Next Article in Journal
Discrepancies between Genetic and Visual Coat Color Assignment in Sarcidano Horse
Next Article in Special Issue
Marine Fish Oil Replacement with Lard or Basa Fish (Pangasius bocourti) Offal Oil in the Diet of Tiger Puffer (Takifugu rubripes): Effects on Growth Performance, Body Composition, and Flesh Quality
Previous Article in Journal
Characterization of Eighty-Eight Single-Nucleotide Polymorphism Markers in the Manila Clam Ruditapes philippinarum Based on High-Resolution Melting (HRM) Analysis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Contribution of elovl5a to Docosahexaenoic Acid (DHA) Synthesis at the Transcriptional Regulation Level in Common Carp, Cyprinus carpio

1
Key Laboratory of Aquatic Genomics, Ministry of Agriculture and Rural Affairs, Beijing Key Laboratory of Fishery Biotechnology, Chinese Academy of Fishery Sciences, Beijing 100141, China
2
Henan Academy of Fishery Sciences, Zhengzhou 450044, China
3
Fisheries Engineering Institute, Chinese Academy of Fishery Sciences, Beijing 100141, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2024, 14(4), 544; https://doi.org/10.3390/ani14040544
Submission received: 22 December 2023 / Revised: 29 January 2024 / Accepted: 1 February 2024 / Published: 6 February 2024
(This article belongs to the Special Issue Novel Insights into Lipid Metabolism in Aquatic Animals)

Abstract

:

Simple Summary

The expression of the elongase of the very-long-chain fatty acid 5 (elovl5) gene was investigated in this study using different molecular validation strategies. It has been found that the elovl5a gene is a causal gene responsible for DHA content differences in common carp. miR-26a-5P is a casual miRNA that negatively regulates DHA synthesis by targeting the elovl5a gene. Considering its down-regulation of the DHA synthesis pathways in common carp, knocking out, knocking down, or silencing the expression of elovl5a may increase DHA content in common carp. Overall, our study preliminarily explored the potential function of elovl5a in common carp. These results provide useful information for future functional research of the elovl5 gene and the interactions between its other gene family members in freshwater fish.

Abstract

Docosahexaenoic acid (DHA) is an essential nutrient for humans and plays a critical role in human development and health. Freshwater fish, such as the common carp (Cyprinus carpio), have a certain degree of DHA biosynthesis ability and could be a supplemental source of human DHA needs. The elongase of very-long-chain fatty acid 5 (Elovl5) is an important enzyme affecting polyunsaturated fatty acid (PUFA) biosynthesis. However, the function and regulatory mechanism of the elovl5 gene related to DHA synthesis in freshwater fish is not clear yet. Previous studies have found that there are two copies of the elovl5 gene, elovl5a and elovl5b, which have different functions. Our research group found significant DHA content differences among individuals in Yellow River carp (Cyprinus carpio var.), and four candidate genes were found to be related to DHA synthesis through screening. In this study, the expression level of elovl5a is decreased in the high-DHA group compared to the low-DHA group, which indicated the down-regulation of elovl5a in the DHA synthesis pathways of Yellow River carp. In addition, using a dual-luciferase reporter gene assay, we found that by targeting the 3’UTR region of elovl5a, miR-26a-5p could regulate DHA synthesis in common carp. After CRISPR/Cas9 disruption of elovl5a, the DHA content in the disrupted group was significantly higher than in the wildtype group; meanwhile, the expression level of elovl5a in the disrupted group was significantly reduced compared with the wildtype group. These results suggest that elovl5a may be down-regulating DHA synthesis in Yellow River carp. This study could provide useful information for future research on the genes and pathways that affect DHA synthesis.

1. Introduction

Polyunsaturated fatty acids (PUFAs), which include two categories, omega-3 and omega-6, are essential nutrients for humans. Omega-3 fatty acids play a vital role in human development as phospholipid components that make up the cell membrane structure [1]. As the most important unsaturated fatty acid and a member of omega-3, docosahexaenoic acid (DHA, C22:6n-3) is crucial for promoting brain, retinal, and neural development, especially in babies [2,3]. The development of DHA-related products has great economic prospects.
Deep-sea fish oil is the main source of omega-3 for humans. However, with the annual decline in global marine fishing catch, relying solely on deep-sea fish oil is insufficient to meet the expanding demand for fish oil nowadays. Unlike marine fish, which mainly accumulate PUFA through the food chain, freshwater fish have a certain degree of PUFA biosynthesis ability [4]. Research has found that freshwater fish, such as zebrafish (Danio rerio), grass carp (Ctenopharyngodon idella), and common carp (Cyprinus carpio), have the ability to convert linoleic acid (LA, C18:2n-6) and α-linolenic acid (ALA, C18:3n-3) into DHA [5]. Common carp is one of the most important freshwater aquaculture fish in China. It has a long breeding history, diverse strains, and a wide distribution [6]. Studying the regulatory mechanism of DHA synthesis in common carp is of great significance for developing freshwater fish as a source of DHA.
The biosynthesis of PUFAs in fish is a process in which LA and ALA are used as substrates to synthesize PUFA through continuous desaturation and elongation reactions. This synthesis pathway is mainly catalyzed by fatty acid desaturase (Fads) that catalyzes the desaturation reaction and elongase of very-long-chain fatty acids (Elovl) that catalyze the carbon chain extension reaction [7,8]. The elovl gene family, which encodes the synthesis of C18 or longer chain fatty acids [9], is a rate-limiting enzyme in these reaction steps [10], playing a crucial role in fatty acid synthesis [11]. The gene expression level and enzyme activity directly affect the synthesis efficiency of DHA [12].
Analysis of elovl5 gene sequences in various fish species, including zebrafish [13] and tilapia (Oreochromis mossambicus) [14], has found that their amino acid sequences are highly conserved and similar to mammalian characteristic domains. Cloning and expression studies of the elovl5 gene in freshwater fish, such as zebrafish [14] and rainbow trout (Oncorhynchus mykiss) [15], have shown that the elovl5 gene has different activities in different fish species. Studies of marine fish, such as large yellow croaker (Larimichthys crocea) [16], golden pompano (Trachinotus ovatus) [17], and Atlantic cod (Gadus morhua) [18], have shown that elovl5 genes in marine fish could extend the substrate of C18 and C20 fatty acids, but lack the ability to convert C22 fatty acids. Overexpression of miR-146a in the liver cell line of rabbitfish (Siganus canaliculatus) could inhibit the expression of the elovl5 gene and thus reduce PUFA content [19]. So far, the function and regulatory mechanism of the elovl5 gene involved in DHA synthesis in common carp is not clear yet. The molecular regulatory mechanism and specific function of elovl5 relating to DHA synthesis in common carp need to be further studied.
A previous study has found that there are two highly similar copies of the elovl5 gene in common carp: elovl5a and elovl5b [20]. However, there are differences in regulatory mechanisms and functions between these two highly homologous gene copies. They have shown different expression patterns at different development stages, in different tissues, or under different feeding conditions [20]. Our previous research found that there were significant differences in DHA content between individuals from the same population under the same breeding conditions in Yellow River carp (Cyprinus carpio var.) [21]. Through genome-wide association analysis (GWAS) and transcriptome differential expression analysis based on DHA content differences in Yellow River carp, combined with analysis of the literature, four genes, including elovl5a, acyl-CoA synthetase bubblegum family member 2 (acsbg2), fatty acid desaturase 6 (fads6), and lipoprotein lipase (lpl), were selected as candidate genes potentially related to DHA content [21]. In the present study, we first used real-time fluorescent quantitative PCR (qRT-PCR) to validate the candidate genes screened in the previous study that may be involved inDHA synthesis. After verification, the potential function of elovl5a was further explored by dual-luciferase reporter gene assay, CRISPR/Cas9 disruption, and gene expression analysis. The results of this study could improve our understanding of the genetic mechanism of elovl5a related to DHA synthesis in common carp and also provide a reference for further research on the interactions between elovl gene family members, such as elovl2 and elovl5.

