Next Article in Journal
Human-Caused High Direct Mortality in Birds: Unsustainable Trends and Ameliorative Actions
Previous Article in Journal
Flavonoids, Isoquinoline Alkaloids, and Their Combinations Affect Growth Performance, Inflammatory Status, and Gut Microbiome of Broilers Under High Stocking Density and Heat Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission

by
Santina Di Bella
1,
Valeria Blanda
1,2,*,
Silvia Scibetta
1,*,
Ilenia Giacchino
2,
Antonino Gentile
1,
Giuseppina Chiarenza
2,
Vincenza Cannella
1,
Giovanni Provinzano
3,
Francesca Grippi
2,† and
Annalisa Guercio
1,†
1
Centro di Referenza Nazionale per Anaplasma, Babesia Rickettsia, Theileria (C.R.A.Ba.R.T.), Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri”, 90129 Palermo, Italy
2
Area Diagnostica Sierologica, Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri”, 90129 Palermo, Italy
3
Riserva Naturale Monte Pellegrino, Ente Gestore Associazione Ranger d’Italia Sezione Sicilia ODV, 90146 Palermo, Italy
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2025, 15(1), 72; https://doi.org/10.3390/ani15010072
Submission received: 13 November 2024 / Revised: 23 December 2024 / Accepted: 26 December 2024 / Published: 31 December 2024
(This article belongs to the Section Veterinary Clinical Studies)

Simple Summary

Ticks are a serious health concern for animals and humans because they spread many infectious pathogens. This study focused on ticks collected from a nature reserve in Sicily (Italy), a popular area for recreation that is also inhabited by wild boars. The analysis concerned 214 ticks, including those found in the environment and those taken from wild boars, using molecular techniques to detect tick-borne pathogens (TBPs), especially those that can infect humans. Six species of ticks were identified: Hyalomma lusitanicum, Rhipicephalus pusillus, Rh. sanguineus s.l., Rh. bursa, Rh. turanicus, and Dermacentor marginatus. Fourteen percent of the ticks tested positive for pathogens, mostly bacteria from the Rickettsia genus, followed by single detections of Coxiella burnetii and Theileria annulata. Molecular identification detected Rickettsia slovaca, R. massiliae, Candidatus R. shennongii, R. conorii, R. felis, and R. barbariae. This diversity of ticks and pathogens highlights a potential risk to public health. The study found new links between specific tick species and TBPs, though further research is needed to understand these ticks’ roles as vectors. It emphasizes the need to monitor ticks in both rural and urban areas to help prevent the spread of tick-borne diseases.

Abstract

Ticks are a major concern for both animal and human health, as they are primary vectors of infectious pathogens. This study focused on ticks found in a nature reserve in southern Italy, highly frequented for recreational activities and inhabited by wild boars. Using molecular techniques, 214 ticks, including questing ticks and those removed from wild boars, were examined for tick-borne pathogens (TBPs), with a focus on zoonotic pathogens. Six tick species were identified: Hyalomma lusitanicum, Rhipicephalus pusillus, Rh. sanguineus s.l., Rh. bursa, Rh. turanicus, and Dermacentor marginatus, several of which are known vectors of zoonotic pathogens. Overall, 14% of ticks were positive for TBPs, mainly bacteria of Rickettsia genus. Molecular analyses detected Rickettsia slovaca, R. massiliae, Candidatus R. shennongii, R. conorii, R. felis, and R. barbariae. Additionally, single detections of Coxiella burnetii and Theileria annulata were recorded. Phylogenetic analyses were conducted on Rickettsia sequences. The range of ticks and TBPs present in this area highlights potential public health concerns. New associations between tick species and TBPs were documented, though vector roles need further investigation. The study highlights the importance of monitoring tick populations in both rural and urban environments to protect public health and prevent tick-borne disease spreading.

1. Introduction

Ticks (Acari: Ixodidae) are among the primary vectors of infectious diseases in animals and represent a significant global threat to humans, pets, wildlife, and livestock. They play a key role in transmitting various tick-borne pathogens (TBPs), including bacteria (e.g., Borrelia, Rickettsia, Anaplasma), viruses (e.g., tick-borne encephalitis virus (TBEV)), and protozoa (e.g., Babesia, Theileria), some of which are also responsible for zoonotic diseases [1].
In recent years, there has been growing attention toward ticks and the pathogens they transmit, particularly those responsible for zoonotic diseases. The global increase in both TBPs and the incidence of tick-borne diseases is driven by complex, multifaceted global changes [2,3]. Several factors are contributing to the increased interaction between humans and these arthropods, including climate change [4], the rising presence of wild animals in rural and peri-urban areas [5], and the growing public interest in outdoor activities [6]. As a result, human tick-borne diseases are emerging and have become a significant public health concern [7].
Urban parks and nature reserves are heavily frequented areas for recreational and sporting activities, as well as for day trips. The Monte Pellegrino Nature Reserve is a regional protected area established in 1996, located in the northern part of Palermo (Sicily, Italy). The reserve hosts a diverse range of fauna and flora, featuring an extensive artificial forest as well as various natural habitats, contributing to significant biodiversity [8]. Additionally, the reserve serves as a popular recreational area for many inhabitants of the city. A previous study was conducted in the same area to analyze the spatial and temporal distribution of ticks in the peri-urban area. The species collected included Ixodes ventalloi, Hyalomma lusitanicum, Rhipicephalus sanguineus, Rhipicephalus pusillus, Haemaphysalis sulcata, Dermacentor marginatus, and Rhipicephalus turanicus. Many of these tick species are significant pathogen vectors, indicating the potential exposure of both animals and humans to TBPs [8]. However, a study of the pathogens present in ticks from this area has never been conducted so far.
Additionally, in recent years, a significant increase in wild boar (Sus scrofa) presence has been recorded. Wild boars are commonly infested with hard ticks, and their populations have been increasing across Europe since 1965 [9]. This species can serve as a reservoir for zoonotic pathogens and contribute to maintaining and spreading tick populations. Additionally, they are frequently found in close proximity to human population, as they are increasingly occupying or using urbanized areas [10].
Currently, vector surveillance and control measures remain the most effective approach to limit tick-borne diseases since effective vaccines are unavailable for most TBPs [11,12]. Monitoring tick distribution and identifying pathogens harbored by these vectors are among the most valuable strategies for reducing the risk of tick-borne diseases’ transmission.
This study aimed to investigate the presence of TBPs in questing ticks collected from a nature reserve in southern Italy frequented for recreational activities. Moreover, given the increasing reports of wild boars in this reserve, our study also investigated the presence of TBPs in ticks feeding on wild boars found as carcasses in the same reserve, located in close proximity to a densely populated area.

2. Materials and Methods

2.1. Study Area

The monitoring activities were conducted during the year 2022 within the Monte Pellegrino Nature Reserve, situated within the municipality of Palermo, approximately a few kilometers from the urban center (Figure 1). Ticks were collected from three different sites: Site no.1 Sede Landolina (Lon 13.33809; Lat 38.17215; 76 m above sea level a.s.l.); Site no 2. Boschetto Airoldi (Lon 13.35141; Lat 38.14946; 35 m a.s.l.); Site no 3. Gorgo S. Rosalia (Lon 13.35179; Lat 38.17005; 392 m a.s.l.). The collection sites are described in detail elsewhere [8].

2.2. Tick Collection and Morphological Identification

Sampling was conducted over a few months, in late spring–summer 2022, specifically from May to July, which coincides with the peak period for recreational activities in the nature reserve. This period aligns with the high levels of human and animal activity in the area, ensuring that the collected samples reflect the season of highest tick abundance and pathogen transmission risk. These months also correspond to the time when wild boar carcasses have been found in the area, which was a key factor in sampling design. The concurrent presence of high tick populations, reserve visitors, and wild boar carcasses during this period provides a snapshot of tick-borne pathogen circulation in a critical temporal window.
Questing ticks were collected by dragging a blanket (1 × 1 m) over the vegetation. In addition, feeding ticks were collected from five wild boar carcasses found in the reserve. Collected specimens were placed in sterile tubes for morphological identification.
Concerning ticks from wild boars, the whole body of each animal was examined for the presence of ticks. Sterile, fine-tipped forceps were used to detach ticks from the host and the removed samples were stored in sterile tubes. On arrival at the laboratory, ticks were kept alive for a week at room temperature, so that any ingested blood was allowed to be digested, and then stored with 70% ethanol at room temperature until identification and DNA extraction.
Ticks were initially identified according to their morphological characteristics, following previously established standard taxonomic keys [13,14], with further classification according to the molecular methods described below.

2.3. DNA Extraction from Ticks

For molecular analysis, ticks were cut longitudinally into two halves; one half was sliced into small pieces, while the other half was stored at −20 °C as a backup. Genomic DNA extraction was then performed on each tick individually using the DNeasy Blood and Tissue Kit (Qiagen, Germany). The ticks were first mechanically disrupted in 200 µL of tissue lysis buffer provided in the kit and treated with proteinase K (100 µg/mL) at 56 °C overnight. Subsequent steps were carried out according to the manufacturer’s instructions. Extracted DNA was quantified using a NanoDrop™ 2000 spectrophotometer and then stored at −20 °C until further use.

