The Bacterial Cell Wall Components Lipopolysaccharide and Peptidoglycan Initiate Divergent Local Tissue and Systemic Inflammatory Response Profiles in the Chicken Model
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Intradermal Injection and Collection of Growing Feathers
2.3. Blood Collection
2.4. Preparation of Pulp Cell Suspensions, Immunofluorescent Staining, and Cell Population Analyses by Flow Cytometry
2.5. RNA Isolation, Quantification, and cDNA Synthesis
2.6. Relative Expression of Cytokines
2.7. Blood Profile Analysis via Automated Hematology (CellDyn)
2.8. Study 1: Local and Systemic Inflammatory Responses to Intradermal Pulp Injection of Various Dosages of Lipopolysaccharide (LPS)
2.9. Study 2: Local and Systemic Inflammatory Responses to Intradermal Pulp Injection of Various Dosages of Peptidoglycan (PGN)
2.10. Study 3: Local Leukocyte Infiltration and Cytokine Gene Expression in Response to Intradermal Pulp Injection of PBS, LPS, or PGN
2.11. Statistical Analysis
3. Results
3.1. Study 1: Local (GF-Pulp) and Systemic (Blood) Inflammatory Responses to Intradermal Pulp Injection of Various Dosages of Lipopolysaccharide (LPS)
3.2. Study 2: Local (GF-Pulp) and Systemic (Blood) Inflammatory Responses to Intradermal Pulp Injection of Various Dosages of Peptidoglycan (PGN)
3.3. Study 3: Local Leukocyte Infiltration and Cytokine Gene Expression in Response to Intradermal Pulp Injection of PBS, LPS, or PGN
3.3.1. Leukocyte Infiltration
3.3.2. Relative Cytokine mRNA Expression
4. Discussion
4.1. Effect of Dose of LPS or PGN on the Local and Systemic Inflammatory Response Profiles in Egg-Type Chickens
4.1.1. LPS
4.1.2. PGN
4.1.3. Vehicle
4.2. Concurrent Study of Local Activities Initiated by i.d. GF-Pulp Injection of LPS or PGN Confirms Their Divergent Inflammatory Response Profiles
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Winn, W.; Allen, S.; Janda, W.; Koneman, E.; Procop, G.; Schreckenberger, P.; Woods, G. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology, 6th ed.; Lippincott Williams & Wilkins: Baltimore, MD, USA, 2006. [Google Scholar]
- Kumar, H.; Kawai, T.; Akira, S. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 2011, 30, 16–34. [Google Scholar] [CrossRef] [PubMed]
- Abbas, A.K.; Lichtman, A.H.; Pillai, S. Cellular and Molecular Immunology, 10th ed.; Elsevier: Philadelphia, PA, USA, 2022. [Google Scholar]
- Sultzer, B.M.; Alerts, E. Genetic factors in leucocyte responses to endotoxin: Further studies in mice. J. Immunol. 1969, 103, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Richardson, R.P.; Rhyne, C.D.; Fong, Y.; Hesse, D.G.; Tracey, K.J.; Marano, M.A.; Lowry, S.F.; Antonacci, A.C.; Calvano, S.E. Peripheral blood leukocyte kinetics following in vivo lipopolysaccharide (LPS) administration to normal human subjects. Influence of elicited hormones and cytokines. Ann. Surg. 1989, 210, 239–245. [Google Scholar] [CrossRef]
- Bowen, O.T.; Dienglewicz, R.L.; Wideman, R.F.; Erf, G.F. Altered monocyte and macrophage numbers in blood and organs of chickens injected i.v. with lipopolysaccharide. Vet. Immunol. Immunopathol. 2009, 131, 200–210. [Google Scholar] [CrossRef]
- French, C.E.; Sales, M.A.; Rochell, S.J.; Rodriguez, A.; Erf, G.F. Local and systemic inflammatory responses to lipopolysaccharide in broilers: New insights using a two-window approach. Poult. Sci. 2020, 99, 6593–6605. [Google Scholar] [CrossRef]
- Erf, G.F.; Ramachandran, I.R. The growing feather as a dermal test-site: Comparison of leukocyte profiles during the response to Mycobacterium butyricum in growing feathers, wattles, and wing webs. Poult. Sci. 2016, 95, 2011–2022. [Google Scholar] [CrossRef]
- Martinon, F.; Agostini, L.; Meylan, E.; Tschopp, J. Identification of bacterial muramyl dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr. Biol. 2004, 14, 1929–1934. [Google Scholar] [CrossRef] [PubMed]
- Keestra, A.M.; de Zoete, M.R.; Bouwman, L.I.; Vaezirad, M.M.; van Putten, J.P. Unique features of chicken Toll-like receptors. Dev. Comp. Immunol. 2013, 41, 316–323. [Google Scholar] [CrossRef]
- Wigley, P.; Kaiser, P. Avian cytokines in health and disease. Rev. Bras. Ciência Avícola 2003, 5, 1–14. [Google Scholar] [CrossRef]
- Girardin, S.E.; Philpott, D.J. Mini review: The role of peptidoglycan recognition in innate immunity. Eur. J. Immunol. 2004, 34, 1777–1782. [Google Scholar] [CrossRef]
- Dziarski, R.; Gupta, D. Peptidoglycan recognition in innate immunity. J. Endotoxin Res. 2005, 11, 304–310. [Google Scholar] [CrossRef]
- Kogut, M.H.; Iqbal, M.; He, H.; Philbin, V.; Kaiser, P.; Smith, A. Expression and function of Toll-like receptors in chicken heterophils. Dev. Comp. Immunol. 2005, 29, 791–807. [Google Scholar] [CrossRef]
- He, H.; Genovese, K.J.; Kogut, M.H. Modulation of chicken macrophage effector function by TH1/TH2 cytokines. Cytokine 2011, 53, 363–369. [Google Scholar] [CrossRef]
- Shi, F.; Erf, G.F. IFN-gamma, IL-21 and IL-10 co-expression in evolving autoimmune vitiligo lesions of Smyth line chickens. J. Investig. Dermatol. 2012, 132, 642–649. [Google Scholar] [CrossRef] [PubMed]
- Seliger, C.; Schaerer, B.; Kohn, M.; Pendl, H.; Weigend, S.; Kaspers, B.; Härtle, S. A rapid high-precision flow cytometry-based technique for total white blood cell counting in chickens. Vet. Immunol. Immunopathol. 2012, 145, 86–99. [Google Scholar] [CrossRef] [PubMed]
- Sreekantapuram, S.; Berens, C.; Barth, S.A.; Methner, U.; Berndt, A. Interaction of Salmonella Gallinarum and Salmonella Enteritidis with peripheral leucocytes of hens with different laying performance. Vet. Res. 2021, 52, 23. [Google Scholar] [CrossRef]
- Burkhardt, N.B.; Elleder, D.; Schusser, B.; Krchlíková, V.; Göbel, T.W.; Härtle, S.; Kaspers, B. The discovery of chicken Foxp3 demands redefinition of avian regulatory T cells. J. Immunol. 2022, 208, 1128–1138. [Google Scholar] [CrossRef]
- Qureshi, M.A. Avian macrophage and immune response: An overview. Poult. Sci. 2003, 82, 691–698. [Google Scholar] [CrossRef]
- Rocchi, A.J.; Santamaria, J.M.; Beck, C.N.; Sales, M.A.; Hargis, B.M.; Tellez-Isaias, G.; Erf, G.F. The immuno-suppressive effects of cyclic, environmental heat stress in broiler chickens: Local and systemic inflammatory responses to an intradermal injection of lipopolysaccharide. Vet. Sci. 2023, 11, 16. [Google Scholar] [CrossRef]
- Shini, S.; Kaiser, P.; Shini, A.; Bryden, W.L. Differential alterations in ultrastructural morphology of chicken heterophils and lymphocytes induced by corticosterone and lipopolysaccharide. Vet. Immunol. Immunopathol. 2008, 122, 83–93. [Google Scholar] [CrossRef]
- Leshchinsky, T.V.; Klasing, K.C. Divergence of the inflammatory response in two types of chickens. Dev. Comp. Immunol. 2001, 25, 629–638. [Google Scholar] [CrossRef]
- Leemans, J.C.; Heikens, M.; Van Kessel, K.P.; Florquin, S.; van der Poll, T. Lipoteichoic acid and peptidoglycan from Staphylococcus aureus synergistically induce neutrophil influx into the lungs of mice. Clin. Diagn. Lab. Immunol. 2003, 10, 950–953. [Google Scholar] [PubMed]
- Mullaly, S.C.; Kubes, P. The role of TLR2 in vivo following challenge with Staphylococcus aureus and prototypic ligands. J. Immunol. 2006, 177, 8154–8163. [Google Scholar] [CrossRef] [PubMed]
- Majeed, S.; Hamad, S.K.; Shah, B.R.; Bielke, L.; Nazmi, A. Natural intraepithelial lymphocyte populations rise during necrotic enteritis in chickens. Front. Immunol. 2024, 15, 1354701. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Santamaria, J.M.; Beck, C.N.; Erf, G.F. Local inflammatory and systemic antibody responses initiated by a first intradermal administration of autogenous Salmonella-killed vaccines and their components in pullets. Vaccines 2024, 12, 1159. [Google Scholar] [CrossRef]
- Iqbal, M.; Philbin, V.J.; Smith, A.L. Expression patterns of chicken Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. Vet. Immunol. Immunopathol. 2005, 104, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Stewart-Tull, D.E. The immunological activities of bacterial peptidoglycans. Annu. Rev. Microbiol. 1980, 34, 11–40. [Google Scholar] [CrossRef]
- Levinson, A.I.; Dziarski, A.; Zweiman, B.; Dziarski, R. Staphylococcal peptidoglycan: T-cell-dependent mitogen and relatively T-cell-independent polyclonal B-cell activator of human lymphocytes. Infect. Immun. 1983, 39, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Kogut, M.H.; Rothwell, L.; Kaiser, P. Differential regulation of cytokine gene expression by avian heterophils during receptor-mediated phagocytosis of opsonized and nonopsonized Salmonella enteritidis. J. Interf. Cytokine Res. 2003, 23, 319–327. [Google Scholar] [CrossRef]
- Hangalapura, B.N.; Nieuwland, M.G.B.; De Vries Reilingh, G.; Buyse, J.J.; Van Den Brand, H.; Kemp, B.; Parmentier, H.K. Severe feed restriction enhances innate immunity but suppresses cellular immunity in chicken lines divergently selected for antibody responses. Poult. Sci. 2005, 84, 1520–1529. [Google Scholar] [CrossRef]
- Siwek, M.; Buitenhuis, A.J.; Cornelissen, S.J.B.; Nieuwland, M.G.B.; Bovenhuis, H.; Crooijmans, R.P.M.A.; Groenen, M.A.M.; deVries-Reilingh, G.; Parmentier, H.K.; van der Poel, J.J. Detection of different quantitative trait loci for antibody responses to keyhole limpet hemocyanin and Mycobacterium butyricum in two unrelated populations of laying hens. Poult. Sci. 2003, 82, 1845–1852. [Google Scholar] [CrossRef]
Target | Primers and Probe | Sequences (5′to 3′) | Accession NO. |
---|---|---|---|
28S | Forward | GGCGAAGCCAGAGGAAACT | X59733 |
Reverse | GACGACCGATTTGCACGTC | ||
Probe | (FAM)-AGGACCGCTACGGACCTCCACCA-(TAMRA) | ||
IL1B | Forward | GCTCTACATGTCGTGTGTGATGAG | AJ245728 |
Reverse | TGTCGATGTCCCGCATGA | ||
Probe | (FAM)-CCACACTGCAGCTGGAGGAAGCC-(TAMRA) | ||
IL4 | Forward | AACATGCGTCAGCTCCTGAAT | AJ621735 |
Reverse | TCTGCTAGGAACTTCTCCATTGAA | ||
Probe | (FAM)-AGCAGCACCTCCCTCAAGGCACC-(TAMRA) | ||
IL6 | Forward | GCTCGCCGGCTTCGA | AJ250838 |
Reverse | GGTAGGTCTGAAAGGCGAACAG | ||
Probe | (FAM)-AGGAGAAATGCCTGACGAAGCTCTCCA-(TAMRA) | ||
IL8 (CXCL8) | Forward | GCCCTCCTCCTGGTTTCA | AJ009800 |
Reverse | TGGCACCGCAGCTCATT | ||
Probe | (FAM)-TCTTTACCAGCGTCCTACCTTGCGACA-(TAMRA) | ||
IL10 | Forward | CATGCTGCTGGGCCTGAA | AJ621614 |
Reverse | CGTCTCCTTGATCTGCTTGATG | ||
Probe | (FAM)-CGACGATGCGGCGCTGTCA-(TAMRA) | ||
IL12A | Forward | TGGCCAAGGGACTCAACTG | NM_213588.1 |
Reverse | ACCTCTTCAAGGGTGCACTCA | ||
Probe | (FAM)-CCGCTGCAAACGAGGCACTCCT-(TAMRA) | ||
IL21 | Forward | GTGGTGAAAGATAAGGATGTCGAA | NM_001024835.1 |
Reverse | TGCCATTCTGGAAGCAGGTT | ||
Probe | (FAM)-TGCTGCATACACCAGAAAACCCTGGG-(TAMRA) | ||
IFNA | Forward | GACAGCCAACGCCAAAGC | U07868 |
Reverse | GTCGCTGCTGTCCAAGCATT | ||
Probe | (FAM)-CTCAACCGGATCCACCGCTACACC-(TAMRA) | ||
IFNB | Forward | CCTCCAACACCTCTTCAACATG | X92479 |
Reverse | TGGCGTGTGCGGTCAAT | ||
Probe | (FAM)-TTAGCAGCCCACACACTCCAAAACACTG-(TAMRA) | ||
IFNG | Forward | GTGAAGAAGGTGAAAGATATCATGGA | Y07922 |
Reverse | GCTTTGCGCTGGATTCTCA | ||
Probe | (FAM)-TGGCCAAGCTCCCGATGAACGA-(TAMRA) | ||
LITAF | Forward | AAGACAAAATTTGCAGGCTGTTT | AB058634 |
Reverse | GGAGCAGACATGATATATGACTGAAATAA | ||
Probe | (FAM)-TGCCTCTGCCATCAGCTCTTTTGTGC-(TAMRA) |
Lymphocyte | Treatment | 0 h | 4 h | 8 h | 1 d | 2 d | 3 d | 5 d | 7d | p (Time) |
---|---|---|---|---|---|---|---|---|---|---|
Bu-1+ | PBS | 0.93 2 | 0.66 | 0.75 | 0.75 | 1.07 | 0.57 | 0.86 | 0.97 | 0.305 |
PGN | 1.12 3 z | 1.26 z | 2.98 z | 11.7 xy | 17.2 x | 12.0 xy | 13.5 xy | 9.03 y | <0.001 | |
CD4+ | PBS | 1.79 | 1.12 | 1.02 | 1.00 | 1.45 | 0.97 | 1.09 | 1.64 | 0.365 |
PGN | 1.26 z | 2.47 zy | 3.65 zy | 9.04 xw | 10.0 w | 6.26 xy | 5.84 y | 4.79 y | <0.001 | |
CD8+ | PBS | 2.52 | 2.01 | 2.12 | 2.42 | 3.28 | 2.94 | 3.07 | 3.33 | 0.102 |
PGN | 1.83 z | 1.90 z | 2.83 z | 7.98 w | 7.18 wx | 4.60 xy | 4.98 xy | 3.95 y | <0.001 | |
γδ TCR+ | PBS | 1.20 | 1.52 | 1.37 | 1.10 | 1.42 | 1.13 | 1.00 | 1.36 | 0.363 |
PGN | 0.96 z | 2.29 y | 2.86 xy | 3.61 x | 2.48 y | 1.38 yz | 1.33 yz | 1.36 yz | <0.001 | |
αβ1 TCR+ | PBS | 2.67 | 1.79 | 1.97 | 1.73 | 2.65 | 2.30 | 2.15 | 2.87 | 0.149 |
PGN | 1.90 z | 2.01 yz | 2.87 yz | 7.51 w | 6.75 wx | 4.35 xy | 3.99 y | 3.92 y | <0.001 | |
αβ2 TCR+ | PBS | 0.81 | 0.61 | 0.67 | 0.70 | 0.95 | 0.84 | 0.83 | 1.17 | 0.148 |
PGN | 0.34 z | 0.812 z | 1.19 yz | 3.12 wx | 3.76 w | 2.36 xy | 1.84 yz | 1.42 y | <0.001 |
Cell-Type | Treat | 0 h | 4 h | 8 h | 24 h | 48 h | 72 h |
---|---|---|---|---|---|---|---|
Bu-1+ | PBS | 0.58 ± 0.20 2 | 0.65 ± 0.13 | 1.34 ± 0.38 | 0.70 ± 0.14 b | 0.92 ± 0.19 b | 0.67 ± 0.09 b |
LPS | 0.44 ± 0.11 | 1.04 ± 0.23 | 1.34 ± 0.19 | 1.46 ± 0.20 b | 1.75 ± 0.17 b | 1.11 ± 0.30 b | |
PGN | 1.12 ± 0.25 z | 1.07 ± 0.08 z | 1.60 ± 0.10 z | 6.50 ± 1.08 a,y | 10.8 ± 1.96 a,x | 9.33 ± 0.97 a,x | |
CD4+ | PBS | 0.64 ± 0.23 | 0.51 ± 0.10 | 1.21 ± 0.55 | 0.51 ± 0.10 b | 0.76 ± 0.26 b | 0.81 ± 0.11 b |
LPS | 0.57 ± 0.21 | 1.07 ± 0.29 | 1.76 ± 0.40 | 0.99 ± 0.22 b | 2.04 ± 0.74 b | 1.44 ± 0.17 b | |
PGN | 0.77 ± 0.13 z | 2.47 ± 0.29 z | 1.75 ± 0.28 z | 6.18 ± 1.63 a,xy | 8.28 ± 2.00 a,x | 5.58 ± 0.82 a,y | |
CD8+ | PBS | 2.15 ± 0.67 | 2.37 ± 0.61 | 3.99 ± 1.16 | 2.68 ± 0.48 b | 3.64 ± 0.61 b | 4.09 ± 0.49 |
LPS | 1.28 ± 0.56 | 2.41 ± 0.39 | 2.82 ± 0.56 | 1.68 ± 0.32 b | 4.06 ± 0.32 b | 3.28 ± 0.50 | |
PGN | 3.37 ± 0.60 z | 3.63 ± 0.48 z | 4.04 ± 0.48 z | 5.03 ± 1.39 a,yz | 8.11 ± 1.19 a,y | 4.84 ± 0.88 yz | |
γδ TCR+ | PBS | 0.69 ± 0.22 | 1.11 ± 0.36 b | 1.32 ± 0.42 b | 0.83 ± 0.28 b | 1.25 ± 0.45 b | 1.10 ± 0.21 b |
LPS | 0.58 ± 0.14 | 1.44 ± 0.27 b | 1.36 ± 0.36 b | 0.99 ± 0.24 b | 1.33 ± 0.15 b | 1.35 ± 0.13 b | |
PGN | 1.36 ± 0.28 z | 3.57 ± 1.01 a,y | 3.31 ± 0.93 a,y | 3.57 ± 0.49 a,y | 3.74 ± 0.32 a,y | 3.04 ± 0.42 a,y | |
αβ1 TCR+ | PBS | 1.78 ± 0.45 | 1.42 ± 0.34 | 2.49 ± 0.70 | 1.65 ± 0.32 b | 2.35 ± 0.53 b | 2.38 ± 0.29 b |
LPS | 1.20 ± 0.32 | 2.13 ± 0.32 | 1.71 ± 0.35 | 1.43 ± 0.34 b | 3.23 ± 0.56 b | 2.58 ± 0.24 b | |
PGN | 2.66 ± 0.53 z | 3.64 ± 0.51 z | 3.45 ± 0.43 z | 7.25 ± 1.37 a,y | 10.5 ± 1.63 a,x | 6.46 ± 0.98 a,y | |
αβ2 TCR+ | PBS | 0.71 ± 0.23 | 0.67 ± 0.15 | 1.07 ± 0.22 | 0.77 ± 0.16 b | 1.12 ± 0.23 b | 1.02 ± 0.15 b |
LPS | 0.48 ± 0.18 | 0.71 ± 0.07 | 0.69 ± 0.13 | 0.51 ± 0.10 b | 1.06 ± 0.13 b | 1.04 ± 0.17 b | |
PGN | 1.06 ± 0.18 z | 1.34 ± 0.21 z | 1.28 ± 0.15 z | 2.82 ± 0.52 a,y | 4.15 ± 0.68 a,x | 2.24 ± 0.21 a,y |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Byrne, K.A.; Erf, G.F. The Bacterial Cell Wall Components Lipopolysaccharide and Peptidoglycan Initiate Divergent Local Tissue and Systemic Inflammatory Response Profiles in the Chicken Model. Animals 2024, 14, 3661. https://doi.org/10.3390/ani14243661
Byrne KA, Erf GF. The Bacterial Cell Wall Components Lipopolysaccharide and Peptidoglycan Initiate Divergent Local Tissue and Systemic Inflammatory Response Profiles in the Chicken Model. Animals. 2024; 14(24):3661. https://doi.org/10.3390/ani14243661
Chicago/Turabian StyleByrne, Kristen A., and Gisela F. Erf. 2024. "The Bacterial Cell Wall Components Lipopolysaccharide and Peptidoglycan Initiate Divergent Local Tissue and Systemic Inflammatory Response Profiles in the Chicken Model" Animals 14, no. 24: 3661. https://doi.org/10.3390/ani14243661
APA StyleByrne, K. A., & Erf, G. F. (2024). The Bacterial Cell Wall Components Lipopolysaccharide and Peptidoglycan Initiate Divergent Local Tissue and Systemic Inflammatory Response Profiles in the Chicken Model. Animals, 14(24), 3661. https://doi.org/10.3390/ani14243661