2. Methods

2.1. Ethics Statement

In this study, all experimental fish were reared and handled following the guidelines for the Care and Use of Experimental Animals of China. Our study was approved by the Animal Care and Use Committee of the Centre for Applied Aquatic Genomics at the Chinese Academy of Fishery Sciences.

2.2. Fish Sample and Fatty Acid Content Determination

The Yellow River carp samples (n = 96) were collected from the Breeding Station of Henan Academy of Fishery Sciences, Zhengzhou, China. The cultured fish were approximately two years old and had been reared under the same conditions and fed with the same commercial diet (Liaoyang Yida Feed Co., Ltd., Liaoyang, China) before experiment. All the fishes were euthanized in MS222 solution before sampling. According to the experimental design, the muscle and liver tissues of each individual were collected and placed in RNALater (Qiagen, Hilden, Germany), which was kept at 4 °C for 3~6 h to immerse the reagent into the tissue samples, and then immediately frozen in dry ice. Then, 20 g of muscle tissue from each Yellow River carp was collected and stored at −80 °C, until sent to Qingdao Kechuang Testing Co., Ltd. (Qingdao, China) for determination of 35 types of fatty acids content. According to GB/T 22223-2008 standard [22], the samples were processed by gas chromatography with analytical instrument (Agilent, Santa Clara, CA, USA).

2.3. RNA Isolation and qRT-PCR

The expression level of DHA content-related genes in Yellow River carp were detected by qRT-PCR. RNA from liver tissue of six fish, each with the highest and the lowest DHA content, were extracted, respectively. cDNAs were synthesized using reverse transcription kit (Qiagen, Shanghai, China). The verified β-actin [20] was selected as the internal reference gene. Primer Premier 5 software was used to design qRT-PCR primers based on gene sequences from the common carp genome database (Cyprinus carpio Assembly: GCF_000951615.2). The primer sequences are shown in Table 1. Total RNA was reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, DE, USA). The total quantitative experiment system was 15 μL, including 1 μL of cDNA, 0.3 μL per each upper and lower primer, 7.5 μL of SYBR Green Master Mix (TOYOBO, Osaka, Japan), and 5.9 μL of ddH2O. The reaction procedure was set at 95 °C for 2 min, followed by 40 cycles at 95 °C for 15 s, 59 °C for 30 s, and 72 °C for 1 min, with the melting curve as the default condition. Each treatment included six biological replicates with three technical duplicates. The relative expression level of each gene was measured by ABI7500 Real-time PCR instrument (Applied Biosystems, Waltham, MA, USA).

2.4. Plasmid Construction

To avoid systematic error caused by the negative regulation of mRNA expression in the 3’-untranslated region (3’UTR) of the elovl5a gene, in this experiment, using wildtype (WT) as the control group when co-transfecting WT with mimics or inhibitors could better illustrate the regulatory effect of overexpression on the elovl5a gene. The Targetscan (http://www.targetscan.org/vert_71/, accessed on 8 April 2022) and AnimalTFDB 3.0 (http://bioinfo.life.hust.edu.cn/AnimalTFDB#!/, accessed on 9 April 2022) were used to predict the putative binding sites of elovl5a on the 3’UTR. After obtaining the putative binding sites, the vector was constructed based on the sequences of the elovl5a gene 3’UTR region, including putative binding sites. The target region was inserted into the NheI/XhoI site of pmirGLO vector (Genecreate, Nanjing, China) to construct the reporter plasmids (pmirGLO-ELOVL5). The plasmids for transfection were conducted using the TOP10 competent cell (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions.