2.4. Tick Molecular Identification

A fragment of Cytochrome c Oxidase subunit I (COI) gene, approximately 710 bp, was analyzed to confirm tick identification. This gene was amplified via polymerase chain reaction (PCR) using primers specific to invertebrates [15].

2.5. Molecular Detection of Pathogens and Sequencing

All ticks were tested for the relevant target genes, which included ompA and ompB, insertion sequence (IS1111), and htpB, ospA, 16S rRNA, and 18S rRNA genes for Rickettsia, Coxiella, Borrelia, Anaplasma, and Piroplasmids, respectively. The reactions for Rickettsia and Anaplasma were run under nested PCR settings; the other reactions were run under the real-time PCR settings. Amplification of Coxiella burnetii and Piroplasmids’ DNA was carried out by conventional PCRs. To better identify the species, gltA was used as an additional target for Rickettsia by performing conventional PCR on a limited number of samples. Protocols are published elsewhere [16,17,18,19,20,21,22,23,24]. All primers and probes used in this study are listed in Table 1.
Real-time PCR assays were carried out in a CFX96 Real-Time System (Bio-Rad, Hercules, CA) or QuantStudio™ 6 Pro Real-Time PCR System (Life Technologies, Thermo Fisher Scientific, Carlsbad, CA, USA). Reaction mix included 1X SsoAdvanced Universal Probes Supermix (Bio Rad Laboratories, Hercules, CA, USA), 500 nM of each primer, and 500 nM of probe, in a 20 µL total volume. The following thermal cycle conditions were used: 95 °C for 3 min, 40 cycles of 95 °C for 10 s, and 60 °C for 30 s. Coxiella burnetii DNA (provided by Istituto Zooprofilattico Sperimentale delle Venezie, Legnaro, Italy), B. burgdorferi s.l. DNA extracted from the IFA slides (Fuller Laboratories, Fullerton, CA, USA), and B. microti DNA provided by the WOAH Reference Center for Babesiosis were used as positive controls. Nuclease-free water was used as a negative control.
Conventional PCR assays were carried out in a SimpliAmp thermal cycler (Thermo Fisher Scientific Inc., Waltham, MA) in a final volume of 50 µL, using GoTaq G2 DNA Polymerase (Promega Italia s.r.l., Milan, Italy) with 5 µL of each DNA extract. Positive and negative controls were included in each amplification assay to evaluate the presence of appropriately sized amplicons and to rule out potential contamination. In particular, R. conorii DNA (Amplirun, Vircell, Granada, Spain), A. phagocytophilum DNA extracted from IFA slides (Fuller Laboratories, Fullerton, CA, USA), and Babesia microti DNA provided by the WOAH Reference Center for Babesiosis were used as positive controls. Nuclease-free water was used as a negative control. The amplicons were visualized by electrophoresis on a 2% agarose gel and observed using a SybrSafe nucleic acid staining solution under UV light. A 100 bp DNA ladder was used as a molecular-weight size marker (Amplisize® Molecular Ruler, BioRad Laboratories, Hercules, CA, USA). The PCR products were quantified and sent for sequencing to Macrogen Inc. (Macrogen Europe, Amsterdam, The Netherlands). The obtained raw data, for the ompA and ompB genes, were visualized and manually edited through Chromas (Technelysium Pty Ltd., Tewantin, Australia). The fasta sequences were generated and submitted to BLAST (Basic Local Alignment Search Tool, version 2.13.0) at NCBI (National Center for Biotechnology Information) to identify the closest matching species based on sequence homology.

2.6. Phylogenetic Analysis

For phylogenetic tree construction, sequence alignments were carried by MUSCLE implemented in MEGA XI [25] comparing Rickettsia spp. sequences indicated from BLAST analysis and closely related reference sequences selected from previous studies retrieved from NCBI molecular database [26,27]. Individual phylogenetic trees based on the ompA and ompB fragments were constructed using the maximum likelihood (ML) method and the Kimura 2-parameter model. The number of base substitutions per site between sequences, visualized by matrix, were conducted using the Kimura 2-parameter model by MEGA XI.

3. Results

3.1. Sampled Ticks

A total of 214 ticks were collected within the Monte Pellegrino Nature Reserve and analyzed for the presence of TBP DNA. In particular, 137 (64%) were free-living ticks and 77 (36%) were collected from wild boar carcasses.
Among questing ticks, 69 (50.4%) H. lusitanicum, 27 (19.7%) Rh. pusillus, 17 (12.4%) Rh. sanguineus s.l., 12 (8.7%) Rh. bursa, 9 (6.5%) Rh. turanicus, and 3 (2.2%) D. marginatus were collected from the three sampling sites. All the collected ticks were adults, comprising 48 males and 89 females.
Regarding the 77 feeding ticks collected from wild boars, all were adults, comprising 51 males and 26 females; 75 (97.4%) were H. lusitanicum and 2 (2.6%) were D. marginatus.
Details on collected ticks are reported in Table 2 and Table 3.

3.2. Pathogen Detection

Overall, 30 (14.0%) of the examined ticks tested positive for TBPs. Details on detected pathogens in relation to tick species and collection sites are reported in Table 2 and Table 3.
In particular, 28 (13.1%) of the examined ticks were positive for Rickettsia spp.; out of them, 26 were free-living and 2 were collected from wild boars.

3.2.1. Pathogen Detection from Questing Ticks

Molecular identification detected R. slovaca in 11 ticks, of which 10 were H. lusitanicum and 1 was D. marginatus. Rickettsia massiliae was identified in 4 ticks: 2 H. lusitanicum, 1 Rh. turanicus and 1 Rh. pusillus. A total of three ticks (one Rh. pusillus, one Rh. turanicus, and one H. lusitanicum) resulted as positive for Candidatus R. shennongii. In three cases (two H. lusitanicum and one Rh. turanicus), a non-discriminative species identification between R. massiliae and Canidatus R. shennongii was obtained. Rickettsia conorii was detected in one Rh. sanguineus and Rickettsia felis in one H. lusitanicum. Moreover, R. barbariae was found in three Rh. bursa.
Coxiella burnetii was detected in one H. lusitanicum (0.5%).
A H. lusitanicum (0.5%) resulted as positive for piroplasm presence. Sequence analyses revealed the presence of T. annulata.
No coinfections were detected.
All the other investigated pathogens were absent.

3.2.2. Pathogen Detection from Wild Boar Carcasses

Two ticks positive for R. massiliae, one for H. lusitanicum, and one for D. marginatus were collected from wild boars.

3.3. Rickettsia spp. Phylogenetic Analysis

After the editing of the raw sequences, 18 sequences of good quality of the target ompB and 12 of the target ompA were retrieved. Only two samples were analyzed by both targets (MP-I tick26 and MP-III tick3). Comparing sequences to the NCBI nucleotide database by BLAST, all of them were related to Rickettsia spp. (Table 4). The ML trees, respectively, for ompB (Figure 2) and ompA (Figure 3), clearly showed the taxonomic relationship between the analyzed sequences.
The ompB revealed the presence of R. slovaca as the most frequent in the samples (7 of 18) showing very high homology, from 99% to 100%, to an R. slovaca sequence obtained from a questing Ixodes ricinus in Spain (MK301607). Rickettsia felis was identified in a single sample with 99% homology to a reference sequence obtained from Haemaphysalis intermedia in India (OM681612). Rickettsia barbariae, detected in a single sample, showed total homology to a reference sequence of R. barbariae from Rh. turanicus obtained in Lebanon (KY233287). Rickettsia massiliae was identified in six samples, with 99% homology to a Portuguese sequence (Table 4; Figure 2), obtained from Rh. sanguineus (MN853118). In the other three samples, however, ompB did not show suitable variability to discriminate between many references of R. massiliae and the newly described species Candidatus R. shennongii (ON015827) from Rhipicephalus haemaphysaloides from China, which remained in doubt (Table 4; Figure 2). These sequences showed total identity only to a small group of sequences of R. massiliae from Rh. haemaphysaloides from Taiwan (ON646173), which appeared instead quite different from the other R. massiliae references. This appeared also evident when comparing the ompB nucleotide alignment and the matrix of diversity of these identities to the closest references (Figure 4A).
For one of these doubt samples, MP-I tick26, the ompA gene sequence was also obtained, which instead revealed a major identity (99%) towards Candidatus R. shennongii from Rh. haemaphysaloides obtained in China (OL856103). The ompA analysis also indicated the presence of Candidatus R. shennongii in the other three samples, with very high homology (99–100%) to the same sequence as for MP-I tick26 (Table 4; Figure 3). Comparing the ompA nucleotide alignment and the matrix of diversity of these identities to the closest references, these four samples showed the major similarity to Candidatus R. shennongii (Figure 4B).
The ompA sequences also indicated the presence of R. slovaca as the most frequent in the samples (5 of 12) showing very high homology, from 99% to 100%, to Spanish sequences obtained from D. marginatus (OP729880). In two samples, R. barbariae was identified with ompA, with total homology to a sequence (KY233249) from a Rh. turanicus from Lebanon (Table 4; Figure 3). One sequence of ompA indicated a group of R. conorii from China detected in Rh. turanicus as the closest species (KY069258), but the identity was only 98% (seven nucleotides different) (Table 4; Figure 3).
The target gltA was secondarily implemented in the analysis, just to help in clarifying the position of the doubt samples Candidatus R. shennongii/R. massiliae. To test the potential of the target in discriminating between these two species, the sample MP-I tick26 was amplified and sequenced. Results from BLAST indicated our gltA sequence matched 100% to Candidatus R. shennongii from Rh. haemaphysaloides (OL856116) [26] but also to an isolate of R. rhipicephali from Rh. sanguineus s. l. Iran (OM912835, Esmaili et al., unpublished) and an isolate of R. massiliae (OQ409918, Yarmukhamedova et al., unpublished) from Uzbekistan. Results from the phylogenetic tree, although, apparently suggested a major similarity towards Candidatus R. shennongii, but nucleotide dissimilarity, varying from one to three nucleotides only, indicated a very low level of divergence towards the other clusters of R. massiliae (Figure 5).

4. Discussion

This study investigated the presence of zoonotic agents in ticks collected from a nature reserve in close proximity to the urban area in southern Italy. This area was previously the focus of a more extensive study that examined the temporal and spatial distribution of tick populations [8]. In comparison to the earlier research, the present study involved a smaller number of ticks, as it primarily focused on pathogen detection rather than assessing the ecological and seasonal distribution of ticks in the area. The relative proportions of the different tick species between the two studies varied, likely due to several factors: the total number of ticks analyzed, the number of sampling sites (three in this study compared to six in the previous one), the sampling seasonality (spring–summer in this study versus year-round sampling in the previous one), and the inclusion of ticks collected not only from the environment but also from wild boars inhabiting the reserve, an aspect not addressed in the earlier study.
The study demonstrates the presence of both established and potential vector species of pathogens that affect animals and humans [8]. The following tick species were detected: H. lusitanicum, Rh. sanguineus s.l., Rh. turanicus, Rh. bursa, D. marginatus, and H. marginatum.
Among the sampled ticks, H. lusitanicum was the most frequently identified species. This tick predominantly parasitizes large mammals, such as domestic ruminants and pigs, and is primarily associated with the transmission of Anaplasma spp. and T. annulata [35]. Moreover, the transovarial and transstadial transmission of C. burnetii, the causative agent of Q fever, was documented in H. lusitanicum, although its vector competence for this bacterium remains to be fully established [36,37]. Hyalomma lusitanicum may also contribute to the transmission of spotted fever group (SFG) Rickettsiae [38]. Additionally, both H. lusitanicum and H. marginatum are competent vectors for the Crimean-Congo hemorrhagic fever virus (CCHFV). Autochthonous cases of CCHF have recently emerged in Europe where the virus was previously absent, with human cases reported in Greece, Bulgaria, and Spain [39].
Rhipicephalus sanguineus s.l., the brown dog tick, is a recognized vector for several pathogens, including A. marginale, B. bigemina, and B. bovis [8]. This tick parasitizes a variety of hosts, including humans, and plays a significant role in transmitting zoonotic agents such as Rickettsia spp. [40].
Dermacentor marginatus, also known as the ornate sheep tick, is widely distributed across southern Europe [41]. Although D. marginatus is less frequently reported to bite humans, cases of this tick being collected from human patients have been reported [42]. It is a vector of B. caballi, T. equi, and potentially B. microti, the causative agent of human babesiosis. Additionally, it transmits R. sibirica and R. conorii and is the primary vector of R. slovaca [9]. Furthermore, it is capable of transmitting TBEV and CCHFV.
Rhipicephalus turanicus is associated with the transmission of Babesia spp. and multiple Rickettsia species, including R. monacensis, R. massiliae, R. conorii, and R. aeschlimannii [6,8]. As a multi-host tick, it parasitizes sheep, goats, cattle, and horses, as well as other mammals, birds, lizards, and snakes [14].
Rhipicephalus bursa has been involved in the circulation of several agents including A. marginale, T. equi [43], A. ovis, A. phagocytophilum [44], B. ovis [45], C. burnetii [46], Ehrlichia canis [47], R. barbariae, B. caballi, B. bigemina, and Theileria haneyi [48].
Ticks collected from wild boars in this study were predominantly H. lusitanicum, with a smaller proportion identified as D. marginatus. Both species are commonly associated with wild boars [35,49,50,51]. Our findings suggest that wild boars may contribute to the maintenance of these tick species, particularly H. lusitanicum, in urban and peri-urban environments, potentially increasing the risk of zoonotic disease transmission [9,50].
Concerning TBPs detected in this study, a notable infection rate of Rickettsia spp. in ticks emerged, with 13.1% positive samples (28 out of 214). This prevalence is comparable to the findings of Scarpulla et al. [52], who reported a 12.4% infection rate in 113 ticks collected from hosts and the environment in the Latium and Tuscany regions. However, it is lower than the 20.78% infection rate documented in a similar study conducted by Ebani et al. [53] on 77 pools of three ticks each in Tuscany. To date, there is a lack of updated data on the occurrence of Rickettsia species in free-living ticks from Sicily.
Phylogenetic analyses identified a diverse array of Rickettsia species.
Rickettsia slovaca emerged as the most frequently detected species, confirmed through both the ompA and ompB genetic targets. Additionally, the presence of R. felis and R. barbariae highlights the diversity of Rickettsia species in this region, some of which may have zoonotic potential. The detection of R. massiliae in multiple samples further suggests that this species is prevalent in the area.
However, one of the main challenges encountered in this study was the difficulty in distinguishing between R. massiliae and Candidatus R. shennongii based on the ompB sequence. However, the target ompA, instead, seems to clearly identify these sequences as Candidatus R. shennongii; the inconsistency observed between the two target genes adopted in this study was considered restrictive for a univocal identification of these samples. Also, the adoption of a third target, gltA, to test its potential did not solve the issue. Therefore, in these samples, for two tick species H. lusitanicum and Rh. turanicus, the identification remained at the genus level for Rickettsia spp.
Candidatus R. shennongii is a species recently identified in Rh. haemaphysaloides ticks in China [26]. Previously, this Rickettsia species was named Rickettsia sp. and was reported in Haemaphysalis spinigera, Haemaphysalis turturis, Haemaphysalis bandicota, and Rh. haemaphysaloides from India and Taiwan [27,54]. In pet ectoparasites from India, it was called R. massiliae [27], highlighting the confusion in discrimination. This agent shows a broad host and geographic range and, to the best of our knowledge, it is the first time that similarity with this species has been reported in Italy. The pathogenicity of Candidatus R. shennongii to humans is unknown. The eventual finding of Candidatus R. shennongii in Italy would be the first; therefore, more targets need to be investigated to strongly support this option.
The discovery of a potential new variant of R. conorii also warrants additional investigation, as it could represent an unrecognized strain circulating in the region.
In the present study, R. slovaca was detected in both D. marginatus and H. lusitanicum. Rickettsia slovaca is the primary etiological agent responsible for TIBOLA/DEBONEL (Tick-Borne Lymphadenopathy/Dermacentor-Borne Necrosis Erythema and Lymphadenopathy) [55]. In Europe, it is primarily associated with Dermacentor ticks, with D. marginatus and D. reticulatus confirmed as its main vectors [56]. The strong link between R. slovaca and D. marginatus is well documented, including within Sicilian tick populations [40,57]. Furthermore, previous research highlighted the elevated risk of R. slovaca-related rickettsiosis in Sicily and across other regions in the Mediterranean basin [58]. Hyalomma lusitanicum has been considered a less efficient vector for Rickettsia spp. [59], although its role in harboring R. slovaca was observed in earlier studies [37]. However, the capacity of H. lusitanicum to act as a competent vector for R. slovaca remains unconfirmed.
The presence of R. massiliae was detected in H. lusitanicum and Rh. sanguineus s.l. Rickettsia massiliae is mainly transmitted by ticks of the Rhipicephalus genus. In Europe, its vectors include Rh. sanguineus s.l., Rh. bursa, Rh. pusillus, and I. ricinus [56]. The detection of R. massiliae in Rhipicephalus ticks collected from humans was reported in Sicily [40]. The first human case of R. massiliae infection was reported in Sicily in a patient with Mediterranean spotted fever (MSF), and other two cases of TIBOLA/DEBONEL were attributed to R. massiliae in Italy [60].
In addition, two of the ticks collected from wild boars tested positive for R. massiliae, confirming previous reports of R. massiliae in H. lusitanicum from wild boars [35]. Unfortunately, it was not possible to test wild boar tissues for these pathogens. However, we can confidently state that wild boars carry ticks infected with zoonotic Rickettsia species. Considering the significant population expansion of wild boars in Sicily, as well as in many areas of Europe, coupled with their habit of venturing into urban areas in search of food, they may serve as effective sentinels for the risk of transmission of TBPs to humans in the area [9].
Another notable finding is the detection of R. felis, the etiological agent of flea-borne spotted fever, an emerging rickettsiosis of medical significance and a common cause of febrile illness in humans [61]. Although the cat flea (Ctenocephalides felis) is currently recognized as the only confirmed biological vector of R. felis, molecular evidence identified this pathogen in a range of arthropods, suggesting a broader host spectrum [62,63]. Human infections have been reported in several countries, including a case in Italy, which was likely imported [64].
Additionally, R. barbariae, an emerging member of the spotted fever group (SFG) Rickettsia, was identified in Rh. bursa. Initially detected in R. bursa ticks in Portugal in 2006 and provisionally named Rickettsia sp. PoTiRb169 [65], this pathogen has since been confirmed in ticks from several countries from Europe, Asia, and Africa. It was also identified in various tick species, including Rh. annulatus and Rh. simus [66,67], and genera such as Amblyomma and Hyalomma [33,68,69,70]. Beyond ticks, R. barbariae was amplified from the flea Vermipsylla alakurt [48,68]. These findings highlight the expanding range of arthropod hosts and potential vectors for this pathogen.
Coxiella burnetii was also detected in an H. lusitanicum tick. Although the transovarial transmission of C. burnetii in this tick species was documented, the role of ticks in the transmission of Q fever remains debated [71]. Domestic ruminants are considered the main source of human infections and the primary mode of transmission to humans is through the inhalation of aerosols contaminated with C. burnetii from infected animals [72,73].
Our findings, while based on a single positive case, reinforce the association between H. lusitanicum and T. annulata. Although T. annulata is not a zoonotic agent, its detection is noteworthy as it is the causative agent of tropical theileriosis, a disease with significant veterinary importance. This pathogen is widely distributed across southern Europe, North Africa, and Asia, placing an estimated 250 million cattle at risk of infection [74]. In Sicily, T. annulata exhibits a high prevalence among cattle, making bovine theileriosis one of the most common tick-borne diseases in the region, with outbreaks reported annually. A serological study conducted in Sicily between 2018 and 2019 documented seroprevalence rates in cattle farms ranging from 22% to 71% [75]. Hyalomma lusitanicum is one of the tick species implicated in the transmission of T. annulata [76], and it has been identified as the primary vector responsible for transmitting this pathogen to cattle in Sicily.

5. Conclusions

The study identified both established and potential vector species capable of transmitting pathogens to animals and humans, highlighting a diverse tick community. The detected species included H. lusitanicum, Rh. sanguineus s.l., Rh. turanicus, Rh. bursa, Rh. Pusillus, and D. marginatus. A significant infection rate with various Rickettsia species was observed among both questing and feeding ticks. Additionally, C. burnetii and T. annulata were identified in questing ticks.
Phylogenetic analysis revealed R. slovaca as the most frequently detected species. Other Rickettsia species identified included R. felis, R. barbariae, R. massiliae, R. conorii, and Candidatus R. shennongii. A key challenge in the study was distinguishing between R. massiliae and Candidatus R. shennongii. To confirm the presence of Candidatus R. shennongii and other potentially novel Rickettsia variants, future research should utilize larger sample sizes and additional genetic targets. The detection of potentially new species, such as Candidatus R. shennongii, underscores the importance of continuous surveillance and comprehensive molecular characterization of Rickettsia in tick populations.
The diversity of ticks and associated pathogens identified in the study area, combined with the presence of wildlife and novel host–pathogen relationships, has significant implications for the ecology of tick-borne diseases. These findings highlight a potential risk to both human and animal health, emphasizing the critical need for ongoing monitoring and targeted mitigation strategies.

Author Contributions

Conceptualization, S.D.B. and V.B.; methodology, S.D.B., V.B., and S.S.; formal analysis, S.D.B., V.B., and S.S.; investigation A.G. (Antonino Gentile) and I.G.; resources, G.P., F.G., V.C., and G.C.; data curation, S.D.B. and V.B.; writing—original draft preparation, V.B.; writing—review and editing, S.D.B.; supervision, A.G. (Annalisa Guercio) and F.G.; funding acquisition, A.G. (Annalisa Guercio) and F.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable, as this study exclusively involved ticks collected from the environment or from wild boar carcasses. The carcasses were submitted to the Istituto Zooprofilattico Sperimentale della Sicilia as part of surveillance programs or official control measures.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors would like to thank the association Rangers d’Italia for the opportunity to carry out this study in the Monte Pellegrino Nature Reserve. We thank Nicola Galati and Antonio Lastra from the Istituto Zooprofilattico Sperimentale della Sicilia for their invaluable technical support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. De la Fuente, J.; Estrada-Peña, A.; Venzal, J.M.; Kocan, K.M.; Sonenshine, D.E. Overview: Ticks as Vectors of Pathogens that Cause Disease in Humans and Animals. Front. Biosci. 2008, 13, 6938–6946. [Google Scholar] [CrossRef]
  2. Colwell, D.D.; Dantas-Torres, F.; Otranto, D. Vector-Borne Parasitic Zoonoses: Emerging Scenarios and New Perspectives. Vet. Parasitol. 2011, 182, 14–21. [Google Scholar] [CrossRef]
  3. Dantas-Torres, F.; Otranto, D. Vector-Borne Zoonoses. In Zoonoses: Infections Affecting Humans and Animals; Sing, A., Ed.; Springer: Cham, Switzerland, 2022. [Google Scholar] [CrossRef]
  4. Gilbert, L. The Impacts of Climate Change on Ticks and Tick-Borne Disease Risk. Annu. Rev. Entomol. 2021, 66, 373–388. [Google Scholar] [CrossRef] [PubMed]
  5. Torina, A.; Blanda, V.; Antoci, F.; Scimeca, S.; D’Agostino, R.; Scariano, E.; Piazza, A.; Galluzzo, P.; Giudice, E.; Caracappa, S. A Molecular Survey of Anaplasma spp., Rickettsia spp., Ehrlichia canis, and Babesia microti in Foxes and Fleas from Sicily. Transbound. Emerg. Dis. 2013, 60, 125–130. [Google Scholar] [CrossRef]
  6. Mancini, F.; Ciccozzi, M.; Lo Presti, A.; Cella, E.; Giovanetti, M.; Di Luca, M.; Toma, L.; Bianchi, R.; Khoury, C.; Rezza, G.; et al. Characterization of Spotted Fever Group Rickettsiae in Ticks from a City Park of Rome, Italy. Ann. Ist. Super. Sanità 2015, 51, 284–290. [Google Scholar] [CrossRef]
  7. Dantas-Torres, F. Climate Change, Biodiversity, Ticks, and Tick-Borne Diseases: The Butterfly Effect. Int. J. Parasitol. Parasites Wildl. 2015, 4, 452–461. [Google Scholar] [CrossRef] [PubMed]
  8. Torina, A.; Blanda, V.; Blanda, M.; Auteri, M.; La Russa, F.; Scimeca, S.; D’Agostino, R.; Disclafani, R.; Villari, S.; Currò, V.; et al. A Geographical Information System-Based Approach for Integrated Strategies of Tick Surveillance and Control in the Peri-Urban Natural Reserve of Monte Pellegrino (Palermo, Southern Italy). Int. J. Environ. Res. Public Health 2018, 15, 404. [Google Scholar] [CrossRef]
  9. Castillo-Contreras, R.; Magen, L.; Birtles, R.; Varela-Castro, L.; Hall, J.L.; Conejero, C.; Aguilar, X.F.; Colom-Cadena, A.; Lavín, S.; Mentaberre, G.; et al. Ticks on Wild Boar in the Metropolitan Area of Barcelona (Spain) Are Infected with Spotted Fever Group Rickettsiae. Transbound. Emerg. Dis. 2022, 69, e82–e95. [Google Scholar] [CrossRef]
  10. Castillo-Contreras, R.; Carvalho, J.; Serrano, E.; Mentaberre, G.; Fernández-Aguilar, X.; Colom, A.; González-Crespo, C.; Lavín, S.; López-Olvera, J.R. Urban Wild Boars Prefer Fragmented Areas with Food Resources Near Natural Corridors. Sci. Total Environ. 2018, 615, 282–288. [Google Scholar] [CrossRef]
  11. De la Fuente, J.; Kopáček, P.; Lew-Tabor, A.; Maritz-Olivier, C. Strategies for New and Improved Vaccines Against Ticks and Tick-Borne Diseases. Parasite Immunol. 2016, 38, 754–769. [Google Scholar] [CrossRef] [PubMed]
  12. Torina, A.; Moreno-Cid, J.A.; Blanda, V.; Fernández de Mera, I.G.; de la Lastra, J.M.; Scimeca, S.; Blanda, M.; Scariano, M.E.; Briganò, S.; Disclafani, R.; et al. Control of Tick Infestations and Pathogen Prevalence in Cattle and Sheep Farms Vaccinated with the Recombinant Subolesin-Major Surface Protein 1a Chimeric Antigen. Parasites Vectors 2014, 7, 10. [Google Scholar] [CrossRef]
  13. Manilla, G. Fauna d’Italia Acari Ixodida; Edizioni Calderini: Bologna, Italy, 1998; pp. 42–242. [Google Scholar]
  14. Walker, J.B.; Keirans, J.E.; Horak, I.G. The Genus Rhipicephalus (Acari: Ixodidae): A Guide to the Brown Ticks of the World; Cambridge University Press: Cambridge, UK, 2000; pp. 40–583. [Google Scholar]
  15. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
  16. Oteo, J.A.; Portillo, A.; Santibáñez, S.; Blanco, J.R.; Pérez-Martínez, L.; Ibarra, V. Cluster of Cases of Human Rickettsia felis Infection from Southern Europe (Spain) Diagnosed by PCR. J. Clin. Microbiol. 2006, 44, 2669–2671. [Google Scholar] [CrossRef]
  17. Choi, Y.J.; Jang, W.J.; Kim, J.H.; Ryu, J.S.; Lee, S.H.; Park, K.H.; Paik, H.S.; Koh, Y.S.; Choi, M.S.; Kim, I.S. Spotted Fever Group and Typhus Group Rickettsioses in Humans, South Korea. Emerg. Infect. Dis. 2005, 11, 237–244. [Google Scholar] [CrossRef]
  18. Roux, V.; Rydkina, E.; Eremeeva, M.; Raoult, D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int. J. Syst. Bacteriol. 1997, 47, 252–261. [Google Scholar] [CrossRef]
  19. Richter, P.J., Jr.; Kimsey, R.B.; Madigan, J.E.; Barlough, J.E.; Dumler, J.S.; Brooks, D.L. Ixodes pacificus (Acari: Ixodidae) as a vector of Ehrlichia equi (Rickettsiales: Ehrlichieae). J. Med. Entomol. 1996, 33, 1–5. [Google Scholar] [CrossRef] [PubMed]
  20. Schets, F.M.; de Heer, L.; de Roda Husman, A.M. Coxiella burnetii in Sewage Water at Sewage Water Treatment Plants in a Q Fever Epidemic Area. Int. J. Hyg. Environ. Health 2013, 216, 698–702. [Google Scholar] [CrossRef]
  21. To, H.; Kako, N.; Zhang, G.Q.; Otsuka, H.; Ogawa, M.; Ochiai, O.; Nguyen, S.V.; Yamaguchi, T.; Fukushi, H.; Nagaoka, N.; et al. Q Fever Pneumonia in Children in Japan. J. Clin. Microbiol. 1996, 34, 647–651. [Google Scholar] [CrossRef] [PubMed]
  22. Briciu, V.T.; Sebah, D.; Coroiu, G.; Lupşe, M.; Cârstina, D.; Ţăţulescu, D.F.; Mihalca, A.D.; Gherman, C.M.; Leucuţa, D.; Meyer, F.; et al. Immunohistochemistry and Real-Time PCR as Diagnostic Tools for Detection of Borrelia burgdorferi Sensu Lato in Ticks Collected from Humans. Exp. Appl. Acarol. 2016, 69, 49–60. [Google Scholar] [CrossRef] [PubMed]
  23. Stańczak, J.; Cieniuch, S.; Lass, A.; Biernat, B.; Racewicz, M. Detection and Quantification of Anaplasma phagocytophilum and Babesia spp. in Ixodes ricinus Ticks from Urban and Rural Environments, Northern Poland, by Real-Time Polymerase Chain Reaction. Exp. Appl. Acarol. 2015, 66, 63–81. [Google Scholar] [CrossRef] [PubMed]
  24. Carret, C.; Walas, F.; Carcy, B.; Grande, N.; Précigout, E.; Moubri, K.; Schetters, T.P.; Gorenflot, A. Babesia canis canis, Babesia canis vogeli, Babesia canis rossi: Differentiation of the Three Subspecies by a Restriction Fragment Length Polymorphism Analysis on Amplified Small Subunit Ribosomal RNA Genes. J. Eukaryot. Microbiol. 1999, 46, 298–303. [Google Scholar] [CrossRef] [PubMed]
  25. Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  26. Lu, M.; Tian, J.; Wang, W.; Zhao, H.; Jiang, H.; Han, J.; Guo, W.; Li, K. High diversity of Rickettsia spp., Anaplasma spp., and Ehrlichia spp. in ticks from Yunnan Province, Southwest China. Front. Microbiol. 2022, 13, 1008110. [Google Scholar] [CrossRef] [PubMed]
  27. Shehla, S.; Ullah, F.; Alouffi, A.; Almutairi, M.M.; Khan, Z.; Tanaka, T.; Labruna, M.B.; Tsai, K.-H.; Ali, A. Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens 2023, 12, 1080. [Google Scholar] [CrossRef]
  28. Krishnamoothy, N.; Kumar, A.; Veerapathiran, A.; Balaji, T.; Rajeswari, A.; Paramasivan, R. Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India. Microorganisms 2023, 11, 1713. [Google Scholar] [CrossRef]
  29. Remesar, S.; Cano-Terriza, D.; Morrondo, P.; Jiménez-Ruiz, S.; López, C.M.; Jiménez-Martín, D.; Díaz, P.; Paniagua, J.; García-Bocanegra, I. Molecular detection of Rickettsia spp. in wild ungulates and their ticks in Mediterranean areas of southwestern Spain. Zoonoses Public Health 2023, 70, 485–497. [Google Scholar] [CrossRef] [PubMed]
  30. Barradas, P.F.; Mesquita, J.R.; Ferreira, P.; Amorim, I.; Gärtner, F. Detection of tick-borne pathogens in Rhipicephalus sanguineus sensu lato and dogs from different districts of Portugal. Ticks Tick Borne Dis. 2020, 11, 101536. [Google Scholar] [CrossRef]
  31. Blanc, G.; Ogata, H.; Robert, C.; Audic, S.; Claverie, J.M.; Raoult, D. Lateral gene transfer between obligate intracellular bacteria: Evidence from the Rickettsia massiliae genome. Genome Res. 2007, 17, 1657–1664. [Google Scholar] [CrossRef]
  32. Chao, L.L.; Erazo, E.; Robinson, M.; Liang, Y.F.; Shih, C.M. First detection and molecular identification of a pathogenic spotted fever group Rickettsia, R. massiliae, from Rhipicephalus haemaphysaloides ticks infesting dogs in southern Taiwan. Acta Trop. 2022, 236, 106666. [Google Scholar] [CrossRef] [PubMed]
  33. Fernández de Mera, I.G.; Blanda, V.; Torina, A.; Dabaja, M.F.; El Romeh, A.; Cabezas-Cruz, A.; de la Fuente, J. Identification and molecular characterization of spotted fever group rickettsiae in ticks collected from farm ruminants in Lebanon. Ticks Tick Borne Dis. 2018, 9, 104–108. [Google Scholar] [CrossRef]
  34. Wang, Q.; Guo, W.B.; Pan, Y.S.; Jiang, B.G.; Du, C.H.; Que, T.C.; Zhan, L.; Wu, J.H.; Yu, M.H.; Cui, X.M.; et al. Detection of Novel Spotted Fever Group Rickettsiae (Rickettsiales: Rickettsiaceae) in Ticks (Acari: Ixodidae) in Southwestern China. J. Med. Entomol. 2021, 58, 1363–1369. [Google Scholar] [CrossRef]
  35. Valcárcel, F.; Elhachimi, L.; Vilá, M.; Tomassone, L.; Sánchez, M.; Selles, S.M.A.; Kouidri, M.; González, M.G.; Martín-Hernández, R.; Valcárcel, Á.; et al. Emerging Hyalomma lusitanicum: From Identification to Vectorial Role and Integrated Control. Med. Vet. Entomol. 2023, 37, 425–459. [Google Scholar] [CrossRef]
  36. González, J.; González, M.G.; Valcárcel, F.; Sánchez, M.; Martín-Hernández, R.; Tercero, J.M.; Olmeda, A.S. Transstadial Transmission from Nymph to Adult of Coxiella burnetii by Naturally Infected Hyalomma lusitanicum. Pathogens 2020, 9, 884. [Google Scholar] [CrossRef] [PubMed]
  37. Sánchez, M.; Valcárcel, F.; González, J.; González, M.G.; Martín-Hernández, R.; Tercero, J.M.; González-Jara, P.; Olmeda, A.S. Seasonality of Coxiella burnetii Among Wild Rabbits (Oryctolagus cuniculus) and the Hyalomma lusitanicum (Acari: Ixodidae) in a Meso-Mediterranean Ecosystem. Pathogens 2022, 11, 36. [Google Scholar] [CrossRef] [PubMed]
  38. Remesar, S.; Castro-Scholten, S.; Cano-Terriza, D.; Díaz, P.; Morrondo, P.; Jiménez-Martín, D.; Rouco, C.; García-Bocanegra, I. Molecular Identification of Zoonotic Rickettsia Species in Ixodidae Parasitizing Wild Lagomorphs from Mediterranean Ecosystems. Transbound. Emerg. Dis. 2021, 69, e992–e1004. [Google Scholar] [CrossRef]
  39. Eslava, M.; Carlos, S.; Reina, G. Crimean-Congo Hemorrhagic Fever Virus: An Emerging Threat in Europe with a Focus on Epidemiology in Spain. Pathogens 2024, 13, 770. [Google Scholar] [CrossRef] [PubMed]
  40. Blanda, V.; Torina, A.; La Russa, F.; D’Agostino, R.; Randazzo, K.; Scimeca, S.; Giudice, E.; Caracappa, S.; Cascio, A.; de la Fuente, J. A Retrospective Study of the Characterization of Rickettsia Species in Ticks Collected from Humans. Ticks Tick Borne Dis. 2017, 8, 610–614. [Google Scholar] [CrossRef] [PubMed]
  41. Rubel, F.; Brugger, K.; Pfeffer, M.; Chitimia-Dobler, L.; Didyk, Y.M.; Leverenz, S.; Dautel, H.; Kahl, O. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick-Borne Dis. 2016, 7, 224–233. [Google Scholar] [CrossRef] [PubMed]
  42. Accorsi, A.; Schiavetti, I.; Listorti, V.; Dellepiane, M.; Masotti, C.; Ercolini, C.; Guardone, L.; Razzuoli, E. Hard Ticks (Ixodidae) from Wildlife in Liguria, Northwest Italy: Tick Species Diversity and Tick-Host Associations. Insects 2022, 13, 199. [Google Scholar] [CrossRef]
  43. Ferrolho, S.; Antunes, A.S.; Santos, R.; Velez, L.; Padre, A.; Cabezas-Cruz, M.M.; Santos-Silva, A.; Domingos, J. Detection and phylogenetic characterization of Theileria spp. and Anaplasma marginale in Rhipicephalus bursa in Portugal. Ticks Tick-Borne Dis. 2016, 7, 443–448. [Google Scholar] [CrossRef] [PubMed]
  44. Dahmani, M.; Davoust, B.; Rousseau, F.; Raoult, D.; Fenollar, F.; Mediannikov, O. Natural Anaplasmataceae infection in Rhipicephalus bursa ticks collected from sheep in the French Basque Country. Ticks Tick-Borne Dis. 2017, 8, 18–24. [Google Scholar] [CrossRef]
  45. Erster, O.; Roth, A.; Wolkomirsky, R.; Leibovich, B.; Savitzky, I.; Shkap, V. Transmission of Babesia ovis by different Rhipicephalus bursa developmental stages and infected blood injection. Ticks Tick-Borne Dis. 2016, 7, 13–19. [Google Scholar] [CrossRef]
  46. Raele, D.A.; Galante, D.; Pugliese, N.; De Simone, E.; Cafiero, M.A. Coxiella-like endosymbiont associated to the “Anatolian brown tick” Rhipicephalus bursa in southern Italy. Microbes Infect. 2015, 17, 799–805. [Google Scholar] [CrossRef] [PubMed]
  47. Matei, I.A.; Ionică, A.M.; Corduneanu, A.; Domșa, C.; Sándor, A.D. The presence of Ehrlichia canis in Rhipicephalus bursa ticks collected from ungulates in continental Eastern Europe. J. Vet. Res. 2021, 65, 271–275. [Google Scholar] [CrossRef]
  48. Barradas, P.F.; Marques, J.; Tavares, C.; Brito, N.V.; Mesquita, J.R. Detection of Tick-Borne Pathogens in Rhipicephalus bursa Ticks Collected from the Autochthonous Garrano Breed of Horses in Portugal. Vet. Parasitol. Reg. Stud. Rep. 2024, 51, 101033. [Google Scholar] [CrossRef] [PubMed]
  49. Maioli, G.; Pistone, D.; Bonilauri, P.; Pajoro, M.; Barbieri, I.; Patrizia, M.; Vicari, N.; Dottori, M. Etiological Agents of Rickettsiosis and Anaplasmosis in Ticks Collected in Emilia-Romagna Region (Italy) During 2008 and 2009. Exp. Appl. Acarol. 2012, 57, 199–208. [Google Scholar] [CrossRef] [PubMed]
  50. Sgroi, G.; Iatta, R.; Lia, R.P.; D’Alessio, N.; Manoj, R.R.S.; Veneziano, V.; Otranto, D. Spotted fever group Rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound. Emerg. Dis. 2021, 68, 2111–2120. [Google Scholar] [CrossRef]
  51. Garcia-Vozmediano, A.; Giglio, G.; Ramassa, E.; Nobili, F.; Rossi, L.; Tomassone, L. Dermacentor marginatus and Dermacentor reticulatus, and Their Infection by SFG Rickettsiae and Francisella-Like Endosymbionts, in Mountain and Periurban Habitats of Northwestern Italy. Vet. Sci. 2020, 7, 157. [Google Scholar] [CrossRef] [PubMed]
  52. Scarpulla, M.; Barlozzari, G.; Marcario, A.; Salvato, L.; Blanda, V.; De Liberato, C.; D’Agostini, C.; Torina, A.; Macrì, G. Molecular detection and characterization of spotted fever group rickettsiae in ticks from Central Italy. Ticks Tick-Borne Dis. 2016, 7, 1052–1056. [Google Scholar] [CrossRef]
  53. Ebani, V.V.; Bertelloni, F.; Turchi, B.; Filogari, D.; Cerri, D. Molecular survey of tick-borne pathogens in Ixodid ticks collected from hunted wild animals in Tuscany, Italy. Asian Pac. J. Trop. Med. 2015, 8, 714–717. [Google Scholar] [CrossRef] [PubMed]
  54. Nguyen, V.L.; Colella, V.; Greco, G.; Fang, F.; Nurcahyo, W.; Hadi, U.K.; Venturina, V.; Tong, K.B.Y.; Tsai, Y.L.; Taweethavonsawat, P.; et al. Molecular detection of pathogens in ticks and fleas collected from companion dogs and cats in East and Southeast Asia. Parasites Vectors 2020, 13, 420. [Google Scholar] [CrossRef]
  55. Parola, P.; Raoult, D. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [PubMed]
  56. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef]
  57. Beninati, T.; Genchi, C.; Torina, A.; Caracappa, S.; Bandi, C.; Lo, N. Rickettsiae in Ixodid ticks, Sicily. Emerg. Infect. Dis. 2005, 11, 509–511. [Google Scholar] [CrossRef] [PubMed]
  58. Torina, A.; Fernández de Mera, I.G.; Alongi, A.; Mangold, A.J.; Blanda, V.; Scarlata, F.; Di Marco, V.; de la Fuente, J. Rickettsia conorii Indian Tick Typhus strain and R. slovaca in humans, Sicily. Emerg. Infect. Dis. 2012, 18, 1008–1010. [Google Scholar] [CrossRef] [PubMed]
  59. Pereira, A.; Parreira, R.; Cotão, A.J.; Nunes, M.; Vieira, M.L.; Azevedo, F.; Campino, L.; Maia, C. Tick-borne bacteria and protozoa detected in ticks collected from domestic animals and wildlife in Central and Southern Portugal. Ticks Tick-Borne Dis. 2018, 9, 225–234. [Google Scholar] [CrossRef] [PubMed]
  60. Guccione, C.; Colomba, C.; Tolomeo, M.; Trizzino, M.; Iaria, C.; Cascio, A. Rickettsiales in Italy. Pathogens 2021, 10, 181. [Google Scholar] [CrossRef] [PubMed]
  61. Giudice, E.; Di Pietro, S.; Alaimo, A.; Blanda, V.; Lelli, R.; Francaviglia, F.; Caracappa, S.; Torina, A. A molecular survey of Rickettsia felis in fleas from cats and dogs in Sicily (Southern Italy). PLoS ONE 2014, 9, e106820. [Google Scholar] [CrossRef] [PubMed]
  62. Reif, K.E.; Macaluso, K.R. Ecology of Rickettsia felis: A review. J. Med. Entomol. 2009, 46, 723–736. [Google Scholar] [CrossRef] [PubMed]
  63. Selmi, R.; Belkahia, H.; Tayh, G.; Mezzi, A.; Chibani, S.; Ben Said, M.; Messadi, L. First detection of Rickettsia felis and Ehrlichia canis in the common bed bug Cimex lectularius. Comp. Immunol. Microbiol. Infect. Dis. 2024, 110, 102200. [Google Scholar] [CrossRef] [PubMed]
  64. Sulis, G.; Rodari, P.; Caligaris, S.; Tomasoni, L.R.; Castelli, F.; Gulletta, M. A case of Rickettsia felis infection imported from Nepal. J. Travel Med. 2015, 22, 276–278. [Google Scholar] [CrossRef] [PubMed][Green Version]
  65. de Sousa, R.; Barata, C.; Vitorino, L.; Santos-Silva, M.; Carrapato, C.; Torgal, J.; Walker, D.; Bacellar, F. Rickettsia sibirica isolation from a patient and detection in ticks, Portugal. Emerg. Infect. Dis. 2006, 12, 1103–1108. [Google Scholar] [CrossRef] [PubMed]
  66. Halajian, A.; Palomar, A.M.; Portillo, A.; Heyne, H.; Romero, L.; Oteo, J.A. Detection of zoonotic agents and a new Rickettsia strain in ticks from donkeys from South Africa: Implications for travel medicine. Travel Med. Infect. Dis. 2018, 26, 43–50. [Google Scholar] [CrossRef] [PubMed]
  67. Mura, A.; Masala, G.; Tola, S.; Satta, G.; Fois, F.; Piras, P.; Rolain, J.M.; Raoult, D.; Parola, P. First direct detection of rickettsial pathogens and a new Rickettsia species, Candidatus Rickettsia barbariae, in ticks from Sardinia, Italy. Clin. Microbiol. Infect. 2008, 14, 1028–1033. [Google Scholar] [CrossRef] [PubMed]
  68. Zhao, S.S.; Li, H.Y.; Yin, X.P.; Liu, Z.Q.; Chen, C.F.; Wang, Y.Z. First detection of Candidatus Rickettsia barbariae in the flea Vermipsylla alakurt from north-western China. Parasites Vectors 2016, 9, 325. [Google Scholar] [CrossRef]
  69. Ereqat, S.; Nasereddin, A.; Al-Jawabreh, A.; Azmi, K.; Harrus, S.; Mumcuoglu, K.; Apanaskevich, D.; Abdeen, Z. Molecular detection and identification of spotted fever group Rickettsiae in ticks collected from the West Bank, Palestinian Territories. PLoS Negl. Trop. Dis. 2016, 10, e0004348. [Google Scholar] [CrossRef]
  70. Vanegas, A.; Keller, C.; Krüger, A.; Manchang, T.K.; Hagen, R.M.; Frickmann, H.; Veit, A.; Achukwi, M.D.; Krücken, J.; Poppert, S. Molecular detection of spotted fever group Rickettsiae in ticks from Cameroon. Ticks Tick-Borne Dis. 2018, 9, 1049–1056. [Google Scholar] [CrossRef]
  71. Duron, O.; Sidi-Boumedine, K.; Rousset, E.; Moutailler, S.; Jourdain, E. The importance of ticks in Q fever transmission: What has (and has not) been demonstrated? Trends Parasitol. 2015, 31, 536–552. [Google Scholar] [CrossRef]
  72. Sireci, G.; Badami, G.D.; Di Liberto, D.; Blanda, V.; Grippi, F.; Di Paola, L.; Guercio, A.; de la Fuente, J.; Torina, A. Recent advances on the innate immune response to Coxiella burnetii. Front. Cell Infect. Microbiol. 2021, 11, 754455. [Google Scholar] [CrossRef]
  73. Dabaja, M.F.; Greco, G.; Blanda, V.; Tempesta, M.; Bayan, A.; Torina, A.; Vesco, G.; D’Agostino, R.; Lelli, R.; Ezzedine, M.; et al. Multispacer sequence typing of Coxiella burnetii from milk and hard tick samples from ruminant farms in Lebanon. Vet. Ital. 2020, 56, 289–296. [Google Scholar] [CrossRef]
  74. Liu, J.; Guan, G.; Yin, H. Theileria annulata. Trends Parasitol. 2022, 38, 265–266. [Google Scholar] [CrossRef] [PubMed]
  75. Gargano, V.; Blanda, V.; Gambino, D.; La Russa, F.; Di Cataldo, S.; Gentile, A.; Schirò, G.; Torina, A.; Millán, J.; Vicari, D. Serological survey and molecular characterization of Theileria annulata in Sicilian cattle. Pathogens 2021, 10, 101. [Google Scholar] [CrossRef] [PubMed]
  76. Giménez-Pardo, C.; Martínez-Grueiro, M.M. Some hydrolase activities from the tick Hyalomma lusitanicum Koch, 1844 (Ixodoidea: Ixodida). Parasite 2008, 15, 589–593. [Google Scholar] [CrossRef][Green Version]
Figure 1. Sampling site: Site no.1 Sede Landolina (Lon 13.33809; Lat 38.17215; 76 m above sea level a.s.l.); Site no 2. Boschetto Airoldi (Lon 13.35141; Lat 38.14946; 35 m a.s.l.); Site no 3. Gorgo S. Rosalia (Lon 13.35179; Lat 38.17005; 392 m a.s.l.). The main image (Data SIO, NOAA, U.S. Navy, NGA, GEBCO) is from Google Earth.
Figure 1. Sampling site: Site no.1 Sede Landolina (Lon 13.33809; Lat 38.17215; 76 m above sea level a.s.l.); Site no 2. Boschetto Airoldi (Lon 13.35141; Lat 38.14946; 35 m a.s.l.); Site no 3. Gorgo S. Rosalia (Lon 13.35179; Lat 38.17005; 392 m a.s.l.). The main image (Data SIO, NOAA, U.S. Navy, NGA, GEBCO) is from Google Earth.
Animals 15 00072 g001
Figure 2. Individual phylogenetic trees based on the ompB fragments constructed using the ML method.
Figure 2. Individual phylogenetic trees based on the ompB fragments constructed using the ML method.
Animals 15 00072 g002
Figure 3. Individual phylogenetic trees based on the ompA fragments constructed using the ML method.
Figure 3. Individual phylogenetic trees based on the ompA fragments constructed using the ML method.
Animals 15 00072 g003
Figure 4. Alignments, with nucleotides’ positions of the variation points, and the matrices of evolutionary divergence between sequences related to R. massiliae and Candidatus R. shennongii: (A) results for ompB; (B) results for ompA. * Sample analyzed by both targets.
Figure 4. Alignments, with nucleotides’ positions of the variation points, and the matrices of evolutionary divergence between sequences related to R. massiliae and Candidatus R. shennongii: (A) results for ompB; (B) results for ompA. * Sample analyzed by both targets.
Animals 15 00072 g004
Figure 5. Individual phylogenetic tree based on the gltA fragments, constructed using the ML method, with the closest references for the sample MP-I tick26.
Figure 5. Individual phylogenetic tree based on the gltA fragments, constructed using the ML method, with the closest references for the sample MP-I tick26.
Animals 15 00072 g005
Table 1. PCR performed for the amplification of DNA from Rickettsia spp., Anaplasma spp., and Piroplasmids, and the real-time PCRs performed for the amplification of Coxiella burnetii, Borrelia spp., and Piroplasmids.
Table 1. PCR performed for the amplification of DNA from Rickettsia spp., Anaplasma spp., and Piroplasmids, and the real-time PCRs performed for the amplification of Coxiella burnetii, Borrelia spp., and Piroplasmids.
PathogenGene TargetPCR AssayPrimer/Probe SequencesReference
Rickettsia spp.ompANested PCRRr190.70p 5′-ATGGCGAATATTTCTCCAAAA-3′-
Rr190.701n 5′-GTTCCGTTAATGGCAGCATCT--3′
Rr190.602n 5′-AGTGCAGCATTCGCTCCCCCT-3′
[16]
Rickettsia spp.ompBNested PCRrompB OF 5′-GTAACCGGAAGTAATCGTTTCGTAA-3′
rompB OR 5′-GCTTTATAACCAGCTAAACCACC-3′
rompB SFG IF 5′-GTTTAATACGTGCTGCTAACCAA-3′
rompB SFG IR 5′-GGTTTGGCCCATATACCATAAG-3′
[17]
Rickettsia spp.gltAPCR409D 5′-CCTATGGCTATTATGCTTGC-3′
1258N ATTCCAAAAAGTACAGTGAACA-3′
[18]
Anaplasma spp.16S-rRNANested PCREE1 5′-TCCTGGCTCAGAACGAACGCTGGCGGC-3′
EE2 5′-AGTCACTGACCCAACCTTAAATGGCTG-3′
EE3 5′-GTCGAACGGATTATTCTTTATAGCTTGC-3′
EE4 5′-CCCTTCCGTTAAGAAGGATCTAATCTCC-3′
[19]
Coxiella burnetiiIS1111Real-time PCRsIS1pri F 5′- CGGGTTAAGCGTGCTCAGTAT-3′
sIS1pri R 5′- TCCACACGCTTCCATCACCAC- 3′
Tqpro sIS1 (5′-FAM/3′-BHQ1)
5′-AGCCCACCTTAAGACTGGCTACGGTGGAT-3′
[20]
Coxiella burnetiihtpBPCRQ3 5′-GGCAATCACCAATAAGGGCCG-3′
Q5 5′-GCGGGTGATGGTACCACAACA-3′
[21]
Borrelia spp.ospAReal-time PCRBor_OspA_F 5′- AATATTTATTGGGAATAGGTCTAA-3′
Bor_OspA_R 5′-CACCAGGCAAATCTACTGA-3′
Bor_OspA_TM (5′-FAM/3′-BHQ1)
5′-TTAATAGCATGYAAGCAAAATGTTAGCA-3′
[22]
Piroplasmids18S rRNAReal-time PCRBab18S_F 5′- CATGAACGAGGAATGCCTAGTATG- 3′
Bab18S_R 5′- CCGAATAATTCACCGGATCACTC–3′
Bab18S_Pr (5′-FAM/3′-BQ1)
5′- CCGAATAATTCACCGGATCACTC—3′
[23]
Piroplasmids18S rRNAPCRPIROA 5′-AATACCCAATCCTGACACAGGG-3′
PIROB 5′-TTAAATACGAATGCCCCCAAC-3′
[24]
Table 2. Total ticks screened and positives identified.
Table 2. Total ticks screened and positives identified.
Free-Living Tick SpeciesNo. of Male Tick CountNo. of Female Tick CountPositive/Total Number (Positive Percentage)Tick-Borne Pathogens
Hyalomma lusitanicum254418/69 (26.1)Rickettsia massiliae (2)
Rickettsia massiliae—Candidatus Rickettsia shennongii (2)
Candidatus Rickettsia shennongii (1)
Rickettsia slovaca (10)
Rickettsia felis (1)
Coxiella burnetii (1)
Theileria annulata (1)
Rhipicephalus pusillus14132/27 (7.4)Rickettsia massiliae (1)
Candidatus Rickettsia shennongii (1)
Rhipicephalus bursa483/12 (25)Rickettsia barbariae (3)
Rhipicephalus sanguineus s.l.0171/17 (5.9)Rickettsia conorii (1)
Rhipicephalus turanicus543/9 (33.3)Rickettsia massiliae (1)
Rickettsia massiliae—Candidatus Rickettsia shennongii (1)
Candidatus Rickettsia shennongii (1)
Dermacentor marginatus031/3 (33.3)Rickettsia slovaca (1)
Feeding Tick Species Positive/Total Number (Positive Percentage)Tick-Borne Pathogens
Hyalomma lusitanicum51241/75 (1.3)Rickettsia massiliae (1)
Dermacentor marginatus021/2 (50)Rickettsia massiliae (1)
Table 3. Tick species collected in the study and detected pathogens per collection site.
Table 3. Tick species collected in the study and detected pathogens per collection site.
Collection SiteTick Species Positive/Total Number per Site (Positive Percentage; CI 95%)Tick-Borne Pathogens
Site 1—Sede LandolinaHyalomma lusitanicum5/37 (13.5)Rickettsia massiliae (1)
Rickettsia massiliae—Candidatus Rickettsia shennongii (2)
Candidatus Rickettsia shennongii (1)
Coxiella burnetii (1)
Rhipicephalus pusillus0/7
Rhipicephalus bursa0/6
Site 2—Boschetto AiroldiHyalomma lusitanicum1/7 (14.2)Rickettsia massiliae (1)
Rhipicephalus pusillus2/17 (11.7)Rickettsia massiliae (1)
Candidatus Rickettsia shennongii (1)
Rhipicephalus bursa3/6 (50)Rickettsia barbariae (3)
Rhipicephalus sanguineus s.l.1/14 (7.1)Rickettsia conorii (1)
Rhipicephalus turanicus3/9 (33.3)Rickettsia massiliae (1)
Rickettsia massiliae—Candidatus Rickettsia shennongii (1)
Candidatus Rickettsia shennongii (1)
Site 3—Gorgo Santa RosaliaHyalomma lusitanicum12/25 (48)Rickettsia slovaca (10)
Rickettsia felis (1)
Theileria annulata (1)
Rhipicephalus pusillus0/3
Rhipicephalus sanguineus s.l0/3
Dermacentor marginatus1/3 (33.3)Rickettsia slovaca (1)
Wild boar carcassesHyalomma lusitanicum1/75 (1.3)Rickettsia massiliae (1)
Dermacentor marginatus1/2 (50)Rickettsia massiliae (1)
Table 4. Comparison of obtained sequences to the NCBI nucleotide database by BLAST.
Table 4. Comparison of obtained sequences to the NCBI nucleotide database by BLAST.
Sample IdTargetTaxonBlast IdCountry of OriginReferenceBlast Id %
MP-IVompBR. felisOM681612India[28]99%
MP-III tick3 *ompBR. slovacaMK301607Spain[29]100%
MP-III tick4ompBR. slovacaMK301607Spain[29]100%
MP-III tick5ompBR. slovacaMK301607Spain[29]100%
MP-III tick6ompBR. slovacaMK301607Spain[29]100%
MP-III tick8ompBR. slovacaMK301607Spain[29]99%
MP-III tick10ompBR. slovacaMK301607Spain[29]100%
MP-III tick13ompBR. slovacaMK301607Spain[29]99%
MP-I tick17ompBR. massiliaeMN853118/CP000683Portugal[30,31]99%
MP-I tick25ompBR. massiliae—Candidatus R. shennongiiON646173/ON015827Taiwan[26,32]100/99%
MP-I tick26 *ompBR. massiliae—Candidatus R. shennongiiON646173/ON015827Taiwan[26,32]100/99%
MP-I tick27ompBR. massiliae—Candidatus R. shennongiiON646173/ON015827Taiwan[26,32]99/99%
MP-I tick35ompBR. massiliaeMN853118/CP000683Portugal[30,31]99%
MP-I tick36ompBR. massiliaeMN853118/CP000683Portugal[30,31]99%
MP-I tick46ompBR. massiliaeMN853118/CP000683Portugal[30,31]99%
MP-I tick61ompBCandidatus R. barbariaeKY233287Lebanon[33]100%
MP-II tick17-1ompBR. massiliaeMN853118/CP000683Portugal[30]99%
MP-II tick16-2ompBR. massiliaeMN853118/CP000683Portugal[30]99%
MP-III tick2ompAR. slovacaOP729880Spain[29]100%
MP-III tick3 *ompAR. slovacaOP729880Spain[29]99%
MP-III tick7ompAR. slovacaOP729880Spain[29]99%
MP-III tick9ompAR. slovacaOP729880Spain[29]100%
MP-III tick14ompAR. slovacaOP729880Spain[29]99%
MP-I tick26 *ompACandidatus R. shennongiiOL856103China[26]99%
MP-I tick28ompACandidatus R. shennongiiOL856103China[26]99%
MP-I tick29ompACandidatus R. shennongiiOL856103China[26]99%
MP-I tick38ompAR. conoriiKY069258China[34]98%
MP-I tick42ompACandidatus R. shennongiiOL856103China[26]100%
MP-I tick64ompACandidatus R. barbariaeKY233249Lebanon[33]100%
MP-I tick65ompACandidatus R. barbariaeKY233249Lebanon[33]100%
* Sample analyzed by both targets.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Di Bella, S.; Blanda, V.; Scibetta, S.; Giacchino, I.; Gentile, A.; Chiarenza, G.; Cannella, V.; Provinzano, G.; Grippi, F.; Guercio, A. Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission. Animals 2025, 15, 72. https://doi.org/10.3390/ani15010072

AMA Style

Di Bella S, Blanda V, Scibetta S, Giacchino I, Gentile A, Chiarenza G, Cannella V, Provinzano G, Grippi F, Guercio A. Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission. Animals. 2025; 15(1):72. https://doi.org/10.3390/ani15010072

Chicago/Turabian Style

Di Bella, Santina, Valeria Blanda, Silvia Scibetta, Ilenia Giacchino, Antonino Gentile, Giuseppina Chiarenza, Vincenza Cannella, Giovanni Provinzano, Francesca Grippi, and Annalisa Guercio. 2025. "Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission" Animals 15, no. 1: 72. https://doi.org/10.3390/ani15010072

APA Style

Di Bella, S., Blanda, V., Scibetta, S., Giacchino, I., Gentile, A., Chiarenza, G., Cannella, V., Provinzano, G., Grippi, F., & Guercio, A. (2025). Molecular Detection of Rickettsia spp. and Other Tick-Borne Pathogens in Ticks from a Nature Reserve: Implications for Zoonotic Transmission. Animals, 15(1), 72. https://doi.org/10.3390/ani15010072

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop