Circoviridae Survey in Captive Non-Human Primates, Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Nucleic Acids Extraction and Molecular Investigation
2.3. Genome Amplification and Sequence Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rosario, K.; Breitbart, M.; Harrach, B.; Segalés, J.; Delwart, E.; Biagini, P.; Varsani, A. Revisiting the taxonomy of the family Circoviridae: Establishment of the genus Cyclovirus and removal of the genus Gyrovirus. Arch. Virol. 2017, 162, 1447–1463. [Google Scholar] [CrossRef] [PubMed]
- Breitbart, M.; Delwart, E.; Rosario, K.; Segalés, J.; Varsani, A.; Ictv Report Consortium. ICTV Virus Taxonomy Profile: Circoviridae. J. Gen. Virol. 2017, 98, 1997–1998. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Shan, T.; Soji, O.B.; Alam, M.M.; Kunz, T.H.; Zaidi, S.Z.; Delwart, E. Possible cross-species transmission of circoviruses and cycloviruses among farm animals. J. Gen. Virol. 2011, 92, 768–772. [Google Scholar] [CrossRef]
- Lian, H.; Liu, Y.; Li, N.; Wang, Y.; Zhang, S.; Hu, R. Novel circovirus from mink, China. Emerg. Infect. Dis. 2014, 20, 1548–1550. [Google Scholar] [CrossRef] [PubMed]
- Todd, D. Circoviruses: Immunosuppressive threats to avian species: A review. Avian Pathol. 2014, 29, 373–394. [Google Scholar] [CrossRef] [PubMed]
- Johne, R.; Fernandez-de-Luco, D.; Hofle, U.; Muller, H. Genome of a novel circovirus of starlings, amplified by multiply primed rolling-circle amplification. J. Gen. Virol. 2006, 87, 1189–1195. [Google Scholar] [CrossRef] [PubMed]
- Doszpoly, A.; Tarján, Z.L.; Glávits, R.; Müller, T.; Benkő, M. Full genome sequence of a novel circo-like virus detected in an adult European eel Anguilla anguilla showing signs of cauliflower disease. Dis. Aquat. Organ. 2014, 109, 107–115. [Google Scholar] [CrossRef]
- Lőrincz, M.; Dán, A.; Láng, M.; Csaba, G.; Tóth, A.G.; Székely, C.; Cságola, A.; Tuboly, T. Novel circovirus in European catfish (Silurus glanis). Arch. Virol. 2012, 157, 1173–1176. [Google Scholar] [CrossRef]
- Padilla-Rodriguez, M.; Rosario, K.; Breitbart, M. Novel cyclovirus discovered in the Florida woods cockroach Eurycotis floridana (Walker). Arch Virol. 2013, 158, 1389–1392. [Google Scholar] [CrossRef]
- Rosario, K.; Mettel, K.A.; Benner, B.E.; Johnson, R.; Scott, C.; Yusseff-Vanegas, S.Z.; Baker, C.C.M.; Cassill, D.L.; Storer, C.; Varsani, A.; et al. Virus discovery in all three major lineages of terrestrial arthropods highlights the diversity of single-stranded DNA viruses associated with invertebrates. PeerJ 2018, 6, e5761. [Google Scholar] [CrossRef]
- Segalés, J. Porcine circovirus type 2 (PCV2) infections: Clinical signs, pathology and laboratory diagnosis. Virus Res. 2012, 164, 10–19. [Google Scholar] [CrossRef]
- Segalés, J.; Kekarainen, T.; Cortey, M. The natural history of porcine circovirus type 2: From an inoffensive virus to a devastating swine disease? Vet. Microbiol. 2013, 165, 13–20. [Google Scholar] [CrossRef]
- Julian, L.; Piasecki, T.; Chrząstek, K.; Walters, M.; Muhire, B.; Harkins, G.W.; Martin, D.P.; Varsani, A. Extensive recombination detected among beak and feather disease virus isolates from breeding facilities in Poland. J. Gen. Virol. 2013, 94, 1086–1095. [Google Scholar] [CrossRef]
- Massaro, M.; Ortiz-Catedral, L.; Julian, L.; Galbraith, J.A.; Kurenbach, B.; Kearvell, J.; Kemp, J.; van Hal, J.; Elkington, S.; Taylor, G.; et al. Molecular characterisation of beak and feather disease virus (BFDV) in New Zealand and its implications for managing an infectious disease. Arch. Virol. 2012, 157, 1651–1663. [Google Scholar] [CrossRef]
- Baekbo, P.; Kristensen, C.S.; Larsen, L.E. Porcine circovirus diseases: A review of PMWS: Porcine circovirus diseases. Transbound. Emerg. Dis. 2012, 59, 60–67. [Google Scholar] [CrossRef] [PubMed]
- Fogell, D.J.; Martin, R.O.; Groombridge, J.J. Beak and feather disease virus in wild and captive parrots: An analysis of geographic and taxonomic distribution and methodological trends. Arch. Virol. 2016, 161, 2059–2074. [Google Scholar] [CrossRef]
- Pérot, P.; Fourgeaud, J.; Rouzaud, C.; Regnault, B.; Da Rocha, N.; Fontaine, H.; Le Pavec, J.; Dolidon, S.; Garzaro, M.; Chretien, D.; et al. Circovirus hepatitis infection in heart-lung transplant patient, France. Emerg. Infect. Dis. 2023, 29, 286–293. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, P.; Ye, M.; Tian, R.R.; Li, N.; Cao, L.; Ma, Y.; Liu, F.L.; Zheng, Y.T.; Zhang, C. Novel Circovirus in Blood from Intravenous Drug Users, Yunnan, China. Emerg. Infect. Dis. 2023, 29, 1015–1019. [Google Scholar] [CrossRef]
- Li, L.; Kapoor, A.; Slikas, B.; Bamidele, O.S.; Wang, C.; Shaukat, S.; Masroor, M.A.; Wilson, M.L.; Ndjango, J.B.N.; Peeters, M.; et al. Multiple diverse circoviruses infect farm animals and are commonly found in human and chimpanzee feces. J. Virol. 2010, 84, 1674–1682. [Google Scholar] [CrossRef]
- Tan, L.V.; van Doorn, H.R.; Nghia, H.D.T.; Chau, T.T.H.; Tu, L.T.P.; de Vries, M.; Canuti, M.; Deijs, M.; Jebbink, M.F.; Baker, S.; et al. Identification of a new Cyclovirus in cerebrospinal fluid of patients with acute central nervous system infections. mBio 2013, 4, e00231-13. [Google Scholar] [CrossRef] [PubMed]
- Smits, S.L.; Zijlstra, E.E.; van Hellemond, J.J.; Schapendonk, C.M.E.; Bodewes, R.; Schürch, A.C.; Haagmans, B.L.; Osterhaus, A.D.M.E. Novel Cyclovirus in human cerebrospinal fluid, Malawi, 2010–2011. Emerg Infect Dis. 2013, 19, 1511–1513. [Google Scholar] [CrossRef] [PubMed]
- Yozwiak, N.L.; Skewes-Cox, P.; Stenglein, M.D.; Balmaseda, A.; Harris, E.; DeRisi, J.L. Virus identification in unknown tropical febrile illness cases using deep sequencing. PLoS Negl. Trop. Dis. 2012, 6, e1485. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.G.; Luchsinger, V.; Avendano, L.F.; Deng, X.; Delwart, E. Cyclovirus in nasopharyngeal aspirates of Chilean children with respiratory infections. J. Gen. Virol. 2014, 95, 922–927. [Google Scholar] [CrossRef] [PubMed]
- George, U.; Simsek, C.; Faleye, T.O.C.; Arowolo, O.; Oragwa, A.; Adewumi, O.M.; Matthijnssens, J.; Adeniji, J.A. Genome Sequences of Novel Members of Previously Described DNA and RNA Virus Families, Isolated from Feces of a Drill Monkey in Nigeria. Microbiol. Resour. Announc. 2020, 9, e00092-20. [Google Scholar] [CrossRef]
- Dunay, E.; Rukundo, J.; Atencia, R.; Cole, M.F.; Cantwell, A.; Emery Thompson, M.; Rosati, A.G.; Goldberg, T.L. Viruses in saliva from sanctuary chimpanzees (Pan troglodytes) in Republic of Congo and Uganda. PLoS ONE 2023, 18, e0288007. [Google Scholar] [CrossRef]
- Capozza, P.; Lanave, G.; Diakoudi, G.; Pellegrini, F.; Cardone, R.; Vasinioti, V.I.; Decaro, N.; Elia, G.; Catella, C.; Alberti, A.; et al. Diversity of CRESS DNA Viruses in Squamates Recapitulates Hosts Dietary and Environmental Sources of Exposure. Microbiol. Spectr. 2022, 10, e0078022. [Google Scholar] [CrossRef]
- Wu, L.; Liu, X.; Schadt, C.W.; Zhou, J. Microarray-based analysis of Subnanogram quantities of microbial community DNAs by using whole-community genome amplification. Appl. Environ. Microbiol. 2006, 72, 4931–4941. [Google Scholar] [CrossRef]
- Johne, R.; Müller, H.; Rector, A.; van Ranst, M.; Stevens, H. Rolling-circle amplification of viral DNA genomes using phi29 polymerase. Trends Microbiol. 2009, 17, 205–211. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Walker, J.E.; Saraste, M.; Runswick, M.J.; Gay, N.J. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1982, 1, 945–951. [Google Scholar] [CrossRef] [PubMed]
- Rosario, K.; Duffy, S.; Breitbart, M. A field guide to eukaryotic circular single-stranded DNA viruses: Insights gained from metagenomics. Arch. Virol. 2012, 157, 1851–1871. [Google Scholar] [CrossRef] [PubMed]
- Dayaram, A.; Potter, K.A.; Moline, A.B.; Rosenstein, D.D.; Marinov, M.; Thomas, J.E.; Breitbart, M.; Rosario, K.; Argüello-Astorga, G.R.; Varsani, A. High global diversity of cycloviruses amongst dragonflies. J. Gen. Virol. 2013, 94, 1827–1840. [Google Scholar] [CrossRef] [PubMed]
- Rosario, K.; Dayaram, A.; Marinov, M.; Ware, J.; Kraberger, S.; Stainton, D.; Breitbart, M.; Varsani, A. Diverse circular ssDNA viruses discovered in dragonflies (Odonata: Epiprocta). J. Gen. Virol. 2012, 93, 2668–2681. [Google Scholar] [CrossRef]
- Watts, D.P. Meat eating by nonhuman primates: A review and synthesis. J. Hum. Evol. 2020, 149, 102882. [Google Scholar] [CrossRef]
- Cyclovirus in Cerebrospinal Fluid of Patients with Central Nervous System Infection. Available online: https://www.ecdc.europa.eu/sites/default/files/media/en/publications/Publications/rapid-risk-assessment-Cyclovirus-final.pdf (accessed on 28 January 2024).
Assay | Primers | Sequence (5’-3’) | Amplification Size (nt) | Reference |
---|---|---|---|---|
Pan-Rep PCR | CV-F1 | GGIAYICCICAYYTICARGG | 500 | [19] |
CV-R1 | AWCCAICCRTARAARTCRTC | |||
nestedPCR | CV-F2 | GGIAYICCICAYYTICARGGITT | 400 | |
CV-R2 | TGYTGYTCRTAICCRTCCCACCA | |||
Inverse PCR | 162R | CTGGCTCAATCTAACACATCCTAT | >1500 | [26] |
201F | GTGTAACTCGGCAATACGTTTAAT | |||
nestedPCR | 117R | TGAAGTATCATACTACTGGGGGC | ||
305F | TTTCAAAGTATTCGCCCGATTTAG | |||
nestedPCR | 535R | TGAGTTCCTCTGTATACTTTAGA | 351 | This study |
896F | TATAGAAGGCGTTTTATGAGAT |
NHP Species Tested | No. of Animals | Type of Samples Total % (Positive/Total) | Animals Total % (Positive/Total) | |||
---|---|---|---|---|---|---|
Serum | Saliva | Faeces | ||||
Collection A | Japanese macaque | 9 | 0% (0/9) | 0% (0/9) | 11.1% (1/9) | 11.1% (1/9) |
Mandrill | 4 | 0% (0/4) | 25% (1/4) | 100% (4/4) | 100.0% (4/4) | |
Ring-tailed lemur | 3 | 0% (0/3) | 0% (0/3) | 0% (0/3) | 0.0% (0/3) | |
Black lemur | 3 | 0% (0/3) | 0% (0/3) | 0% (0/3) | 0.0% (0/3) | |
White-crowned mangabey | 3 | 0% (0/3) | 0% (0/3) | 0% (0/3) | 0.0% (0/3) | |
Red ruffed lemur | 2 | 0% (0/2) | 0% (0/2) | 0% (0/2) | 0.0% (0/2) | |
Collection B | Common marmoset | 11 | n.a. | n.a. | 0.0% (0/11) | 0.0% (0/11) |
Cynomolgus macaque | 7 | n.a. | n.a. | 0.0% (0/7) | 0.0% (0/7) | |
Japanese macaque | 6 | n.a. | n.a. | 66.7% (4/6) | 66.7% (4/6) | |
Total | 48 | 0% (0/24) | 4.2% (1/24) | 18.7% (9/48) | 18.7% (9/48) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sarchese, V.; Di Profio, F.; Palombieri, A.; Friedrich, K.G.; Robetto, S.; Banyai, K.; Marsilio, F.; Martella, V.; Di Martino, B. Circoviridae Survey in Captive Non-Human Primates, Italy. Animals 2024, 14, 881. https://doi.org/10.3390/ani14060881
Sarchese V, Di Profio F, Palombieri A, Friedrich KG, Robetto S, Banyai K, Marsilio F, Martella V, Di Martino B. Circoviridae Survey in Captive Non-Human Primates, Italy. Animals. 2024; 14(6):881. https://doi.org/10.3390/ani14060881
Chicago/Turabian StyleSarchese, Vittorio, Federica Di Profio, Andrea Palombieri, Klaus Gunther Friedrich, Serena Robetto, Krisztian Banyai, Fulvio Marsilio, Vito Martella, and Barbara Di Martino. 2024. "Circoviridae Survey in Captive Non-Human Primates, Italy" Animals 14, no. 6: 881. https://doi.org/10.3390/ani14060881