2.5. Cell Culture, Transfection, and Dual-Luciferase Report Assay

The vectors were transfected into 293T cells with mimics and mimics NC, respectively. The HEK293T cells were inoculated in the 24-well culture plate the day before transfection and cultured in DMEM high-glucose medium containing 10% FBS in incubator with 5% CO2 at 37 °C. miRNA was dissolved in DEPC water to a concentration of 20 μM. Then, a final concentration of 50 of nM miRNA and 2 μg of plasmid were added into 50 μL of serum-free DMEM medium. The mixture was incubated at room temperature for 5 min. After that, 2 μL of lipo2000 transfection reagent was added into 50 μL of serum-free DMEM medium. The mixture was incubated at room temperature for 15 min. Then, the serum-free DMEM medium was supplemented to 0.5 mL and cultured at 37 °C for 4–6 h. We discarded medium and added 0.5 mL of complete medium. pmirGLirGLO-ELOVL5 or pmirGLO-ELOVL5-mut was co-transfected with mimics or mimics NC into SMMC-7721 cells by Lipofectamine-mediated gene transfer. pmirGLO, pmirGLO-ELOVL5, or pmirGLO-ELOVL5-mut was transfected into different SMMC-7721 cell clones and HCCLM6 cell clones via lipofectamine-mediated gene transfer. After 48 h of transfection, the relative luciferase was determined using a dual-luciferase reporter assay system (Genecreate, Nanjing, China) according to the manufacturer’s instructions and normalized to Renilla luciferase activity.

2.6. CRISPR/Cas9 Disruption

In order to verify the function of elovl5a related to DHA synthesis in Yellow River carp, CRISPR/Cas9 disruption was performed. The ZiFiT website (http://zifit.partners.org/ZiFiT/CSquare9Nuclease.aspx, accessed on 20 April 2022) was used for the sgRNA target design. Sequences of the sgRNA target used for elovl5a in this study were 5′-TGCCAGAACACCCACAGTGG-3′. The sgRNA and Cas9 nuclease were synthesized or supplied by Genscript, Nanjing, China. The embryos were randomly divided into inject group and non-inject control group. The injection was prepared using the EasyEdit sgRNA kit from Genscript, Nanjing, China. Immediately after artificial insemination, the fertilized eggs in the single-cell development stage were microinjected using 1 μL injection for inject group. The parameters of the microinjection instrument were adjusted to pi/hpa 467, ti/s 0.1, pc/hpa 18.

2.7. Verification after Gene Disruption

The juvenile fish were reared and sampled until seven months old. The fish fillet was collected and stored at −80 °C for DHA content determination and DNA sequencing. The liver tissue was collected and stored in RNA later at −80 °C for qRT-PCR. Marine animal tissue DNA extraction kit (Tiangen, Beijing, China) was used to extract DNA. Primer Premier 5 software was used to design PCR primers for the target region of elovl5a gene. The primers are shown in Table 1. Then, the sgRNA target region of elovl5a gene was amplified and sequenced. The n-3 PUFA contents of the mutant and wildtype Yellow River carp were detected by Qingdao Kechuang Testing Co., Ltd., Qingdao, China, using gas chromatography–mass spectrometry (GC-MS). The n-3 PUFA typically includes DHA, eicosapentaenoic acid (EPA, C20:5n-3), arachidonic acid (ARA, C20:4n-6), and ALA.

2.8. Gene Expression Analysis

RNA was extracted from liver tissue of the mutant and wildtype Yellow River carp. Purity and integrity of total RNA were detected using 1% agarose gel electrophoresis, and cDNA was synthesized using the reverse transcription kit (TOYOBO, Osaka, Japan). Primers for elovl5a gene in Table 1 were used for qRT-PCR, and the internal reference gene was β-actin [23]. The reaction system, procedure, and statistical analysis are the same as Method 2.2.

2.9. Data Analysis

Differences in the relative expression level of each gene between two groups were calculated using the 2−ΔΔCT method with p-value < 0.05 (Wilcoxon test) as the threshold. The n-3 PUFA content differences between the mutant group and wildtype group were calculated using p-value < 0.05 (t-test) as the significant threshold.

3. Results

3.1. Fatty Acid Content of Yellow River Carp in Muscle Tissue

A total of 96 two-year-old Yellow River carp were sampled and detected for 35 types of fatty acids. Of all types of fatty acids, we are particularly interested in the contents of n-3 PUFA, especially DHA, in this study. The contents of ALA, ARA, EPA, and DHA in the muscle of Yellow River carp ranged from 308.63 to 1971.64 mg/kg, 147.72 to 1063.22 mg/kg, 115.25 to 570.29 mg/kg, and 746.57 to 2257.59 mg/kg, respectively. There were significant differences in the content of four different n-3 PUFA types. DHA has the highest content (1485.54 ± 305.63 mg/kg, mean ± SD, n = 96) compared to ALA (906.14 ± 413.28 mg/kg, mean ± SD, n = 96) and ARA (481.75 ± 230.85 mg/kg, mean ± SD, n = 96), while EPA has the lowest content (258.30 ± 89.83 mg/kg, mean ± SD, n = 96). To verify the candidate genes related to the DHA content, six Yellow River carp, each with the highest and lowest DHA content, were selected to conduct the following experiments.

3.2. The Expression of Candidate Genes in Yellow River Carp

As shown in Figure 1, there was no significant differential expression observed in the genes acsbg2, fads6, and lpl between the two groups in the Yellow River carp. Only the expression level of elovl5a in the higher DHA content group was significantly lower than those in the lower DHA content group (p < 0.05, Wilcoxon test), with the fold-change of −1.99. Even though the difference in expression level between the two groups in the lpl gene seemed large, the statistical result was non-significant. This could be caused by the small sample size and the large sample variance within the group.

3.3. elovl5a Is the Target Gene of miR-26a-5p

With regard to putative binding sites predicting miR-26a-5p, the sequence of which was paired with the 3’UTR region of the elovl5a gene, they were found to be related to fatty acid synthesis. To elucidate the underlying mechanism of miR-26a-5p in the DHA content regulation in Yellow River carp, the interaction between miR-26a-5p and the 3’UTR of elovl5a was investigated. The seed region of miR-26a-5p exhibited a specific complementary binding site to the 3’UTR region of elovl5a, including seven nucleotides (miR-26a-5p: 3′-UUGGAUAGGACCUAAUGAACUU-5′, elovl5a‒3’UTR: 5′-AAUAUCUUCAUCUUUACUUGAU-3′). Wildtype and mutant dual luciferase reporter vectors of the elovl5a gene were constructed: pmir-GLO-ELOVL5 WT 5′-AATATCTTCATCTTTACTTGAT-3′, pmir-GLO-ELOVL5 MUT 5′-AATATCTTCATCTTATGAACTT-3′. The vectors were transfected into 293T cells with miR-26a-5p mimics and mimics NC, respectively. After determination by dual-luciferase reporter assay and normalization, Figure 2 showed that the co-transfection of Elovl5-WT with miR-26a-5p mimics resulted in an extremely significant reduction in the relative luciferase activity (p < 0.01, Wilcoxon test), while co-transfection with Elovl5-MUT did not induce a significant change in luciferase activity. These results suggested that elovl5a was a target gene of miR-26a-5p, and miR-26a-5p negatively regulated the expression of the elovl5a gene.

3.4. CRISPR/Cas9 Disruption of elovl5a in Yellow River Carp

To further verify the DHA content-related function of elovl5a in Yellow River carp, CRISPR/Cas9 disruption was conducted by microinjection into the fertilized eggs. The n-3 PUFA content of mutant and wildtype Yellow River carp is shown in Table 2. There were no statistical differences between the non-injected group and the injected group in the content of ALA (C18:3n3), ARA (C20:4n6), and EPA (C20:5n3). However, the DHA (C22:6n3) content was significantly higher in the injected group compared with the non-injected group (p < 0.05, t-test, Figure 3A). In addition, there were no statistically significant differences in body weight and length between the non-injected group and the injected group from the same cage (p > 0.05).
After sequencing verification of the sgRNA target region of the elovl5a gene, no gene modifications or mutations were observed in the non-injected group, whereas in the injected group, nested peaks within the target region were observed in the mutant individuals, indicating a relatively high frequency of mutations. Two representative sequencing results of PCR products, which corresponded to the wildtype and elovl5a gene disrupted individuals, were shown in Figure 3B. The sequencing results of the wildtype (wt) individuals were completely consistent with the theoretical elovl5a sgRNA sequences (TGCCAGAACACCCACAGTGG). However, hybrid peaks started from the sgRNA target site in the mutant (mu) individuals. Using DNAMAN 9.0 software to compare wt and mu amplified sequences, it was found that mutated individuals undergo frameshift mutations starting from the sgRNA target, indicating a possible change in the protein function. Six individuals each from the wt and mu groups were selected to conduct qRT-PCR experiments. The relative expression level of the elovl5a gene is shown in Figure 3C. Compared with the wt group, the expression level of the elovl5a gene in the mu group was significantly reduced (p < 0.01).

4. Discussion

PUFAs play an important role in the growth, development, and reproduction of fish and are also of great significance to human health [24,25]. In particular, the content of DHA is an important indicator representing the quality of fish. Freshwater fish have a certain degree of PUFA biosynthesis ability, which is worth our in-depth research. Previous studies have reported that the fads and elovl gene families are the two main gene families affecting DHA synthesis in teleosts [26,27]. Screening and identifying genes that affect DHA synthesis at the genomic level can significantly shorten the breeding time compared with traditional breeding methods. Therefore, searching for the main genes that affect DHA content would benefit the improvement in fish quality by conducting molecular breeding.
In the present study, qRT-PCR was conducted to identify the DHA content-related genes (including acsbg2, elovl5a, fads6, and lpl) in Yellow River carp. A significantly differentially expressed gene, elovl5a, was identified, indicating that the elovl5a gene may down-regulate the DHA synthesis in Yellow River carp. To verify the potential down-regulation of elovl5a in the DHA synthesis processes in Yellow River carp, a dual-luciferase reporter gene assay was performed, and we found that miR-26a-5p may negatively regulate the DHA synthesis by targeting the 3’UTR region of elovl5a. Furthermore, the contribution of elovl5a to the DHA content in Yellow River carp was verified by the CRISPR/Cas9 gene editing system. The DHA content in the disrupted group was significantly increased, while the expression level of elovl5a was significantly reduced in the disrupted group compared with the wildtype group, suggesting that the elovl5a gene down-regulates DHA synthesis in Yellow River carp.
Results from qRT-PCR, dual-luciferase reporter gene assay, and gene editing experiments all indicated that elovl5a negatively regulates DHA synthesis in Yellow River carp. These results are consistent with recent studies on the function of the elovl5 gene in zebrafish. Compared with wildtype (elovl5+) zebrafish, the C22 PUFA content of elovl5 knockout (elovl5) zebrafish was significantly increased, which may be related to the up-regulation of elovl4b and elovl2 expression [28]. Meanwhile, the expression level of elovl5 in the liver of elovl2 knockout (elovl2) zebrafish is quite low, suggesting that elovl5 may play a role as an “assistant attacker” of elovl2 in the LC-PUFA synthesis of zebrafish [28]. Another zebrafish elovl2/elovl5 comparative gene knockout experiment showed that Elovl2, but not Elovl5, is essential for DHA biosynthesis in zebrafish [29]. The liver DHA content of the elovl2 mutant was significantly reduced, while the elovl5 mutant was not significantly changed, indicating that the endogenous synthesis of DHA in zebrafish is mediated by Elovl2.
It is necessary to further discuss another member of the elovl gene family, elovl2, whose function is similar to elovl5. The elovl2 gene has been lost in many marine fish and has only been cloned in a few fish species, such as zebrafish, Atlantic salmon (Salmo salar), and rainbow trout [11,30]. In zebrafish, heterologous expression of the elovl2 gene can increase the content of Docosapentaenoic acid (C22:5n-3), the precursor of DHA [31]. In cyprinid fish, the correlation between the expression level of elovl2 and elovl5 is significantly higher than that of other members of the elovl family. Previous studies have shown that there was a complex interaction between Elovl2 and Elovl5 enzymes. In teleost, elovl2 and elovl5, as collateral homologous genes, have similar substrate activity. The Elovl2 and Elovl5 in zebrafish and grass carp both possess the activity of extending C18 and C20 substrates to synthesize PUFA [14]. There is a potential synergistic or competitive relationship between the two enzymes in catalyzing the biosynthesis pathway of PUFAs [32,33]. Therefore, researchers conducted gene editing experiments on the elovl2 and elovl5 genes and found that after the disruption of the elovl2 gene in zebrafish and Atlantic salmon, DHA synthesis in liver and muscle was inhibited and the content was significantly reduced, while EPA accumulated significantly [28,29,34]. However, there was no significant change in the DHA content of the elovl5-disrupted zebrafish, indicating that elovl2, rather than elovl5, plays a key role in the DHA synthesis of zebrafish. Our research confirmed that elovl5a is not the key gene to promote DHA synthesis in Yellow River carp, but may inhibit DHA synthesis. This may be related to the competition between elovl2 and elovl5 for substrates, or it may be due to the lack of catalytic activity of elovl5a for DHA precursor substances in Yellow River carp. Studies on zebrafish and large yellow croaker showed that the conversion efficiency of Elovl5 to different fatty acid substrates decreased with the increase in substrate carbon chain length (conversion rate C18 > C20 > C22) [14,35]. Yeast heterologous expression experiments indicated that elovl5 preferred to catalyze the elongation reaction of C18 PUFA, while elovl2 has a higher efficiency in catalyzing the synthesis of DPA from C20 and C22 PUFA substrates [32,36,37]. In addition, as carp are allotetraploid fish, there are two copies of the elovl5 gene [20,38,39]. Therefore, further studies on the functions of elovl5b and elovl2 genes, as well as the interactions among elovl gene family members, will help us to better understand the functions of the elovl gene family in the synthesis of DHA and PUFA in carp.
Overall, our study revealed that the elovl5a gene is a causal gene responsible for the DHA content differences in Yellow River carp. miR-26a-5P may be a casual miRNA that negatively regulates DHA synthesis by targeting the elovl5a gene. Considering its down-regulation of the DHA synthesis in Yellow River carp, knocking out, knocking down, or silencing the expression of elovl5a could increase the DHA content in Yellow River carp.

5. Conclusions

Previously, we identified elovl5a, acsbg2, fads6, and lpl as the candidate genes which related to the DHA content of common carp. In this study, the expression level of elovl5a was significantly higher in the high-DHA content carp compared with the low-DHA content group. Furthermore, we found that a key miRNA, miR-26a-5p, may act as an important factor in the regulation of DHA synthesis in Yellow River carp by targeting the 3’UTR region of elovl5a. Moreover, the DHA content in the elovl5a-disrupted group is significantly increased compared to the wildtype group. Meanwhile, the expression level of elovl5a was significantly down-regulated in the elovl5a-disrupted fish compared with the wildtype group. To sum up, our study preliminarily explored the potential function of elovl5a and found a new miRNA closely related to the regulation of DHA content in Yellow River carp. These results provide useful information for the future functional research of the elovl5 gene and the interactions between its other gene family members.

Author Contributions

Data curation, Z.Z.; Formal analysis, H.Z. and P.L.; Funding acquisition, H.Z.; Investigation, Y.J.; Methodology, P.L., Y.Z. and J.X.; Project administration, J.X.; Resources, Y.Z., J.F. and J.X.; Software, Y.Z.; Supervision, H.Z. and J.X.; Validation, P.L.; Visualization, H.Z.; Writing—original draft, H.Z.; Writing—review and editing, H.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Central Public-interest Scientific Institution Basal Research Fund, CAFS (No. 2020B003, No. 2023JC0102, and No. 2023TD25).

Institutional Review Board Statement

The animal study protocol was approved by the Animal Care and Use Committee of the Chinese Academy of Fishery Sciences (protocol code: ACUC-CAFS-20191202; date of approval: 27 December 2018).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Trumbo, P.; Schlicker, S.; Yates, A.A.; Poos, M. Dietary reference intakes for energy, carbohydrate, fiber, fat, fatty acids, cholesterol, protein and amino acids. J. Am. Diet. Assoc. 2002, 102, 1621–1630. [Google Scholar] [CrossRef]
  2. Newberry, S.J.; Chung, M.; Booth, M.; Maglione, M.A.; Tang, A.M.; O’Hanlon, C.E.; Wang, D.D.; Okunogbe, A.; Huang, C.; Motala, A.; et al. Omega-3 Fatty Acids and Maternal and Child Health: An Updated Systematic Review. Evid. Rep. Technol. Assess. (Full Rep.) 2016, 224, 1–826. [Google Scholar]
  3. SanGiovanni, J.P.; Chew, E.Y. The role of omega-3 long-chain polyunsaturated fatty acids in health and disease of the retina. Prog. Retin. Eye Res. 2005, 24, 87–138. [Google Scholar] [CrossRef] [PubMed]
  4. Tocher, D.R. Fatty acid requirements in ontogeny of marine and freshwater fish. Aquac. Res. 2010, 41, 717–732. [Google Scholar] [CrossRef]
  5. Du, Z.Y.; Clouet, P.; Zheng, W.H.; Degrace, P.; Tian, L.X.; Liu, Y.J. Biochemical hepatic alterations and body lipid composition in the herbivorous grass carp (Ctenopharyngodon idella) fed high-fat diets. Br. J. Nutr. 2006, 95, 905–915. [Google Scholar] [CrossRef] [PubMed]
  6. Xu, P.; Zhang, X.; Wang, X.; Li, J.; Liu, G.; Kuang, Y.; Xu, J.; Zheng, X.; Ren, L.; Wang, G.; et al. Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat. Genet. 2014, 46, 1212–1219. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, Y.; Xu, Z.M.; Wang, Q.; Li, Q.S.; Sun, X.Q.; Li, J.T. The Promoter SNPs Were Associated with Both the Contents of Poly-Unsaturated Fatty Acids (PUFAs) and the Expressions of PUFA-Related Genes in Common Carp. Biology 2023, 12, 524. [Google Scholar] [CrossRef] [PubMed]
  8. Zhao, R.; Yang, C.R.; Wang, Y.X.; Xu, Z.M.; Li, S.Q.; Li, J.C.; Sun, X.Q.; Wang, H.W.; Wang, Q.; Zhang, Y.; et al. Fads2b Plays a Dominant Role in ∆6/∆5 Desaturation Activities Compared with Fads2a in Common Carp (Cyprinus carpio). Int. J. Mol. Sci. 2023, 24, 10638. [Google Scholar] [CrossRef]
  9. Leonard, A.E.; Kelder, B.; Bobik, E.G.; Chuang, L.T.; Lewis, C.J.; Kopchick, J.J.; Mukerji, P.; Huang, Y.S. Identification and expression of mammalian long-chain PUFA elongation enzymes. Lipids 2002, 37, 733–740. [Google Scholar] [CrossRef]
  10. Monroig, O.; Wang, S.; Zhang, L.; You, C.; Tocher, D.R.; Li, Y. Elongation of long-chain fatty acids in rabbitfish Siganus canaliculatus: Cloning, functional characterisation and tissue distribution of Elovl5- and Elovl4-like elongases. Aquaculture 2012, 350, 63–70. [Google Scholar] [CrossRef]
  11. Castro, L.F.; Tocher, D.R.; Monroig, O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef]
  12. Cook, H.W.; McMaster, C.R. Chapter 7 Fatty acid desaturation and chain elongation in eukaryotes. New Compr. Biochem. 2002, 36, 181–204. [Google Scholar]
  13. Agaba, M.; Tocher, D.R.; Dickson, C.A.; Dick, J.R.; Teale, A.J. Zebrafish cDNA encoding multifunctional Fatty Acid elongase involved in production of eicosapentaenoic (20:5n-3) and docosahexaenoic (22:6n-3) acids. Mar. Biotechnol. 2004, 6, 251–261. [Google Scholar] [CrossRef]
  14. Agaba, M.K.; Tocher, D.R.; Zheng, X.; Dickson, C.A.; Dick, J.R.; Teale, A.J. Cloning and functional characterisation of polyunsaturated fatty acid elongases of marine and freshwater teleost fish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2005, 142, 342–352. [Google Scholar] [CrossRef]
  15. Gregory, M.K.; James, M.J. Rainbow trout (Oncorhynchus mykiss) ELovl5 and Elovl2 differ in selectivity for elongation of omega-3 docosapentaenoic acid. Biochim. Biophys. Acta 2014, 1841, 1656–1660. [Google Scholar] [CrossRef]
  16. Xiao, S.; Wang, P.; Dong, L.; Zhang, Y.; Han, Z.; Wang, Q.; Wang, Z. Whole-genome single-nucleotide polymorphism (SNP) marker discovery and association analysis with the eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) content in Larimichthys crocea. PeerJ 2016, 4, e2664. [Google Scholar] [CrossRef]
  17. Lei, C.X.; Li, M.M.; Tian, J.J.; Wen, J.K.; Li, Y.Y. Transcriptome analysis of golden pompano (Trachinotus ovatus) liver indicates a potential regulatory target involved in HUFA uptake and deposition. Comp. Biochem. Physiol. Part D Genom. Proteom. 2020, 33, 100633. [Google Scholar] [CrossRef]
  18. Xue, X.; Feng, C.Y.; Hixson, S.M.; Johnstone, K.; Anderson, D.M.; Parrish, C.C.; Rise, M.L. Characterization of the fatty acyl elongase (elovl) gene family, and hepatic elovl and delta-6 fatty acyl desaturase transcript expression and fatty acid responses to diets containing camelina oil in Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2014, 175, 9–22. [Google Scholar] [CrossRef] [PubMed]
  19. Chen, C.; Zhang, J.; Zhang, M.; You, C.; Liu, Y.; Wang, S.; Li, Y. miR-146a is involved in the regulation of vertebrate LC-PUFA biosynthesis by targeting elovl5 as demonstrated in rabbitfish Siganus canaliculatus. Gene 2018, 676, 306–314. [Google Scholar] [CrossRef] [PubMed]
  20. Ren, H.T.; Huang, Y.; Tang, Y.K.; Yu, J.H.; XU, P. Two Elovl5-like elongase genes in Cyprinus carp var. Jian: Gene characterization, mRNA expression, and nutritional regulation. Mol. Biol. 2015, 49, 527–534. [Google Scholar] [CrossRef]
  21. Zhang, H.; Xu, P.; Jiang, Y.; Zhao, Z.; Feng, J.; Tai, R.; Dong, C.; Xu, J. Genomic, transcriptomic, and epigenomic features differentiate genes that are relevant for muscular polyunsaturated fatty acids in the common carp. Front. Genet. 2019, 10, 217. [Google Scholar] [CrossRef] [PubMed]
  22. GB/T 22223-2008; Determination of Total Fat, Saturated Fat, and Unsaturated Fat in Foods—Hydrolytic Extraction-Gas Chromatography. Standardization Administration of the People’s Republic of China: Beijing, China, 2008.
  23. Zhang, W.; Jia, Y.; Ji, X.; Zhang, R.; Liang, T.; Du, Q.; Chang, Z. Optimal reference genes in different tissues, gender, and gonad of Yellow River carp (Cyprinus carpio var) at various developmental periods. Pak. J. Zool. 2016, 48, 1615–1622. [Google Scholar]
  24. Dael, P.V. Role of n-3 long-chain polyunsaturated fatty acids in human nutrition and health: Review of recent studies and recommendations. Nutr. Res. Pract. 2021, 15, 137–159. [Google Scholar] [CrossRef] [PubMed]
  25. Bou, M.; Berge, G.M.; Baeverfjord, G.; Sigholt, T.; Østbye, T.; Romarheim, O.H.; Hatlen, B.; Leeuwis, R.; Venegas, C.; Ruyter, B. Requirements of n-3 very long-chain PUFA in Atlantic salmon (Salmo salar L): Effects of different dietary levels of EPA and DHA on fish performance and tissue composition and integrity. Br. J. Nutr. 2017, 117, 30–47. [Google Scholar] [CrossRef]
  26. Jin, Y.; Datsomor, A.K.; Olsen, R.E.; Vik, J.O.; Torgersen, J.S.; Edvardsen, R.B.; Wargelius, A.; Winge, P.; Grammes, F. Targeted mutagenesis of ∆5 and ∆6 fatty acyl desaturases induce dysregulation of lipid metabolism in Atlantic salmon (Salmo salar). BMC Genom. 2020, 21, 805. [Google Scholar] [CrossRef]
  27. Xie, D.; Liu, X.; Wang, S.; You, C.; Li, Y. Effects of dietary LNA/LA ratios on growth performance, fatty acid composition and expression levels of elovl5, Δ4 fad and Δ6/Δ5 fad in the marine teleost Siganus canaliculatus. Aquaculture 2018, 484, 309–316. [Google Scholar] [CrossRef]
  28. Sun, S.; Ren, T.; Li, X.; Cao, X.; Gao, J. Polyunsaturated fatty acids synthesized by freshwater fish: A new insight to the roles of elovl2 and elovl5 in vivo. Biochem. Biophys. Res. Commun. 2020, 532, 414–419. [Google Scholar] [CrossRef]
  29. Liu, C.; Ye, D.; Wang, H.; He, M.; Sun, Y. Elovl2 But Not Elovl5 Is Essential for the Biosynthesis of Docosahexaenoic Acid (DHA) in Zebrafish: Insight from a Comparative Gene Knockout Study. Mar. Biotechnol. 2020, 22, 613–619. [Google Scholar] [CrossRef]
  30. Monroig, O.; Shu-Chien, A.C.; Kabeya, N.; Tocher, D.R.; Castro, L.F.C. Desaturases and elongases involved in long-chain polyunsaturated fatty acid biosynthesis in aquatic animals: From genes to functions. Prog. Lipid Res. 2022, 86, 101157. [Google Scholar] [CrossRef]
  31. Kabeya, N.; Takeuchi, Y.; Yamamoto, Y.; Yazawa, R.; Haga, Y.; Satoh, S.; Yoshizaki, G. Modification of the n-3 HUFA biosynthetic pathway by transgenesis in a marine teleost, nibe croaker. J. Biotechnol. 2014, 172, 46–54. [Google Scholar] [CrossRef]
  32. Monroig, O.; Rotllant, J.; Sanchez, E.; Cerda-Reverter, J.M.; Tocher, D.R. Expression of long-chain polyunsaturated fatty acid (LC-PUFA) biosynthesis genes during zebrafish Danio rerio early embryogenesis. BBA Mol. Cell Biol. Lipids 2009, 1791, 1093–1101. [Google Scholar] [CrossRef] [PubMed]
  33. Marrero, M.; Monroig, O.; Navarro, J.C.; Ribes-Navarro, A.; Perez, J.A.; Galindo, A.; Rodriguez, C. Metabolic and molecular evidence for long-chain PUFA biosynthesis capacity in the grass carp Ctenopharyngodon idella. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2022, 270, 111232. [Google Scholar] [CrossRef] [PubMed]
  34. Datsomor, A.K.; Zic, N.; Li, K.; Olsen, R.E.; Jin, Y.; Vik, J.O.; Edvardsen, R.B.; Grammes, F.; Wargelius, A.; Winge, P. CRISPR/Cas9-mediated ablation of elovl2 in Atlantic salmon (Salmo salar L.) inhibits elongation of polyunsaturated fatty acids and induces Srebp-1 and target genes. Sci. Rep. 2019, 9, 7533. [Google Scholar] [CrossRef] [PubMed]
  35. Li, S.; Monroig, Ó.; Wang, T.; Yuan, Y.; Navarro, J.C.; Hontoria, F.; Liao, K.; Tocher, D.R.; Mai, K.; Xu, W.; et al. Functional characterization and differential nutritional regulation of putative Elovl5 and Elovl4 elongases in large yellow croaker (Larimichthys crocea). Sci. Rep. 2017, 7, 2303. [Google Scholar] [CrossRef] [PubMed]
  36. Morais, S.; Monroig, O.; Zheng, X.; Leaver, M.J.; Tocher, D.R. Highly unsaturated fatty acid synthesis in Atlantic salmon: Characterization of ELOVL5- and ELOVL2-like elongases. Mar. Biotechnol. 2009, 11, 627–639. [Google Scholar] [CrossRef] [PubMed]
  37. Xie, D.; Ye, J.; Lu, M.; Wang, S.; Li, Y. Comparison of activities of fatty acyl desaturases and elongases among six teleosts with different feeding and ecological habits. Front. Mar. Sci. 2020, 7, 117. [Google Scholar] [CrossRef]
  38. Ren, H.; Yu, J.; Xu, P.; Tang, Y. Single nucleotide polymorphisms of Δ6-desaturase and Elovl5 segments and their associations with common carp (Cyprinus carpio) growth traits. Genet. Mol. Res. 2015, 14, 12848–12854. [Google Scholar] [CrossRef]
  39. Ren, H.; Yu, J.; Xu, P.; Tang, Y. Influence of dietary fatty acids on muscle fatty acid composition and expression levels of Δ6 desaturase-like and Elovl5-like elongase in common carp (Cyprinus carpio var. Jian). Comp. Biochem. Phys. B 2012, 163, 184–192. [Google Scholar] [CrossRef]
Figure 1. Quantitative real-time PCR based on the relative expression levels of four candidate genes. Data are shown as mean ± SE (n = 6). The significant differences were indicated by asterisks (* p < 0.05, Wilcoxon test).
Figure 1. Quantitative real-time PCR based on the relative expression levels of four candidate genes. Data are shown as mean ± SE (n = 6). The significant differences were indicated by asterisks (* p < 0.05, Wilcoxon test).
Animals 14 00544 g001
Figure 2. Results of the targeting relationship between miR-26a-5p and elovl5a. The firefly/Renilla activity was measured when miR-26a-5p mimics or mimics NC with wildtype (Elovl5-WT) or mutant (Elovl5-MUT) pmir-GLO vectors were co-transfected into HEK 293t cells for 48 h. Data are shown as mean ± SE (n = 3). The significant differences were indicated by asterisks (** p < 0.01, ns p > 0.05, Wilcoxon test).
Figure 2. Results of the targeting relationship between miR-26a-5p and elovl5a. The firefly/Renilla activity was measured when miR-26a-5p mimics or mimics NC with wildtype (Elovl5-WT) or mutant (Elovl5-MUT) pmir-GLO vectors were co-transfected into HEK 293t cells for 48 h. Data are shown as mean ± SE (n = 3). The significant differences were indicated by asterisks (** p < 0.01, ns p > 0.05, Wilcoxon test).
Animals 14 00544 g002
Figure 3. Results of elovl5a gene disruption between wildtype and mutant Yellow River carp. (A) The n-3 PUFA content differences between wildtype and mutant Yellow River carp. Data are shown as mean ± SE (n = 6). The significant differences were indicated by asterisks (* p < 0.05, t-test). (B) The mutations in the elovl5a-disrupted individuals were detected by Sanger sequencing. (C) The mRNA expression level of wildtype and elovl5a-disrupted individuals. Data were shown as mean ± SE (n = 3).
Figure 3. Results of elovl5a gene disruption between wildtype and mutant Yellow River carp. (A) The n-3 PUFA content differences between wildtype and mutant Yellow River carp. Data are shown as mean ± SE (n = 6). The significant differences were indicated by asterisks (* p < 0.05, t-test). (B) The mutations in the elovl5a-disrupted individuals were detected by Sanger sequencing. (C) The mRNA expression level of wildtype and elovl5a-disrupted individuals. Data were shown as mean ± SE (n = 3).
Animals 14 00544 g003
Table 1. Primers used in this study.
Table 1. Primers used in this study.
GenePrimer Sequences (5′‒3′)Product Length (bp)Purpose
acsbg2F: CTCAAGTGTAACGTTGATGACAATG237qRT-PCR
R: AGATATGGAGAAGTCTCGTGGAAG
elovl5aF: CAGGATGATGAACGTACTTTGGTG209qRT-PCR
R: GGATGAAGCTGTTAAACGTGGC
fads6F: GTGTGTGTGTCTGGGGTTTTTT198qRT-PCR
R: GTCATTTGGTAGATGCGTTTGG
lplF: GAGTCAACAAAATTCGCACACG205qRT-PCR
R: TTCAAAGCAGGCATAATGTAGGG
elovl5aF: GCTTTGAACATATTTCCTTCCTGAC879PCR
R: TGCCCAATTCACCACTGCTT
Table 2. The statistical description of n-3 PUFA content in mutant and wildtype Yellow River carp.
Table 2. The statistical description of n-3 PUFA content in mutant and wildtype Yellow River carp.
TraitMin (g/kg)Max (g/kg)Average (g/kg)SDCoefficient of Variation (%)
ALA—mutant0.0620.7510.2280.024 103.9
ALA—wildtype0.0750.4440.2330.014 61
ARA—mutant0.2280.8020.4030.019 47.88
ARA—wildtype0.2350.580.4010.013 31.63
EPA—mutant0.1350.3220.2350.016 53.12
EPA—wildtype0.2480.4490.3320.010 20
DHA—mutant0.5060.6680.5890.007 12.37
DHA—wildtype0.3430.5370.4720.007 14.54
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, H.; Li, P.; Zhu, Y.; Jiang, Y.; Feng, J.; Zhao, Z.; Xu, J. Contribution of elovl5a to Docosahexaenoic Acid (DHA) Synthesis at the Transcriptional Regulation Level in Common Carp, Cyprinus carpio. Animals 2024, 14, 544. https://doi.org/10.3390/ani14040544

AMA Style

Zhang H, Li P, Zhu Y, Jiang Y, Feng J, Zhao Z, Xu J. Contribution of elovl5a to Docosahexaenoic Acid (DHA) Synthesis at the Transcriptional Regulation Level in Common Carp, Cyprinus carpio. Animals. 2024; 14(4):544. https://doi.org/10.3390/ani14040544

Chicago/Turabian Style

Zhang, Hanyuan, Peizhen Li, Youxiu Zhu, Yanliang Jiang, Jianxin Feng, Zixia Zhao, and Jian Xu. 2024. "Contribution of elovl5a to Docosahexaenoic Acid (DHA) Synthesis at the Transcriptional Regulation Level in Common Carp, Cyprinus carpio" Animals 14, no. 4: 544. https://doi.org/10.3390/ani14040544

APA Style

Zhang, H., Li, P., Zhu, Y., Jiang, Y., Feng, J., Zhao, Z., & Xu, J. (2024). Contribution of elovl5a to Docosahexaenoic Acid (DHA) Synthesis at the Transcriptional Regulation Level in Common Carp, Cyprinus carpio. Animals, 14(4), 544. https://doi.org/10.3390/ani14040544

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop