Xiang, Z.; Han, G.; Yu, B.; Huang, Z.; Chen, D. Effects of different dietary protein sources on cecal microflora in rats. Afr. J. Biotechnol. 2011, 10, 3704–3708. [Google Scholar]
  34. Xiang, Z.; Qi, H.; Han, G.; Liu, J.; Huang, Z.; Yu, B.; Chen, D. Real-time TaqMan polymerase chain reaction to quantify the effects of different sources of dietary starch on Bifidobacterium in the intestinal tract of piglets. Afr. J. Biotechnol. 2011, 10, 5059–5067. [Google Scholar]
  35. Kuller, W.I.; Soede, N.M.; van Beers-Schreurs, H.M.G.; Langendijk, P.; Taverne, M.A.M.; Verheijden, J.H.M.; Kemp, B. Intermittent suckling: Effects on piglet and sow performance before and after weaning. J. Anim. Sci. 2004, 82, 405–413. [Google Scholar] [CrossRef] [PubMed]
  36. Pié, S.; Lalles, J.P.; Blazy, F.; Laffitt, J.; Sève, B.; Oswald, I.P. Weaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets. J. Nutr. 2004, 134, 641–647. [Google Scholar]
  37. Moeser, A.J.; Pohl, C.S.; Rajput, M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim. Nutr. 2017, 3, 313–321. [Google Scholar] [CrossRef]
  38. Douglas, S.L.; Edwards, S.A.; Sutcliffe, E.; Knap, P.W.; Kyriazakis, I. Identification of risk factors associated with poor lifetime growth performance in pigs. J. Anim. Sci. 2013, 91, 4123–4132. [Google Scholar] [CrossRef]
  39. Bæk, O.; Ren, S.; Brunse, A.; Sangild, P.T.; Nguyen, D.N. Impaired neonatal immunity and infection resistance following fetal growth restriction in preterm pigs. Front. Immunol. 2020, 11, 1808. [Google Scholar] [CrossRef]
  40. Jarvis, S.; D’Eath, R.B.; Robson, S.K.; Lawrence, A.B. The effect of confinement during lactation on the hypothalamic–pituitary–adrenal axis and behaviour of primiparous sows. Physiol. Behav. 2006, 87, 345–352. [Google Scholar] [CrossRef]
  41. Yu, C.; Chen, C.; Chang, C. The immediate effects of weaning stress on the hypothalamus-pituitary-adrenal alteration of newly weaned piglets. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1218–1223. [Google Scholar] [CrossRef] [PubMed]
  42. Jiang, X.; Lu, N.; Zhao, H.; Yuan, H.; Xia, D.; Lei, H. The microbiome–metabolome response in the colon of piglets under the status of weaning stress. Front. Microbiol. 2020, 11, 2055. [Google Scholar] [CrossRef] [PubMed]
  43. Petrowski, K.; Wintermann, G.B.; Schaarschmidt, M.; Bornstein, S.R.; Krischbaum, C. Blunted salivary and plasma cortisol response in patients with panic disorder under psychosocial stress. Int. J. Psychophysiol. 2013, 88, 35–39. [Google Scholar] [CrossRef] [PubMed]
  44. Pineiro, M.; Piñeiro, C.; Carpintero, R.; Morales, J.; Campbell, F.M.; Eckersall, P.D.; Toussaint Mathilda, J.M.; Lampreave, F. Characterisation of the pig acute phase protein response to road transport. Vet. J. 2007, 173, 669–674. [Google Scholar] [CrossRef]
  45. Gutiérrez, A.M.; Martínez-Subiela, S.; Eckersall, P.D.; Cerón, J.J. C-reactive protein quantification in porcine saliva: A minimally invasive test for pig health monitoring. Vet. J. 2009, 181, 261–265. [Google Scholar] [CrossRef]
  46. Wang, M.; Zhong, Q.; Xin, H.; Yu, B.; He, J.; Yu, J.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; et al. Purine metabolism and hexosamine biosynthetic pathway abnormalities in diarrheal weaned piglets identified using metabolomics. Animals 2024, 14, 522. [Google Scholar] [CrossRef]
  47. Pomorska-Mól, M.; Kwit, K.; Markowska-Daniel, I. Major acute phase proteins in pig serum from birth to slaughter. J. Vet. Res. 2012, 56, 553–557. [Google Scholar] [CrossRef]
  48. Wang, J.; Wu, C.; Feng, J. Effect of dietary antibacterial peptide and zinc-methionine on performance and serum biochemical parameters in piglets. Czech. J. Anim. Sci. 2011, 56, 30–36. [Google Scholar] [CrossRef]
  49. Lv, D.; Xiong, X.; Yang, H.; Wang, M.; He, Y.; Liu, Y.; Yin, Y. Effect of dietary soy oil, glucose, and glutamine on growth performance, amino acid profile, blood profile, immunity, and antioxidant capacity in weaned piglets. Sci. China Life Sci. 2018, 61, 1233–1242. [Google Scholar] [CrossRef]
  50. Heo, J.M.; Kim, J.C.; Hansen, C.F.; Mullan, B.P.; Hampson, D.J.; Pluske, J.R. Effects of feeding low protein diets to piglets on plasma urea nitrogen, faecal ammonia nitrogen, the incidence of diarrhoea and performance after weaning. Arch. Anim. Nutr. 2008, 62, 343–358. [Google Scholar] [CrossRef]
  51. Zou, X.T.; Zheng, G.H.; Fang, X.J.; Jiang, J.F. Effects of glutamine on growth performance of weanling piglets. Czech J. Anim. Sci. 2006, 51, 444. [Google Scholar] [CrossRef]
  52. Tao, X.; Xu, Z.; Men, X. Transient effects of weaning on the health of newly weaning piglets. Czech J. Anim. Sci. 2016, 61, 82–90. [Google Scholar] [CrossRef]
  53. Wang, J.; Ji, H. Tight junction proteins in the weaned piglet intestine: Roles and regulation. Curr. Protein Pept. Sci. 2019, 20, 652–660. [Google Scholar] [CrossRef]
  54. Bennet, S.; Trnblom, H. Editorial: Increased expression of nerve growth factor correlates with visceral hypersensitivity and impaired gut barrier function in diarrhoea-predominant irritable bowel syndrome. Aliment. Pharmacol. Ther. 2017, 45, 567–568. [Google Scholar] [CrossRef]
  55. Luo, C.; Xia, B.; Zhong, R.; Shen, D.; Li, J.; Chen, L.; Zhang, H. Early-life nutrition interventions improved growth performance and intestinal health via the gut microbiota in piglets. Front. Nutr. 2022, 8, 783688. [Google Scholar] [CrossRef] [PubMed]
  56. Hu, C.H.; Xiao, K.; Luan, Z.S.; Song, J. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs. J. Anim. Sci. 2013, 91, 1094–1101. [Google Scholar] [CrossRef]
  57. Al Masri, S.; Hünigen, H.; Al Aiyan, A.; Rieger, J.; Zentek, J.; Richardson, K.; Plendl, J. Influence of age at weaning and feeding regimes on the postnatal morphology of the porcine small intestine: A review of morphometric studies. J. Swine Health Prod. 2015, 23, 186–203. [Google Scholar] [CrossRef]
  58. Xun, W.; Shi, L.; Zhou, H.; Hou, G.; Cao, T. Effect of weaning age on intestinal mucosal morphology, permeability, gene expression of tight junction proteins, cytokines and secretory IgA in Wuzhishan mini piglets. Ital. J. Anim. Sci. 2018, 17, 976–983. [Google Scholar] [CrossRef]
  59. Cao, S.; Hou, L.; Sun, L.; Gao, J.; Gao, K.; Yang, X.; Wang, L. Intestinal morphology and immune profiles are altered in piglets by early-weaning. Int. Immunopharmacol. 2022, 105, 108520. [Google Scholar] [CrossRef]
  60. Brown, D.C.; Maxwell, C.V.; Erf, G.F.; Davis, M.E.; Singh, S.; Johnson, Z.B. The influence of different management systems and age on intestinal morphology, immune cell numbers and mucin production from goblet cells in post-weaning pigs. Vet. Immunol. Immunopathol. 2006, 111, 187–198. [Google Scholar] [CrossRef]
