European Hedgehogs as Hosts of Chaphamaparvovirus, Italy
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Screening of Samples in Quantitative and Conventional PCR
2.3. Genome Sequencing and Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kisary, J. Experimental infection of chicken embryos and day-old chickens with parvovirus of chicken origin. Avian Pathol. 1985, 14, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Pénzes, J.J.; de Souza, W.M.; Agbandje-McKenna, M.; Gifford, R.J. An Ancient Lineage of Highly Divergent Parvoviruses Infects both Vertebrate and Invertebrate Hosts. Viruses 2019, 11, 525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baker, K.S.; Leggett, R.M.; Bexfield, N.H.; Alston, M.; Daly, G.; Todd, S.; Tachedjian, M.; Holmes, C.E.; Crameri, S.; Wang, L.F.; et al. Metagenomic study of the viruses of African straw-coloured fruit bats: Detection of a chiropteran poxvirus and isolation of a novel adenovirus. Virology 2013, 441, 95–106. [Google Scholar] [CrossRef] [Scilit]
- Reuter, G.; Boros, Á.; Delwart, E.; Pankovics, P. Novel circular single-stranded DNA virus from turkey faeces. Arch. Virol. 2014, 159, 2161–2164. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.; Liu, Z.; Wang, Y.; Li, W.; Fu, X.; Lin, Y.; Shen, Q.; Wang, X.; Wang, H.; Zhang, W. A novel rodent Chapparvovirus in feces of wild rats. Virol. J. 2016, 13, 133. [Google Scholar] [CrossRef] [Scilit]
- Palinski, R.M.; Mitra, N.; Hause, B.M. Discovery of a novel Parvovirinae virus, porcine parvovirus 7, by metagenomic sequencing of porcine rectal swabs. Virus Genes 2016, 52, 564–567. [Google Scholar] [CrossRef] [Scilit]
- Lima, D.A.; Cibulski, S.P.; Tochetto, C.; Varela, A.P.M.; Finkler, F.; Teixeira, T.F.; Loiko, M.R.; Cerva, C.; Junqueira, D.M.; Mayer, F.Q.; et al. The intestinal virome of malabsorption syndrome-affected and unaffected broilers through shotgun metagenomics. Virus Res. 2019, 261, 9–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souza, W.M.; Romeiro, M.F.; Fumagalli, M.J.; Modha, S.; de Araujo, J.; Queiroz, L.H.; Durigon, E.L.; Figueiredo, L.T.M.; Murcia, P.R.; Gifford, R.J. Chapparvoviruses occur in at least three vertebrate classes and have a broad biogeographic distribution. J. Gen. Virol. 2017, 98, 225–229. [Google Scholar] [CrossRef] [Scilit]
- Roediger, B.; Lee, Q.; Tikoo, S.; Cobbin, J.C.A.; Henderson, J.M.; Jormakka, M.; O’Rourke, M.B.; Padula, M.P.; Pinello, N.; Henry, M.; et al. An Atypical Parvovirus Drives Chronic Tubulointerstitial Nephropathy and Kidney Fibrosis. Cell 2018, 175, 530–543.e24. [Google Scholar] [CrossRef] [Scilit]
- Williams, S.H.; Che, X.; Garcia, J.A.; Klena, J.D.; Lee, B.; Muller, D.; Ulrich, W.; Corrigan, R.M.; Nichol, S.; Jain, K.; et al. Viral Diversity of House Mice in New York City. mBio 2018, 9, e01354-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fahsbender, E.; Altan, E.; Seguin, M.A.; Young, P.; Estrada, M.; Leutenegger, C.; Delwart, E. Chapparvovirus DNA found in 4% of dogs with diarrhea. Viruses 2019, 11, 398. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Gordon, E.; Idle, A.; Altan, E.; Seguin, M.A.; Estrada, M.; Deng, X.; Delwart, E. Virome of a feline outbreak of diarrhea and vomiting includes bocaviruses and a novel chapparvovirus. Viruses 2020, 12, 506. [Google Scholar] [CrossRef] [Scilit]
- Ge, Z.; Carrasco, S.E.; Feng, Y.; Bakthavatchalu, V.; Annamalai, D.; Kramer, R.; Muthupalani, S.; Fox, J.G. Identification of a new strain of mouse kidney parvovirus associated with inclusion body nephropathy in immunocompromised laboratory mice. Emerg. Microbes Infect. 2018, 9, 1814–1823. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Wang, H.; Liu, X.; Li, Y.; Chen, J.; Zhang, J.; Wang, X.; Shen, S.; Wang, H.; Deng, F.; et al. Genomic and transcriptional analyses of novel parvoviruses identified from dead peafowl. Virology 2020, 539, 80–91. [Google Scholar] [CrossRef] [Scilit]
- Chang, W.S.; Li, C.X.; Hall, J.; Eden, J.S.; Hyndman, T.H.; Holmes, E.C.; Rose, K. Meta-transcriptomic discovery of a divergent circovirus and a chaphamaparvovirus in captive reptiles with proliferative respiratory syndrome. Viruses 2020, 12, 1073. [Google Scholar] [CrossRef] [Scilit]
- Di Profio, F.; Sarchese, V.; Palombieri, A.; Fruci, P.; Massirio, I.; Martella, V.; Fulvio, M.; Di Martino, B. Feline chaphamaparvovirus in cats with enteritis and upper respiratory tract disease. Transbound. Emerg. Dis. 2022, 69, 660–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Douady, C.J.; Chatelier, P.I.; Madsen, O.; de Jong, W.W.; Catzeflis, F.; Springer, M.S.; Stanhope, M.J. Molecular phylogenetic evidence confirming the Eulipotyphla concept and in support of hedgehogs as the sister group to shrews. Mol. Phylogenet. Evol. 2002, 25, 200–209. [Google Scholar] [CrossRef] [Scilit]
- Riley, P.Y.; Chomel, B.B. Hedgehog zoonoses. Emerg. Infect. Dis. 2005, 11, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Ruszkowski, J.J.; Hetman, M.; Turlewicz-Podbielska, H.; Pomorska-Mól, M. Hedgehogs as a Potential Source of Zoonotic Pathogens-A Review and an Update of Knowledge. Animals 2021, 11, 1754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delogu, M.; Cotti, C.; Lelli, D.; Sozzi, E.; Trogu, T.; Lavazza, A.; Garuti, G.; Castrucci, M.R.; Vaccari, G.; De Marco, M.A.; et al. Eco-Virological Preliminary Study of Potentially Emerging Pathogens in Hedgehogs (Erinaceus europaeus) Recovered at a Wildlife Treatment and Rehabilitation Center in Northern Italy. Animals 2020, 10, 407. [Google Scholar] [CrossRef] [Scilit]
- Lanave, G.; Diakoudi, G.; Pellegrini, F.; Lombardi, R.; Prioletti, M.; Circella, E.; Camarda, A.; Di Martino, B.; Camero, M.; Decaro, N.; et al. Novel parvovirus in an outbreak of fatal enteritis in European hedgehogs (Erinaceus europaeus), Italy, 2022. Microbiol. Spectr. 2023, 11, e0249423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, W.T.; Hou, X.; Zhao, J.; Sun, J.; He, H.; Si, W.; Wang, J.; Jiang, Z.; Yan, Z.; Xing, G.; et al. Virome characterization of game animals in China reveals a spectrum of emerging pathogens. Cell 2022, 185, 1117–1129.e8. [Google Scholar] [CrossRef] [Scilit]
- Hoefer, H.L. Hedgehogs. Vet. Clin. N. Am. Small Anim. Pract. 1994, 24, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Smith, A.J. Husbandry and nutrition of hedgehogs. Vet. Clin. N. Am. Exot. Anim. Pract. 1999, 2, 127–141. [Google Scholar] [CrossRef] [Scilit]
- Sarchese, V.; Palombieri, A.; Prandi, I.; Robetto, S.; Bertolotti, L.; Capucchio, M.T.; Orusa, R.; Mauthe von Degerfeld, M.; Quaranta, G.; Vacchetta, M.; et al. Molecular Surveillance for Bocaparvoviruses and Bufaviruses in the European Hedgehog (Erinaceus europaeus). Microorganisms 2024, 12, 189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Q.; Padula, M.P.; Pinello, N.; Williams, S.H.; O’Rourke, M.B.; Fumagalli, M.J.; Orkin, J.D.; Song, R.; Shaban, B.; Brenner, O.; et al. Murine and related chapparvoviruses are nephro-tropic and produce novel accessory proteins in infected kidneys. PLoS Pathog. 2020, 16, e1008262. [Google Scholar] [CrossRef] [Scilit]
- Kozak, M. Pushing the limits of the scanning mechanism for initiation of translation. Gene 2002, 299, 1–34. [Google Scholar] [CrossRef] [Scilit]
- Smith, R.H.; Kotin, R.M. An adeno-associated virus (AAV) initiator protein, Rep 78, catalyzes the cleavage and ligation of single-stranded AAV ori DNA. J. Virol. 2000, 74, 3122–3129. [Google Scholar] [CrossRef] [Scilit]
- Walker, J.E.; Saraste, M.; Runswick, M.J.; Gay, N.J. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATPrequiring enzymes and a common nucleotide binding fold. EMBO J. 1982, 1, 945–951. [Google Scholar] [CrossRef] [Scilit]
- James, J.A.; Escalante, C.R.; Yoon-Robarts, M.; Edwards, T.A.; Linden, R.M.; Aggarwal, A.K. Crystal structure of the SF3 helicase from adeno-associated virus type 2. Structure 2003, 11, 1025–1035. [Google Scholar] [CrossRef] [Scilit]
- Z’adori, Z.; Szelei, J.; Lacoste, M.C.; Li, Y.; Garie!py, S.; Raymond, P.; Allaire, M.; Nabi, I.R.; Tijssen, P. A viral phopholipase A2 is required for parvovirus infectivity. Dev. Cell 2001, 1, 291–302. [Google Scholar] [CrossRef] [Scilit]
- Ramos, E.D.S.F.; Abreu, W.U.; Rodrigues, L.R.R.; Marinho, L.F.; Morais, V.D.S.; Villanova, F.; Pandey, R.P.; Araújo, E.L.L.; Deng, X.; Delwart, E.; et al. Novel Chaphamaparvovirus in Insectivorous Molossus molossus Bats, from the Brazilian Amazon Region. Viruses 2023, 15, 606. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Altan, E.; Reyes, G.; Halstead, B.; Deng, X.; Delwart, E. Virome of Bat Guano from Nine Northern California Roosts. J. Virol. 2021, 95, e01713-20. [Google Scholar] [CrossRef] [Scilit]
- Palombieri, A.; Di Profio, F.; Lanave, G.; Capozza, P.; Marsilio, F.; Martella, V.; Di Martino, B. Molecular detection and characterization of Carnivore chaphamaparvovirus 1 in dogs. Vet. Microbiol. 2020, 251, 108878. [Google Scholar] [CrossRef] [Scilit]
- Alex, C.E.; Fahsbender, E.; Altan, E.; Bildfell, R.; Wolff, P.; Jin, L.; Black, W.; Jackson, K.; Woods, L.; Munk, B.; et al. Viruses in unexplained encephalitis cases in American black bears (Ursus americanus). PLoS ONE 2020, 15, e0244056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matos, M.; Bilic, I.; Viloux, N.; Palmieri, N.; Albaric, O.; Chatenet, X.; Tvarogová, J.; Dinhopl, N.; Heidl, S.; Liebhart, D.; et al. A novel Chaphamaparvovirus is the etiological agent of hepatitis outbreaks in pheasants (Phasianus colchicus) characterized by high mortality. Transbound. Emerg. Dis. 2022, 69, e2093–e2104. [Google Scholar] [CrossRef] [Scilit]
- Fujino, K.; Horie, M.; Aihara, N.; Kamiie, J.; Taharaguchi, S. Detection of chicken chapparvovirus 2 in chickens with hemorrhagic hepatitis in Japan. J. Vet. Med. Sci. 2024, 86, 396–399. [Google Scholar] [CrossRef] [Scilit]
- Edmondson, E.F.; Hsieh, W.T.; Kramer, J.A.; Breed, M.W.; Roelke-Parker, M.E.; Stephens-Devalle, J.; Pate, N.M.; Bassel, L.L.; Hollingshead, M.G.; Karim, B.O.; et al. Naturally Acquired Mouse Kidney Parvovirus Infection Produces a Persistent Interstitial Nephritis in Immunocompetent Laboratory Mice. Vet. Pathol. 2020, 57, 915–925. [Google Scholar] [CrossRef] [Scilit]
- Kailasan, S.; Halder, S.; Gurda, B.; Bladek, H.; Chipman, P.R.; McKenna, R.; Brown, K.; Agbandje-McKenna, M. Structure of an enteric pathogen, bovine parvovirus. J. Virol. 2015, 89, 2603–2614. [Google Scholar] [CrossRef] [Scilit]
- Pénzes, J.J.; Söderlund-Venermo, M.; Canuti, M.; Eis-Hübinger, A.M.; Hughes, J.; Cotmore, S.F.; Harrach, B. Reorganizing the family Parvoviridae: A revised taxonomy independent of the canonical approach based on host association. Arch. Virol. 2020, 165, 2133–2146. [Google Scholar] [CrossRef] [Scilit]

| Oligonucleotide | Position | Sequence (5′-3′) | Sense | Use | References |
|---|---|---|---|---|---|
| 2406 F Chap ErEu | 1949–1965 | GGCGTTTCTGTACCAAAGAGGAA | + | Screening qPCR | [21] |
| 2407 R Chap ErEu | 2039–2061 | GCATTTGCAGCGATGTTCACTAG | – | Screening qPCR | |
| 316 P Chap ErEu Pb | 2012–2037 | FAM-TGCATGATACTACCTTTCATTGCAGA-BHQ1 | + | Screening qPCR | |
| 2421 HhChPV F | 1124–1146 | TGGTAGAACAACCAGATCCGACT | + | Screening PCR | This study |
| 2410 HhChPV R | 2130–2152 | GTTGTTGTACGGGTTGTTCTCCT | – | Screening PCR | |
| 2535 HhChPV F | 334–356 | CTTCACGACAAGGTGAGGAGGAA | + | Sequencing | |
| 2537 HhChPV R | 1321–1294 | TGGCTTTTTCTAACTCTTGTTTCTGTCT | – | Sequencing | |
| 2416 HhChPV F | 1698–1719 | CGCTTTCCTGTCAGGGCTAAAA | + | Sequencing | |
| 2540 HhChPV F | 3217–3239 | TGCCAATCCACGAAATGTTTCCA | + | Sequencing | |
| 2424 HhChPV R | 3458–3431 | ACCACTTAGCAATTTGATCAAGATTAAA | – | Sequencing | |
| 2544 HhChPV R | 3907–3929 | TGGCATACACCTGTCTCCAAGAG | – | Sequencing |
| Hedgehog ID | Collection | Quantity (DNA Copies/g) | |||||
|---|---|---|---|---|---|---|---|
| Duodenum | Liver | Kidney | Spleen | Lung | Brain | ||
| #592-2019 | A | 3.01 × 105 | - | - | 3.57 × 102 | - | - |
| #618-2019 | A | 2.98 × 105 | - | 3.13 × 107 | 1.39 × 104 | - | - |
| #622-2019 | A | - | 1.29 × 103 | 2.72 × 103 | - | - | - |
| #1082-2021 | A | - | 6.67 × 102 | 3.08 × 105 | 7.23 × 103 | 8.27 × 102 | - |
| #328-2022 | A | 2.02 × 104 | - | 4.67 × 102 | - | - | - |
| #403-2022 | A | 7.87 × 102 | - | 3.03 × 103 | - | - | - |
| #458-2022 | A | 8.17 × 102 | - | 5.03 × 104 | - | - | - |
| #637-2022 | B | 6.70 × 104 | 3.73 × 105 | 1.21 × 108 | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Profio, F.; Di Martino, B.; Lanave, G.; Robetto, S.; Prandi, I.; Capucchio, M.T.; Mandola, M.L.; Quaranta, G.; Orusa, R.; Marsilio, F.; et al. European Hedgehogs as Hosts of Chaphamaparvovirus, Italy. Animals 2024, 14, 3624. https://doi.org/10.3390/ani14243624
Di Profio F, Di Martino B, Lanave G, Robetto S, Prandi I, Capucchio MT, Mandola ML, Quaranta G, Orusa R, Marsilio F, et al. European Hedgehogs as Hosts of Chaphamaparvovirus, Italy. Animals. 2024; 14(24):3624. https://doi.org/10.3390/ani14243624
Chicago/Turabian StyleDi Profio, Federica, Barbara Di Martino, Gianvito Lanave, Serena Robetto, Ilaria Prandi, Maria Teresa Capucchio, Maria Lucia Mandola, Giuseppe Quaranta, Riccardo Orusa, Fulvio Marsilio, and et al. 2024. "European Hedgehogs as Hosts of Chaphamaparvovirus, Italy" Animals 14, no. 24: 3624. https://doi.org/10.3390/ani14243624
APA StyleDi Profio, F., Di Martino, B., Lanave, G., Robetto, S., Prandi, I., Capucchio, M. T., Mandola, M. L., Quaranta, G., Orusa, R., Marsilio, F., Martella, V., & Sarchese, V. (2024). European Hedgehogs as Hosts of Chaphamaparvovirus, Italy. Animals, 14(24), 3624. https://doi.org/10.3390/ani14243624

