Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Tick Collection and Morphological Identification
2.3. DNA Extraction from Ticks
2.4. Tick Molecular Identification
2.5. Molecular Detection of Pathogens and Sequencing
2.6. Phylogenetic Analysis
3. Results
3.1. Sampled Ticks
3.2. Pathogen Detection
3.2.1. Pathogen Detection from Questing Ticks
3.2.2. Pathogen Detection from Wild Boar Carcasses
3.3. Rickettsia spp. Phylogenetic Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- De la Fuente, J.; Estrada-Peña, A.; Venzal, J.M.; Kocan, K.M.; Sonenshine, D.E. Overview: Ticks as Vectors of Pathogens that Cause Disease in Humans and Animals. Front. Biosci. 2008, 13, 6938–6946. [Google Scholar] [CrossRef]
- Colwell, D.D.; Dantas-Torres, F.; Otranto, D. Vector-Borne Parasitic Zoonoses: Emerging Scenarios and New Perspectives. Vet. Parasitol. 2011, 182, 14–21. [Google Scholar] [CrossRef]
- Dantas-Torres, F.; Otranto, D. Vector-Borne Zoonoses. In Zoonoses: Infections Affecting Humans and Animals; Sing, A., Ed.; Springer: Cham, Switzerland, 2022. [Google Scholar] [CrossRef]
- Gilbert, L. The Impacts of Climate Change on Ticks and Tick-Borne Disease Risk. Annu. Rev. Entomol. 2021, 66, 373–388. [Google Scholar] [CrossRef] [PubMed]
- Torina, A.; Blanda, V.; Antoci, F.; Scimeca, S.; D’Agostino, R.; Scariano, E.; Piazza, A.; Galluzzo, P.; Giudice, E.; Caracappa, S. A Molecular Survey of Anaplasma spp., Rickettsia spp., Ehrlichia canis, and Babesia microti in Foxes and Fleas from Sicily. Transbound. Emerg. Dis. 2013, 60, 125–130. [Google Scholar] [CrossRef]
- Mancini, F.; Ciccozzi, M.; Lo Presti, A.; Cella, E.; Giovanetti, M.; Di Luca, M.; Toma, L.; Bianchi, R.; Khoury, C.; Rezza, G.; et al. Characterization of Spotted Fever Group Rickettsiae in Ticks from a City Park of Rome, Italy. Ann. Ist. Super. Sanità 2015, 51, 284–290. [Google Scholar] [CrossRef]
- Dantas-Torres, F. Climate Change, Biodiversity, Ticks, and Tick-Borne Diseases: The Butterfly Effect. Int. J. Parasitol. Parasites Wildl. 2015, 4, 452–461. [Google Scholar] [CrossRef] [PubMed]
- Torina, A.; Blanda, V.; Blanda, M.; Auteri, M.; La Russa, F.; Scimeca, S.; D’Agostino, R.; Disclafani, R.; Villari, S.; Currò, V.; et al. A Geographical Information System-Based Approach for Integrated Strategies of Tick Surveillance and Control in the Peri-Urban Natural Reserve of Monte Pellegrino (Palermo, Southern Italy). Int. J. Environ. Res. Public Health 2018, 15, 404. [Google Scholar] [CrossRef]
- Castillo-Contreras, R.; Magen, L.; Birtles, R.; Varela-Castro, L.; Hall, J.L.; Conejero, C.; Aguilar, X.F.; Colom-Cadena, A.; Lavín, S.; Mentaberre, G.; et al. Ticks on Wild Boar in the Metropolitan Area of Barcelona (Spain) Are Infected with Spotted Fever Group Rickettsiae. Transbound. Emerg. Dis. 2022, 69, e82–e95. [Google Scholar] [CrossRef]
- Castillo-Contreras, R.; Carvalho, J.; Serrano, E.; Mentaberre, G.; Fernández-Aguilar, X.; Colom, A.; González-Crespo, C.; Lavín, S.; López-Olvera, J.R. Urban Wild Boars Prefer Fragmented Areas with Food Resources Near Natural Corridors. Sci. Total Environ. 2018, 615, 282–288. [Google Scholar] [CrossRef]
- De la Fuente, J.; Kopáček, P.; Lew-Tabor, A.; Maritz-Olivier, C. Strategies for New and Improved Vaccines Against Ticks and Tick-Borne Diseases. Parasite Immunol. 2016, 38, 754–769. [Google Scholar] [CrossRef] [PubMed]
- Torina, A.; Moreno-Cid, J.A.; Blanda, V.; Fernández de Mera, I.G.; de la Lastra, J.M.; Scimeca, S.; Blanda, M.; Scariano, M.E.; Briganò, S.; Disclafani, R.; et al. Control of Tick Infestations and Pathogen Prevalence in Cattle and Sheep Farms Vaccinated with the Recombinant Subolesin-Major Surface Protein 1a Chimeric Antigen. Parasites Vectors 2014, 7, 10. [Google Scholar] [CrossRef]
- Manilla, G. Fauna d’Italia Acari Ixodida; Edizioni Calderini: Bologna, Italy, 1998; pp. 42–242. [Google Scholar]
- Walker, J.B.; Keirans, J.E.; Horak, I.G. The Genus Rhipicephalus (Acari: Ixodidae): A Guide to the Brown Ticks of the World; Cambridge University Press: Cambridge, UK, 2000; pp. 40–583. [Google Scholar]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Oteo, J.A.; Portillo, A.; Santibáñez, S.; Blanco, J.R.; Pérez-Martínez, L.; Ibarra, V. Cluster of Cases of Human Rickettsia felis Infection from Southern Europe (Spain) Diagnosed by PCR. J. Clin. Microbiol. 2006, 44, 2669–2671. [Google Scholar] [CrossRef]
- Choi, Y.J.; Jang, W.J.; Kim, J.H.; Ryu, J.S.; Lee, S.H.; Park, K.H.; Paik, H.S.; Koh, Y.S.; Choi, M.S.; Kim, I.S. Spotted Fever Group and Typhus Group Rickettsioses in Humans, South Korea. Emerg. Infect. Dis. 2005, 11, 237–244. [Google Scholar] [CrossRef]
- Roux, V.; Rydkina, E.; Eremeeva, M.; Raoult, D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int. J. Syst. Bacteriol. 1997, 47, 252–261. [Google Scholar] [CrossRef]
- Richter, P.J., Jr.; Kimsey, R.B.; Madigan, J.E.; Barlough, J.E.; Dumler, J.S.; Brooks, D.L. Ixodes pacificus (Acari: Ixodidae) as a vector of Ehrlichia equi (Rickettsiales: Ehrlichieae). J. Med. Entomol. 1996, 33, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Schets, F.M.; de Heer, L.; de Roda Husman, A.M. Coxiella burnetii in Sewage Water at Sewage Water Treatment Plants in a Q Fever Epidemic Area. Int. J. Hyg. Environ. Health 2013, 216, 698–702. [Google Scholar] [CrossRef]
- To, H.; Kako, N.; Zhang, G.Q.; Otsuka, H.; Ogawa, M.; Ochiai, O.; Nguyen, S.V.; Yamaguchi, T.; Fukushi, H.; Nagaoka, N.; et al. Q Fever Pneumonia in Children in Japan. J. Clin. Microbiol. 1996, 34, 647–651. [Google Scholar] [CrossRef] [PubMed]
- Briciu, V.T.; Sebah, D.; Coroiu, G.; Lupşe, M.; Cârstina, D.; Ţăţulescu, D.F.; Mihalca, A.D.; Gherman, C.M.; Leucuţa, D.; Meyer, F.; et al. Immunohistochemistry and Real-Time PCR as Diagnostic Tools for Detection of Borrelia burgdorferi Sensu Lato in Ticks Collected from Humans. Exp. Appl. Acarol. 2016, 69, 49–60. [Google Scholar] [CrossRef] [PubMed]
- Stańczak, J.; Cieniuch, S.; Lass, A.; Biernat, B.; Racewicz, M. Detection and Quantification of Anaplasma phagocytophilum and Babesia spp. in Ixodes ricinus Ticks from Urban and Rural Environments, Northern Poland, by Real-Time Polymerase Chain Reaction. Exp. Appl. Acarol. 2015, 66, 63–81. [Google Scholar] [CrossRef] [PubMed]
- Carret, C.; Walas, F.; Carcy, B.; Grande, N.; Précigout, E.; Moubri, K.; Schetters, T.P.; Gorenflot, A. Babesia canis canis, Babesia canis vogeli, Babesia canis rossi: Differentiation of the Three Subspecies by a Restriction Fragment Length Polymorphism Analysis on Amplified Small Subunit Ribosomal RNA Genes. J. Eukaryot. Microbiol. 1999, 46, 298–303. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.; Tian, J.; Wang, W.; Zhao, H.; Jiang, H.; Han, J.; Guo, W.; Li, K. High diversity of Rickettsia spp., Anaplasma spp., and Ehrlichia spp. in ticks from Yunnan Province, Southwest China. Front. Microbiol. 2022, 13, 1008110. [Google Scholar] [CrossRef] [PubMed]
- Shehla, S.; Ullah, F.; Alouffi, A.; Almutairi, M.M.; Khan, Z.; Tanaka, T.; Labruna, M.B.; Tsai, K.-H.; Ali, A. Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens 2023, 12, 1080. [Google Scholar] [CrossRef]
- Krishnamoothy, N.; Kumar, A.; Veerapathiran, A.; Balaji, T.; Rajeswari, A.; Paramasivan, R. Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India. Microorganisms 2023, 11, 1713. [Google Scholar] [CrossRef]
- Remesar, S.; Cano-Terriza, D.; Morrondo, P.; Jiménez-Ruiz, S.; López, C.M.; Jiménez-Martín, D.; Díaz, P.; Paniagua, J.; García-Bocanegra, I. Molecular detection of Rickettsia spp. in wild ungulates and their ticks in Mediterranean areas of southwestern Spain. Zoonoses Public Health 2023, 70, 485–497. [Google Scholar] [CrossRef] [PubMed]
- Barradas, P.F.; Mesquita, J.R.; Ferreira, P.; Amorim, I.; Gärtner, F. Detection of tick-borne pathogens in Rhipicephalus sanguineus sensu lato and dogs from different districts of Portugal. Ticks Tick Borne Dis. 2020, 11, 101536. [Google Scholar] [CrossRef]
- Blanc, G.; Ogata, H.; Robert, C.; Audic, S.; Claverie, J.M.; Raoult, D. Lateral gene transfer between obligate intracellular bacteria: Evidence from the Rickettsia massiliae genome. Genome Res. 2007, 17, 1657–1664. [Google Scholar] [CrossRef]
- Chao, L.L.; Erazo, E.; Robinson, M.; Liang, Y.F.; Shih, C.M. First detection and molecular identification of a pathogenic spotted fever group Rickettsia, R. massiliae, from Rhipicephalus haemaphysaloides ticks infesting dogs in southern Taiwan. Acta Trop. 2022, 236, 106666. [Google Scholar] [CrossRef] [PubMed]
- Fernández de Mera, I.G.; Blanda, V.; Torina, A.; Dabaja, M.F.; El Romeh, A.; Cabezas-Cruz, A.; de la Fuente, J. Identification and molecular characterization of spotted fever group rickettsiae in ticks collected from farm ruminants in Lebanon. Ticks Tick Borne Dis. 2018, 9, 104–108. [Google Scholar] [CrossRef]
- Wang, Q.; Guo, W.B.; Pan, Y.S.; Jiang, B.G.; Du, C.H.; Que, T.C.; Zhan, L.; Wu, J.H.; Yu, M.H.; Cui, X.M.; et al. Detection of Novel Spotted Fever Group Rickettsiae (Rickettsiales: Rickettsiaceae) in Ticks (Acari: Ixodidae) in Southwestern China. J. Med. Entomol. 2021, 58, 1363–1369. [Google Scholar] [CrossRef]
- Valcárcel, F.; Elhachimi, L.; Vilá, M.; Tomassone, L.; Sánchez, M.; Selles, S.M.A.; Kouidri, M.; González, M.G.; Martín-Hernández, R.; Valcárcel, Á.; et al. Emerging Hyalomma lusitanicum: From Identification to Vectorial Role and Integrated Control. Med. Vet. Entomol. 2023, 37, 425–459. [Google Scholar] [CrossRef]
- González, J.; González, M.G.; Valcárcel, F.; Sánchez, M.; Martín-Hernández, R.; Tercero, J.M.; Olmeda, A.S. Transstadial Transmission from Nymph to Adult of Coxiella burnetii by Naturally Infected Hyalomma lusitanicum. Pathogens 2020, 9, 884. [Google Scholar] [CrossRef] [PubMed]
- Sánchez, M.; Valcárcel, F.; González, J.; González, M.G.; Martín-Hernández, R.; Tercero, J.M.; González-Jara, P.; Olmeda, A.S. Seasonality of Coxiella burnetii Among Wild Rabbits (Oryctolagus cuniculus) and the Hyalomma lusitanicum (Acari: Ixodidae) in a Meso-Mediterranean Ecosystem. Pathogens 2022, 11, 36. [Google Scholar] [CrossRef] [PubMed]
- Remesar, S.; Castro-Scholten, S.; Cano-Terriza, D.; Díaz, P.; Morrondo, P.; Jiménez-Martín, D.; Rouco, C.; García-Bocanegra, I. Molecular Identification of Zoonotic Rickettsia Species in Ixodidae Parasitizing Wild Lagomorphs from Mediterranean Ecosystems. Transbound. Emerg. Dis. 2021, 69, e992–e1004. [Google Scholar] [CrossRef]
- Eslava, M.; Carlos, S.; Reina, G. Crimean-Congo Hemorrhagic Fever Virus: An Emerging Threat in Europe with a Focus on Epidemiology in Spain. Pathogens 2024, 13, 770. [Google Scholar] [CrossRef] [PubMed]
- Blanda, V.; Torina, A.; La Russa, F.; D’Agostino, R.; Randazzo, K.; Scimeca, S.; Giudice, E.; Caracappa, S.; Cascio, A.; de la Fuente, J. A Retrospective Study of the Characterization of Rickettsia Species in Ticks Collected from Humans. Ticks Tick Borne Dis. 2017, 8, 610–614. [Google Scholar] [CrossRef] [PubMed]
- Rubel, F.; Brugger, K.; Pfeffer, M.; Chitimia-Dobler, L.; Didyk, Y.M.; Leverenz, S.; Dautel, H.; Kahl, O. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick-Borne Dis. 2016, 7, 224–233. [Google Scholar] [CrossRef] [PubMed]
- Accorsi, A.; Schiavetti, I.; Listorti, V.; Dellepiane, M.; Masotti, C.; Ercolini, C.; Guardone, L.; Razzuoli, E. Hard Ticks (Ixodidae) from Wildlife in Liguria, Northwest Italy: Tick Species Diversity and Tick-Host Associations. Insects 2022, 13, 199. [Google Scholar] [CrossRef]
- Ferrolho, S.; Antunes, A.S.; Santos, R.; Velez, L.; Padre, A.; Cabezas-Cruz, M.M.; Santos-Silva, A.; Domingos, J. Detection and phylogenetic characterization of Theileria spp. and Anaplasma marginale in Rhipicephalus bursa in Portugal. Ticks Tick-Borne Dis. 2016, 7, 443–448. [Google Scholar] [CrossRef] [PubMed]
- Dahmani, M.; Davoust, B.; Rousseau, F.; Raoult, D.; Fenollar, F.; Mediannikov, O. Natural Anaplasmataceae infection in Rhipicephalus bursa ticks collected from sheep in the French Basque Country. Ticks Tick-Borne Dis. 2017, 8, 18–24. [Google Scholar] [CrossRef]
- Erster, O.; Roth, A.; Wolkomirsky, R.; Leibovich, B.; Savitzky, I.; Shkap, V. Transmission of Babesia ovis by different Rhipicephalus bursa developmental stages and infected blood injection. Ticks Tick-Borne Dis. 2016, 7, 13–19. [Google Scholar] [CrossRef]
- Raele, D.A.; Galante, D.; Pugliese, N.; De Simone, E.; Cafiero, M.A. Coxiella-like endosymbiont associated to the “Anatolian brown tick” Rhipicephalus bursa in southern Italy. Microbes Infect. 2015, 17, 799–805. [Google Scholar] [CrossRef] [PubMed]
- Matei, I.A.; Ionică, A.M.; Corduneanu, A.; Domșa, C.; Sándor, A.D. The presence of Ehrlichia canis in Rhipicephalus bursa ticks collected from ungulates in continental Eastern Europe. J. Vet. Res. 2021, 65, 271–275. [Google Scholar] [CrossRef]
- Barradas, P.F.; Marques, J.; Tavares, C.; Brito, N.V.; Mesquita, J.R. Detection of Tick-Borne Pathogens in Rhipicephalus bursa Ticks Collected from the Autochthonous Garrano Breed of Horses in Portugal. Vet. Parasitol. Reg. Stud. Rep. 2024, 51, 101033. [Google Scholar] [CrossRef] [PubMed]
- Maioli, G.; Pistone, D.; Bonilauri, P.; Pajoro, M.; Barbieri, I.; Patrizia, M.; Vicari, N.; Dottori, M. Etiological Agents of Rickettsiosis and Anaplasmosis in Ticks Collected in Emilia-Romagna Region (Italy) During 2008 and 2009. Exp. Appl. Acarol. 2012, 57, 199–208. [Google Scholar] [CrossRef] [PubMed]
- Sgroi, G.; Iatta, R.; Lia, R.P.; D’Alessio, N.; Manoj, R.R.S.; Veneziano, V.; Otranto, D. Spotted fever group Rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound. Emerg. Dis. 2021, 68, 2111–2120. [Google Scholar] [CrossRef]
- Garcia-Vozmediano, A.; Giglio, G.; Ramassa, E.; Nobili, F.; Rossi, L.; Tomassone, L. Dermacentor marginatus and Dermacentor reticulatus, and Their Infection by SFG Rickettsiae and Francisella-Like Endosymbionts, in Mountain and Periurban Habitats of Northwestern Italy. Vet. Sci. 2020, 7, 157. [Google Scholar] [CrossRef] [PubMed]
- Scarpulla, M.; Barlozzari, G.; Marcario, A.; Salvato, L.; Blanda, V.; De Liberato, C.; D’Agostini, C.; Torina, A.; Macrì, G. Molecular detection and characterization of spotted fever group rickettsiae in ticks from Central Italy. Ticks Tick-Borne Dis. 2016, 7, 1052–1056. [Google Scholar] [CrossRef]
- Ebani, V.V.; Bertelloni, F.; Turchi, B.; Filogari, D.; Cerri, D. Molecular survey of tick-borne pathogens in Ixodid ticks collected from hunted wild animals in Tuscany, Italy. Asian Pac. J. Trop. Med. 2015, 8, 714–717. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.L.; Colella, V.; Greco, G.; Fang, F.; Nurcahyo, W.; Hadi, U.K.; Venturina, V.; Tong, K.B.Y.; Tsai, Y.L.; Taweethavonsawat, P.; et al. Molecular detection of pathogens in ticks and fleas collected from companion dogs and cats in East and Southeast Asia. Parasites Vectors 2020, 13, 420. [Google Scholar] [CrossRef]
- Parola, P.; Raoult, D. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [PubMed]
- Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef]
- Beninati, T.; Genchi, C.; Torina, A.; Caracappa, S.; Bandi, C.; Lo, N. Rickettsiae in Ixodid ticks, Sicily. Emerg. Infect. Dis. 2005, 11, 509–511. [Google Scholar] [CrossRef] [PubMed]
- Torina, A.; Fernández de Mera, I.G.; Alongi, A.; Mangold, A.J.; Blanda, V.; Scarlata, F.; Di Marco, V.; de la Fuente, J. Rickettsia conorii Indian Tick Typhus strain and R. slovaca in humans, Sicily. Emerg. Infect. Dis. 2012, 18, 1008–1010. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.; Parreira, R.; Cotão, A.J.; Nunes, M.; Vieira, M.L.; Azevedo, F.; Campino, L.; Maia, C. Tick-borne bacteria and protozoa detected in ticks collected from domestic animals and wildlife in Central and Southern Portugal. Ticks Tick-Borne Dis. 2018, 9, 225–234. [Google Scholar] [CrossRef] [PubMed]
- Guccione, C.; Colomba, C.; Tolomeo, M.; Trizzino, M.; Iaria, C.; Cascio, A. Rickettsiales in Italy. Pathogens 2021, 10, 181. [Google Scholar] [CrossRef] [PubMed]
- Giudice, E.; Di Pietro, S.; Alaimo, A.; Blanda, V.; Lelli, R.; Francaviglia, F.; Caracappa, S.; Torina, A. A molecular survey of Rickettsia felis in fleas from cats and dogs in Sicily (Southern Italy). PLoS ONE 2014, 9, e106820. [Google Scholar] [CrossRef] [PubMed]
- Reif, K.E.; Macaluso, K.R. Ecology of Rickettsia felis: A review. J. Med. Entomol. 2009, 46, 723–736. [Google Scholar] [CrossRef] [PubMed]
- Selmi, R.; Belkahia, H.; Tayh, G.; Mezzi, A.; Chibani, S.; Ben Said, M.; Messadi, L. First detection of Rickettsia felis and Ehrlichia canis in the common bed bug Cimex lectularius. Comp. Immunol. Microbiol. Infect. Dis. 2024, 110, 102200. [Google Scholar] [CrossRef] [PubMed]
- Sulis, G.; Rodari, P.; Caligaris, S.; Tomasoni, L.R.; Castelli, F.; Gulletta, M. A case of Rickettsia felis infection imported from Nepal. J. Travel Med. 2015, 22, 276–278. [Google Scholar] [CrossRef] [PubMed][Green Version]
- de Sousa, R.; Barata, C.; Vitorino, L.; Santos-Silva, M.; Carrapato, C.; Torgal, J.; Walker, D.; Bacellar, F. Rickettsia sibirica isolation from a patient and detection in ticks, Portugal. Emerg. Infect. Dis. 2006, 12, 1103–1108. [Google Scholar] [CrossRef] [PubMed]
- Halajian, A.; Palomar, A.M.; Portillo, A.; Heyne, H.; Romero, L.; Oteo, J.A. Detection of zoonotic agents and a new Rickettsia strain in ticks from donkeys from South Africa: Implications for travel medicine. Travel Med. Infect. Dis. 2018, 26, 43–50. [Google Scholar] [CrossRef] [PubMed]
- Mura, A.; Masala, G.; Tola, S.; Satta, G.; Fois, F.; Piras, P.; Rolain, J.M.; Raoult, D.; Parola, P. First direct detection of rickettsial pathogens and a new Rickettsia species, Candidatus Rickettsia barbariae, in ticks from Sardinia, Italy. Clin. Microbiol. Infect. 2008, 14, 1028–1033. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.S.; Li, H.Y.; Yin, X.P.; Liu, Z.Q.; Chen, C.F.; Wang, Y.Z. First detection of Candidatus Rickettsia barbariae in the flea Vermipsylla alakurt from north-western China. Parasites Vectors 2016, 9, 325. [Google Scholar] [CrossRef]
- Ereqat, S.; Nasereddin, A.; Al-Jawabreh, A.; Azmi, K.; Harrus, S.; Mumcuoglu, K.; Apanaskevich, D.; Abdeen, Z. Molecular detection and identification of spotted fever group Rickettsiae in ticks collected from the West Bank, Palestinian Territories. PLoS Negl. Trop. Dis. 2016, 10, e0004348. [Google Scholar] [CrossRef]
- Vanegas, A.; Keller, C.; Krüger, A.; Manchang, T.K.; Hagen, R.M.; Frickmann, H.; Veit, A.; Achukwi, M.D.; Krücken, J.; Poppert, S. Molecular detection of spotted fever group Rickettsiae in ticks from Cameroon. Ticks Tick-Borne Dis. 2018, 9, 1049–1056. [Google Scholar] [CrossRef]
- Duron, O.; Sidi-Boumedine, K.; Rousset, E.; Moutailler, S.; Jourdain, E. The importance of ticks in Q fever transmission: What has (and has not) been demonstrated? Trends Parasitol. 2015, 31, 536–552. [Google Scholar] [CrossRef]
- Sireci, G.; Badami, G.D.; Di Liberto, D.; Blanda, V.; Grippi, F.; Di Paola, L.; Guercio, A.; de la Fuente, J.; Torina, A. Recent advances on the innate immune response to Coxiella burnetii. Front. Cell Infect. Microbiol. 2021, 11, 754455. [Google Scholar] [CrossRef]
- Dabaja, M.F.; Greco, G.; Blanda, V.; Tempesta, M.; Bayan, A.; Torina, A.; Vesco, G.; D’Agostino, R.; Lelli, R.; Ezzedine, M.; et al. Multispacer sequence typing of Coxiella burnetii from milk and hard tick samples from ruminant farms in Lebanon. Vet. Ital. 2020, 56, 289–296. [Google Scholar] [CrossRef]
- Liu, J.; Guan, G.; Yin, H. Theileria annulata. Trends Parasitol. 2022, 38, 265–266. [Google Scholar] [CrossRef] [PubMed]
- Gargano, V.; Blanda, V.; Gambino, D.; La Russa, F.; Di Cataldo, S.; Gentile, A.; Schirò, G.; Torina, A.; Millán, J.; Vicari, D. Serological survey and molecular characterization of Theileria annulata in Sicilian cattle. Pathogens 2021, 10, 101. [Google Scholar] [CrossRef] [PubMed]
- Giménez-Pardo, C.; Martínez-Grueiro, M.M. Some hydrolase activities from the tick Hyalomma lusitanicum Koch, 1844 (Ixodoidea: Ixodida). Parasite 2008, 15, 589–593. [Google Scholar] [CrossRef][Green Version]
Pathogen | Gene Target | PCR Assay | Primer/Probe Sequences | Reference |
---|---|---|---|---|
Rickettsia spp. | ompA | Nested PCR | Rr190.70p 5′-ATGGCGAATATTTCTCCAAAA-3′- Rr190.701n 5′-GTTCCGTTAATGGCAGCATCT--3′ Rr190.602n 5′-AGTGCAGCATTCGCTCCCCCT-3′ | [16] |
Rickettsia spp. | ompB | Nested PCR | rompB OF 5′-GTAACCGGAAGTAATCGTTTCGTAA-3′ rompB OR 5′-GCTTTATAACCAGCTAAACCACC-3′ rompB SFG IF 5′-GTTTAATACGTGCTGCTAACCAA-3′ rompB SFG IR 5′-GGTTTGGCCCATATACCATAAG-3′ | [17] |
Rickettsia spp. | gltA | PCR | 409D 5′-CCTATGGCTATTATGCTTGC-3′ 1258N ATTCCAAAAAGTACAGTGAACA-3′ | [18] |
Anaplasma spp. | 16S-rRNA | Nested PCR | EE1 5′-TCCTGGCTCAGAACGAACGCTGGCGGC-3′ EE2 5′-AGTCACTGACCCAACCTTAAATGGCTG-3′ EE3 5′-GTCGAACGGATTATTCTTTATAGCTTGC-3′ EE4 5′-CCCTTCCGTTAAGAAGGATCTAATCTCC-3′ | [19] |
Coxiella burnetii | IS1111 | Real-time PCR | sIS1pri F 5′- CGGGTTAAGCGTGCTCAGTAT-3′ sIS1pri R 5′- TCCACACGCTTCCATCACCAC- 3′ Tqpro sIS1 (5′-FAM/3′-BHQ1) 5′-AGCCCACCTTAAGACTGGCTACGGTGGAT-3′ | [20] |
Coxiella burnetii | htpB | PCR | Q3 5′-GGCAATCACCAATAAGGGCCG-3′ Q5 5′-GCGGGTGATGGTACCACAACA-3′ | [21] |
Borrelia spp. | ospA | Real-time PCR | Bor_OspA_F 5′- AATATTTATTGGGAATAGGTCTAA-3′ Bor_OspA_R 5′-CACCAGGCAAATCTACTGA-3′ Bor_OspA_TM (5′-FAM/3′-BHQ1) 5′-TTAATAGCATGYAAGCAAAATGTTAGCA-3′ | [22] |
Piroplasmids | 18S rRNA | Real-time PCR | Bab18S_F 5′- CATGAACGAGGAATGCCTAGTATG- 3′ Bab18S_R 5′- CCGAATAATTCACCGGATCACTC–3′ Bab18S_Pr (5′-FAM/3′-BQ1) 5′- CCGAATAATTCACCGGATCACTC—3′ | [23] |
Piroplasmids | 18S rRNA | PCR | PIROA 5′-AATACCCAATCCTGACACAGGG-3′ PIROB 5′-TTAAATACGAATGCCCCCAAC-3′ | [24] |
Free-Living Tick Species | No. of Male Tick Count | No. of Female Tick Count | Positive/Total Number (Positive Percentage) | Tick-Borne Pathogens |
---|---|---|---|---|
Hyalomma lusitanicum | 25 | 44 | 18/69 (26.1) | Rickettsia massiliae (2) |
Rickettsia massiliae—Candidatus Rickettsia shennongii (2) | ||||
Candidatus Rickettsia shennongii (1) | ||||
Rickettsia slovaca (10) | ||||
Rickettsia felis (1) | ||||
Coxiella burnetii (1) | ||||
Theileria annulata (1) | ||||
Rhipicephalus pusillus | 14 | 13 | 2/27 (7.4) | Rickettsia massiliae (1) Candidatus Rickettsia shennongii (1) |
Rhipicephalus bursa | 4 | 8 | 3/12 (25) | Rickettsia barbariae (3) |
Rhipicephalus sanguineus s.l. | 0 | 17 | 1/17 (5.9) | Rickettsia conorii (1) |
Rhipicephalus turanicus | 5 | 4 | 3/9 (33.3) | Rickettsia massiliae (1) |
Rickettsia massiliae—Candidatus Rickettsia shennongii (1) | ||||
Candidatus Rickettsia shennongii (1) | ||||
Dermacentor marginatus | 0 | 3 | 1/3 (33.3) | Rickettsia slovaca (1) |
Feeding Tick Species | Positive/Total Number (Positive Percentage) | Tick-Borne Pathogens | ||
Hyalomma lusitanicum | 51 | 24 | 1/75 (1.3) | Rickettsia massiliae (1) |
Dermacentor marginatus | 0 | 2 | 1/2 (50) | Rickettsia massiliae (1) |
Collection Site | Tick Species | Positive/Total Number per Site (Positive Percentage; CI 95%) | Tick-Borne Pathogens |
---|---|---|---|
Site 1—Sede Landolina | Hyalomma lusitanicum | 5/37 (13.5) | Rickettsia massiliae (1) |
Rickettsia massiliae—Candidatus Rickettsia shennongii (2) | |||
Candidatus Rickettsia shennongii (1) | |||
Coxiella burnetii (1) | |||
Rhipicephalus pusillus | 0/7 | ||
Rhipicephalus bursa | 0/6 | ||
Site 2—Boschetto Airoldi | Hyalomma lusitanicum | 1/7 (14.2) | Rickettsia massiliae (1) |
Rhipicephalus pusillus | 2/17 (11.7) | Rickettsia massiliae (1) | |
Candidatus Rickettsia shennongii (1) | |||
Rhipicephalus bursa | 3/6 (50) | Rickettsia barbariae (3) | |
Rhipicephalus sanguineus s.l. | 1/14 (7.1) | Rickettsia conorii (1) | |
Rhipicephalus turanicus | 3/9 (33.3) | Rickettsia massiliae (1) | |
Rickettsia massiliae—Candidatus Rickettsia shennongii (1) | |||
Candidatus Rickettsia shennongii (1) | |||
Site 3—Gorgo Santa Rosalia | Hyalomma lusitanicum | 12/25 (48) | Rickettsia slovaca (10) |
Rickettsia felis (1) | |||
Theileria annulata (1) | |||
Rhipicephalus pusillus | 0/3 | ||
Rhipicephalus sanguineus s.l | 0/3 | ||
Dermacentor marginatus | 1/3 (33.3) | Rickettsia slovaca (1) | |
Wild boar carcasses | Hyalomma lusitanicum | 1/75 (1.3) | Rickettsia massiliae (1) |
Dermacentor marginatus | 1/2 (50) | Rickettsia massiliae (1) |
Sample Id | Target | Taxon | Blast Id | Country of Origin | Reference | Blast Id % |
---|---|---|---|---|---|---|
MP-IV | ompB | R. felis | OM681612 | India | [28] | 99% |
MP-III tick3 * | ompB | R. slovaca | MK301607 | Spain | [29] | 100% |
MP-III tick4 | ompB | R. slovaca | MK301607 | Spain | [29] | 100% |
MP-III tick5 | ompB | R. slovaca | MK301607 | Spain | [29] | 100% |
MP-III tick6 | ompB | R. slovaca | MK301607 | Spain | [29] | 100% |
MP-III tick8 | ompB | R. slovaca | MK301607 | Spain | [29] | 99% |
MP-III tick10 | ompB | R. slovaca | MK301607 | Spain | [29] | 100% |
MP-III tick13 | ompB | R. slovaca | MK301607 | Spain | [29] | 99% |
MP-I tick17 | ompB | R. massiliae | MN853118/CP000683 | Portugal | [30,31] | 99% |
MP-I tick25 | ompB | R. massiliae—Candidatus R. shennongii | ON646173/ON015827 | Taiwan | [26,32] | 100/99% |
MP-I tick26 * | ompB | R. massiliae—Candidatus R. shennongii | ON646173/ON015827 | Taiwan | [26,32] | 100/99% |
MP-I tick27 | ompB | R. massiliae—Candidatus R. shennongii | ON646173/ON015827 | Taiwan | [26,32] | 99/99% |
MP-I tick35 | ompB | R. massiliae | MN853118/CP000683 | Portugal | [30,31] | 99% |
MP-I tick36 | ompB | R. massiliae | MN853118/CP000683 | Portugal | [30,31] | 99% |
MP-I tick46 | ompB | R. massiliae | MN853118/CP000683 | Portugal | [30,31] | 99% |
MP-I tick61 | ompB | Candidatus R. barbariae | KY233287 | Lebanon | [33] | 100% |
MP-II tick17-1 | ompB | R. massiliae | MN853118/CP000683 | Portugal | [30] | 99% |
MP-II tick16-2 | ompB | R. massiliae | MN853118/CP000683 | Portugal | [30] | 99% |
MP-III tick2 | ompA | R. slovaca | OP729880 | Spain | [29] | 100% |
MP-III tick3 * | ompA | R. slovaca | OP729880 | Spain | [29] | 99% |
MP-III tick7 | ompA | R. slovaca | OP729880 | Spain | [29] | 99% |
MP-III tick9 | ompA | R. slovaca | OP729880 | Spain | [29] | 100% |
MP-III tick14 | ompA | R. slovaca | OP729880 | Spain | [29] | 99% |
MP-I tick26 * | ompA | Candidatus R. shennongii | OL856103 | China | [26] | 99% |
MP-I tick28 | ompA | Candidatus R. shennongii | OL856103 | China | [26] | 99% |
MP-I tick29 | ompA | Candidatus R. shennongii | OL856103 | China | [26] | 99% |
MP-I tick38 | ompA | R. conorii | KY069258 | China | [34] | 98% |
MP-I tick42 | ompA | Candidatus R. shennongii | OL856103 | China | [26] | 100% |
MP-I tick64 | ompA | Candidatus R. barbariae | KY233249 | Lebanon | [33] | 100% |
MP-I tick65 | ompA | Candidatus R. barbariae | KY233249 | Lebanon | [33] | 100% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Bella, S.; Blanda, V.; Scibetta, S.; Giacchino, I.; Gentile, A.; Chiarenza, G.; Cannella, V.; Provinzano, G.; Grippi, F.; Guercio, A. Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission. Animals 2025, 15, 72. https://doi.org/10.3390/ani15010072
Di Bella S, Blanda V, Scibetta S, Giacchino I, Gentile A, Chiarenza G, Cannella V, Provinzano G, Grippi F, Guercio A. Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission. Animals. 2025; 15(1):72. https://doi.org/10.3390/ani15010072
Chicago/Turabian StyleDi Bella, Santina, Valeria Blanda, Silvia Scibetta, Ilenia Giacchino, Antonino Gentile, Giuseppina Chiarenza, Vincenza Cannella, Giovanni Provinzano, Francesca Grippi, and Annalisa Guercio. 2025. "Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission" Animals 15, no. 1: 72. https://doi.org/10.3390/ani15010072
APA StyleDi Bella, S., Blanda, V., Scibetta, S., Giacchino, I., Gentile, A., Chiarenza, G., Cannella, V., Provinzano, G., Grippi, F., & Guercio, A. (2025). Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission. Animals, 15(1), 72. https://doi.org/10.3390/ani15010072