  61. Wei, X.; Tsai, T.; Howe, S.; Zhao, J. Weaning induced gut dysfunction and nutritional interventions in nursery pigs: A partial review. Animals 2021, 11, 1279. [Google Scholar] [CrossRef]
  62. Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van, de.; Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef]
  63. Wang, W.; Wang, Y.; Hao, X.; Duan, Y.; Meng, Z.; An, X.; Qi, J. Dietary fermented soybean meal replacement alleviates diarrhea in weaned piglets challenged with enterotoxigenic Escherichia coli K88 by modulating inflammatory cytokine levels and cecal microbiota composition. BMC Vet. Res. 2020, 16, 1–11. [Google Scholar] [CrossRef] [PubMed]
  64. McLamb, B.L.; Gibson, A.J.; Overman, E.L.; Stahl, C.; Moeser, A.J. Early weaning stress in pigs impairs innate mucosal immune responses to enterotoxigenic E. coli challenge and exacerbates intestinal injury and clinical disease. PLoS ONE 2013, 8, e59838. [Google Scholar] [CrossRef] [PubMed]
  65. Liu, X.; Xia, B.; He, T.; Li, D.; Su, J.H.; Guo, L.; Wang, J.F.; Zhu, Y.H. Oral administration of a select mixture of Lactobacillus and Bacillus alleviates inflammation and maintains mucosal barrier integrity in the ileum of pigs challenged with Salmonella Infantis. Microorganisms 2019, 7, 135. [Google Scholar] [CrossRef]
  66. Hu, L.; Peng, X.; Chen, H.; Yan, C.; Liu, Y.; Xu, Q.; Fang, Z.F.; Lin, Y.; Xu, S.Y.; Feng, B.; et al. Effects of intrauterine growth retardation and Bacillus subtilis PB6 supplementation on growth performance, intestinal development and immune function of piglets during the suckling period. Eur. J. Nutr. 2017, 56, 1753–1765. [Google Scholar] [CrossRef] [PubMed]
  67. Liu, Y.; Chen, F.; Odle, J.; Lin, X.; Jacobi, S.K.; Zhu, H.; Wu, Z.; Hou, Y. Fish Oil Enhances Intestinal Integrity and Inhibits TLR4 and NOD2 Signaling Pathways in Weaned Pigs after LPS Challenge, 3. J. Nutr. 2012, 142, 2017–2024. [Google Scholar] [CrossRef]
  68. Trevisi, P.; Negrini, C.; Correa, F.; Virdis, S.; Laghi, L.; Marcello, M.; Conte, G.; Mazzoni, M.; Luise, D. Insight into the long-term impact of birth weight on intestinal development, microbial settlement, and the metabolism of weaned piglets. J. Anim. Sci. 2023, 101, skad395. [Google Scholar] [CrossRef]
  69. Lessard, M.; Blais, M.; Beaudoin, F.; Deschene, K.; Verso, L.L.; Bissonnette, N.; Lauzon, K.; Guay, F. Piglet weight gain during the first two weeks of lactation influences the immune system development. Vet. Immunol. Immunopathol. 2018, 206, 25–34. [Google Scholar] [CrossRef]
  70. D’Inca, R.; Kloareg, M.; Gras-Le Guen, C.; Le Huërou-Luron, I. Intrauterine growth restriction modifies the developmental pattern of intestinal structure, transcriptomic profile, and bacterial colonization in neonatal pigs. J. Nutr. 2010, 140, 925–931. [Google Scholar] [CrossRef]
Animals 15 01369 g001
Figure 1. Effects of birth weight and weaning on serum parameters of piglets. (A) The concentration of serum cortisol (COR). (B) The concentration of serum C-reactive protein (CRP). (C) The concentration of blood urea nitrogen (BUN).; WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Figure 1. Effects of birth weight and weaning on serum parameters of piglets. (A) The concentration of serum cortisol (COR). (B) The concentration of serum C-reactive protein (CRP). (C) The concentration of blood urea nitrogen (BUN).; WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Animals 15 01369 g001
Animals 15 01369 g002
Figure 2. Effects of birth weight and weaning on expression of tight junction protein genes in jejunum of piglets. WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight; ZO-1 = zonula occludens-1; ZO-2 = zonula occludens-2. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b,c Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Figure 2. Effects of birth weight and weaning on expression of tight junction protein genes in jejunum of piglets. WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight; ZO-1 = zonula occludens-1; ZO-2 = zonula occludens-2. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b,c Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Animals 15 01369 g002
Animals 15 01369 g003
Figure 3. Effects of birth weight and weaning on expression of inflammation-related genes in jejunum of piglets.; WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight; IL-1β = interleukin-1β; IL-2 = interleukin-2; IL-6 = interleukin-6; TNF-α = tumor necrosis factor α; IFN-γ = Interferon-γ; NLRP3 = NOD-like receptor thermal protein domain associated protein 3; IL-18 = interleukin-18. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Figure 3. Effects of birth weight and weaning on expression of inflammation-related genes in jejunum of piglets.; WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight; IL-1β = interleukin-1β; IL-2 = interleukin-2; IL-6 = interleukin-6; TNF-α = tumor necrosis factor α; IFN-γ = Interferon-γ; NLRP3 = NOD-like receptor thermal protein domain associated protein 3; IL-18 = interleukin-18. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Animals 15 01369 g003
Animals 15 01369 g004
Figure 4. Effects of birth weight and weaning on expression of immune-related genes in jejunum of piglets.; WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight; TLR4 = Toll-like receptors 4; TLR9 = Toll-like receptors 9; NOD = nucleotide-binding oligomerization domain protein; NOD1 = NOD-like receptor 1; NOD2 = NOD-like receptor 2; MyD88 = myeloid differentiation factor 88; TRAF6 = tumor necrosis factor receptor-associated factor 6; TRIF = TIR domain-containing adaptor inducing IFN-β; p38 MAPK = p38 mitogen-activated protein kinase; IRF3 = interferon regulatory factor 3; p65 NF-κB = p65 nuclear factor κB. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Figure 4. Effects of birth weight and weaning on expression of immune-related genes in jejunum of piglets.; WEA = weaning groups; NBW = normal birth weight; LBW = low birth weight; TLR4 = Toll-like receptors 4; TLR9 = Toll-like receptors 9; NOD = nucleotide-binding oligomerization domain protein; NOD1 = NOD-like receptor 1; NOD2 = NOD-like receptor 2; MyD88 = myeloid differentiation factor 88; TRAF6 = tumor necrosis factor receptor-associated factor 6; TRIF = TIR domain-containing adaptor inducing IFN-β; p38 MAPK = p38 mitogen-activated protein kinase; IRF3 = interferon regulatory factor 3; p65 NF-κB = p65 nuclear factor κB. The results are shown as means ± SEM represented by vertical bars (n = 12). a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Animals 15 01369 g004
Table 1. Sequence of primers used for the real-time quantitative PCR analysis.
Table 1. Sequence of primers used for the real-time quantitative PCR analysis.
Genes 1Primer Sequences (5′-3′) 2Size (bp)AT 3, °C
ZO-1F: CAGCCCCCGTACATGGAGA10559.7
R: GCGCAGACGGTGTTCATAGTT
ZO-2F: ATTCGGACCCATAGCAGACATAG10059.7
R: GCGTCTCTTGGTTCTGTTTTAGC
OccludinF: CAGGTGCACCCTCCAGATTG11059.7
R: GGACTTTCAAGAGGCCTGGAT
Claudin-1F: GCCACAGCAAGGTATGGTAAC14059.7
R: AGTAGGGCACCTCCCAGAAG
Claudin-2F: CATCGGCAGCAGCATTATC9559.7
R: ACACTTTGCACTGCATCTGG
IL-1βF: CAGCTGCAAATCTCTCACCA11259.7
R: TCTTCATCGGCTTCTCCACT
IL-2F: TGCACTAACCCTTGCACTCA8359.7
R: GCAATGGCTCCAGTTGTTTCT
IL-6F: TTCACCTCTCCGGACAAAAC12259.7
R: TCTGCCAGTACCTCCTTGCT
TNF-αF: CGTGAAGCTGAAAGACAACCAG12159.7
R: GATGGTGTGAGTGAGGAAAACG
IFN-γF: ACCAGGCCATTCAAAGGAGC9059.7
R: CGAAGTCATTCAGTTTCCCAGAG
NLRP3F: GGAGGAGGAGGAAGAGGAGATA14759.7
R: AGGACTGAGAAGATGCCACTAC
IL-18F: AGTAACCATCTCTGTGCAGTGT15559.7
R: TCTTATCATCATGTCCAGGAAC
Caspase-1F: GAAGGAGAAGAGGAGGCTGTT26859.7
R: AGATTGTGAACCTGTGGAGAGT
TLR4F: TTACAGAAGCTGGTTGCCGT15265.0
R: TCCAGGTTGGGCAGGTTAGA
TLR9F: AATCCAGTCGGAGATGTTTGCT7959.7
R: GACCGCCTGGGAGATGCT
NOD1F: TCAACACCGATCCAGTGAGC23759.7
R: TGAAAATGGTCTCGCCCTCC
NOD2F: GTGCCTCCCCTCTAGACTCA19159.7
R: ACGAACCAGGAAGCCAAGAG
MyD88F: CCATTCGAGATGACCCCCTG18359.7
R: TAGCAATGGACCAGACGCAG
TRAF6F: GCTGCATCTATGGCATTTGAAG7059.7
R: CCACAGATAACATTTGCCAAAGG
P38 MAPKF: AGTTGAAGCTCATTTTAAGACTCGT11759.7
R: AGTTCATCTTCGGCATCTGGG
TRIFF: CAAGTGGAGGAAGGAACAGG13959.7
R: CAACTGCGTCTGGTAGGACA
IRF3F: GCTACACCCTCTGGTTCTGC9559.7
R: GAGACACATGGGGACAACCT
p65 NF-κBF: GTGTGTAAAGAAGCGGGACCT13959.7
R: CACTGTCACCTGGAAGCAGAG
β-actinF: TCTGGCACCACACCTTCT11459.7
R: TGATCTGGGTCATCTTCTCAC
1 ZO-1 = zonula occludens-1; ZO-2 = zonula occludens-2; IL-1β = interleukin-1β; IL-2 = interleukin-2; IL-6 = interleukin-6; TNF-α = tumor necrosis factor α; IFN-γ = Interferon-γ; NLRP3 = NOD-like receptor thermal protein domain associated protein 3; IL-18 = interleukin-18; TLR4 = Toll-like receptors 4; TLR9 = Toll-like receptors 9; NOD = nucleotide-binding oligomerization domain protein; NOD1 = NOD-like receptor 1; NOD2 = NOD-like receptor 2; MyD88 = myeloid differentiation factor 88; TRAF6 = tumor necrosis factor receptor-associated factor 6; p38 MAPK = p38 mitogen-activated protein kinase; TRIF = TIR domain-containing adaptor inducing IFN-β; IRF3= interferon regulatory factor 3; p65 NF-κB = p65 nuclear factor κB. 2 F = forward primer; R = reverse primer. 3 AT = annealing temperature.
Table 2. Sequence of primers and probes used for the real-time quantitative PCR analysis of microbial populations.
Table 2. Sequence of primers and probes used for the real-time quantitative PCR analysis of microbial populations.
PrimerNucleotide Sequence (5′-3′) 1Product Size, bpAT 2, °C
Total bacteriaF: ACTCCTACGGGAGGCAGCAG
R: ATTACCGCGGCTGCTGG		20060
Escherichia coliF: CATGCCGCGTGTATGAAGAA
R: CGGGTAACGTCAATGAGCAAA
P: AGGTATTAACTTTACTCCCTTCCTC		9660
LactobacillusF: ACTCCTACGGGAGGCAGCAG
R: CAACAGTTACTCTGACACCCGTTCTTC
P: AAGAAGGGTTTCGGCTCGTAAAACTC-TGTT		12660
BacillusF: GCAACGAGCGCAACCCTTGA
R: TCATCCCCACCTTCCTCCGGT
P: CGGTTTGTCACCGGCAGTCACCT		9260
1 F = forward primer; R = reverse primer; P = probe. 2 AT = annealing temperature.
Table 3. Effects of weaning on body weight of NBW and LBW piglets 1.
Table 3. Effects of weaning on body weight of NBW and LBW piglets 1.
ItemsNBW 2LBW 3p-Value
21 d body weight, kg6.16 ± 0.033.65 ± 0.070.000
24 d body weight, kg6.37 ± 0.033.55 ± 0.060.000
Body weight gain, g+210−100
1 Values are means ± SEM of 12 piglets per group. 2 NBW = Normal birth weight. 3 LBW = Low birth weight.
Table 4. Effects of birth weight and weaning on jejunal morphology in piglets 1.
Table 4. Effects of birth weight and weaning on jejunal morphology in piglets 1.
ItemsCON 2WEA 3p-Value
NBW 4LBW 5NBW 4LBW 5BWWEABW × WEA
Villus height, μm276.60 ± 15.55 a190.23 ± 35.02 b137.25 ± 17.69 b127.29 ± 9.84 b0.0380.0000.093
Crypt depth, μm67.18 ± 5.25 ab55.81 ± 6.37 b73.97 ± 2.60 a66.25 ± 2.74 ab0.0480.0720.692
V/C 64.18 ± 0.26 a3.49 ± 0.56 a1.88 ± 0.27 b1.95 ± 0.20 b0.3910.0000.294
1 Values are means ± SEM of 12 piglets per group. 2 CON = control groups. 3 WEA = weaning groups. 4 NBW = normal birth weight. 5 LBW = low birth weight. 6 V/C = villus height/crypt depth. a,b Means values with different letters on vertical bars indicate significant differences (p < 0.05).
Table 5. Effects of birth weight and weaning on the microbial populations (log cfu/g of wet digesta) in cecal and colonic digesta of piglets, qPCR results 1.
Table 5. Effects of birth weight and weaning on the microbial populations (log cfu/g of wet digesta) in cecal and colonic digesta of piglets, qPCR results 1.
ItemsCON 2WEA 3p-Value
NBW 4LBW 5NBW 4LBW 5BWWEABW × WEA
Cecal digesta
Total bacteria10.85 ± 0.0510.52 ± 0.1710.73 ± 0.1310.67 ± 0.110.1020.9030.261
Lactobacillus7.38 ± 0.127.11 ± 0.207.31 ± 0.257.01 ± 0.390.2790.7450.945
Escherichia coli5.67 ± 0.36 ab5.10 ± 0.47 b4.39 ± 0.58 b6.68 ± 0.25 a0.0440.7260.001
Bacillus5.25 ± 0.074.96 ± 0.185.40 ± 0.095.32 ± 0.120.1400.0460.388
Colonic digesta
Total bacteria11.19 ± 0.0511.21 ± 0.0511.15 ± 0.0511.23 ± 0.060.3550.8930.540
Lactobacillus7.76 ± 0.137.73 ± 0.157.62 ± 0.247.93 ± 0.080.3800.8530.311
Escherichia coli7.70 ± 0.086.97 ± 0.187.43 ± 0.217.48 ± 0.330.1260.5920.081
Bacillus5.40 ± 0.085.46 ± 0.085.46 ± 0.055.49 ± 0.070.5100.5100.856
1 Values means n = 12 for the four groups. 2 CON = control groups. 3 WEA = weaning groups. 4 NBW = normal birth weight. 5 LBW = low birth weight. a,b Means statistical significance (p < 0.05) in a row between the two treatments.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, P.; Zhang, J.; Tian, Y.; Yu, B.; He, J.; Yu, J.; Zheng, P. Weaning Stress Aggravates Defense Response and the Burden of Protein Metabolism in Low-Birth-Weight Piglets. Animals 2025, 15, 1369. https://doi.org/10.3390/ani15101369

AMA Style

Wang P, Zhang J, Tian Y, Yu B, He J, Yu J, Zheng P. Weaning Stress Aggravates Defense Response and the Burden of Protein Metabolism in Low-Birth-Weight Piglets. Animals. 2025; 15(10):1369. https://doi.org/10.3390/ani15101369

Chicago/Turabian Style

Wang, Peipei, Jinwei Zhang, Yihang Tian, Bing Yu, Jun He, Jie Yu, and Ping Zheng. 2025. "Weaning Stress Aggravates Defense Response and the Burden of Protein Metabolism in Low-Birth-Weight Piglets" Animals 15, no. 10: 1369. https://doi.org/10.3390/ani15101369

APA Style

Wang, P., Zhang, J., Tian, Y., Yu, B., He, J., Yu, J., & Zheng, P. (2025). Weaning Stress Aggravates Defense Response and the Burden of Protein Metabolism in Low-Birth-Weight Piglets. Animals, 15(10), 1369. https://doi.org/10.3390/ani15101369

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop