Embryonic Thermal Programming and Dietary Baicalein Supplementation Post-Hatch: Effects on Broiler Adipose Tissue Deposition
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chickens and Embryonic Heat Conditioning
2.2. Tissue Collection
2.3. Total RNA Extraction and cDNA Synthesis
2.4. Real-Time Quantitative PCR (RT-qPCR)
2.5. Plasma Non-Esterified Fatty Acid (NEFA) Collection
2.6. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Adipose Tissue Relative mRNA Expression
3.3. NEFA Concentration
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Park, A. Distinction of white, beige and brown adipocytes derived from mesenchymal stem cells. World J. Stem Cells 2014, 6, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Mellouk, N.; Ramé, C.; Barbe, A.; Grandhaye, J.; Froment, P.; Dupont, J. Chicken Is a Useful Model to Investigate the Role of Adipokines in Metabolic and Reproductive Diseases. Int. J. Endocrinol. 2018, 2018, 4579734. [Google Scholar] [CrossRef] [PubMed]
- Mellouk, N.; Ramé, C.; Delaveau, J.; Rat, C.; Maurer, E.; Froment, P.; Dupont, J. Adipokines expression profile in liver, adipose tissue and muscle during chicken embryo development. Gen. Comp. Endocrinol. 2018, 267, 146–156. [Google Scholar] [CrossRef] [PubMed]
- Abdullah, A.Y.; Al-Beitawi, N.A.; Rjoup, M.M.S.; Qudsieh, R.I.; Ishmais, M.A.A. Growth Performance, Carcass and Meat Quality Characteristics of Different Commercial Crosses of Broiler Strains of Chicken. J. Poult. Sci. 2010, 47, 13–21. [Google Scholar] [CrossRef]
- Mehaffey, J.M.; Pradhan, S.P.; Meullenet, J.F.; Emmert, J.L.; McKee, S.R.; Owens, C.M. Meat Quality Evaluation of Minimally Aged Broiler Breast Fillets from Five Commercial Genetic Strains. Poult. Sci. 2006, 85, 902–908. [Google Scholar] [CrossRef]
- Miller, M.; Gerval, A.; Hansen, J.; Grossen, G. Poultry Expected to Continue Leading Global Meat Imports as Demand Rises; Poultry & Eggs | USDA: Washington, DC, USA, 2022. [Google Scholar]
- Zuidhof, M.J.; Schneider, B.L.; Carney, V.L.; Korver, D.R.; Robinson, F.E. Growth, efficiency, and yield of commercial broilers from 1957, 1978, and 2005. Poult. Sci. 2014, 93, 2970–2982. [Google Scholar] [CrossRef]
- Suzuki, S.; Kobayashi, M.; Murai, A.; Tsudzuki, M.; Ishikawa, A. Characterization of Growth, Fat Deposition, and Lipid Metabolism-Related Gene Expression in Lean and Obese Meat-Type Chickens. J. Poult. Sci. 2019, 56, 101–111. [Google Scholar] [CrossRef]
- Chen, C.Y.; Huang, Y.F.; Ko, Y.J.; Liu, Y.J.; Chen, Y.H.; Walzem, R.L.; Chen, S.E. Obesity-associated cardiac pathogenesis in broiler breeder hens: Development of metabolic cardiomyopathy. Poult. Sci. 2017, 96, 2438–2446. [Google Scholar] [CrossRef]
- Bernardi, O.; Estienne, A.; Reverchon, M.; Bigot, Y.; Froment, P.; Dupont, J. Adipokines in metabolic and reproductive functions in birds: An overview of current knowns and unknowns. Mol. Cell. Endocrinol. 2021, 534, 111370. [Google Scholar] [CrossRef]
- Piestun, Y.; Halevy, O.; Yahav, S. Thermal manipulations of broiler embryos-The effect on thermoregulation and development during embryogenesis. Poult. Sci. 2009, 88, 2677–2688. [Google Scholar] [CrossRef]
- Tzschentke, B.; Basta, D. Early development of neuronal hypothalamic thermosensitivity in birds: Influence of epigenetic temperature adaptation. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2002, 131, 825–832. [Google Scholar] [CrossRef] [PubMed]
- Basaki, M.; Sahraiy, N.; Keykavusi, K.; Akbari, G.; Shahbazfar, A.A.; Kianifard, D. Differential expression of small heat shock proteins in the brain of broiler embryo; the effects of embryonic thermal manipulation. J. Therm. Biol. 2020, 93, 102719. [Google Scholar] [CrossRef] [PubMed]
- Rajkumar, U.; Vinoth, A.; Shanmugam, M.; Rajaravindra, K.S.; Rama Rao, S.V. Effect of embryonic thermal exposure on heat shock proteins (HSPs) gene expression and serum T3 concentration in two broiler populations. Anim. Biotechnol. 2015, 26, 260–267. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, U.; Vaughan, R.S.; Siegel, P.; Liu, D.; Gilbert, E.R.; Cline, M.A. Embryonic heat conditioning increases lipolytic gene expression in broiler chicks at day 4 post-hatch. Front. Physiol. 2024, 15, 1445569. [Google Scholar] [CrossRef]
- Zhao, Q.; Chen, X.-Y.; Martin, C. Scutellaria baicalensis, the golden herb from the garden of Chinese medicinal plants. Sci. Bull. (Beijing) 2016, 61, 1391–1398. [Google Scholar] [CrossRef] [PubMed]
- Bie, B.; Sun, J.; Guo, Y.; Li, J.; Jiang, W.; Yang, J.; Huang, C.; Li, Z. Baicalein: A review of its anti-cancer effects and mechanisms in Hepatocellular Carcinoma. Biomed. Pharmacother. 2017, 93, 1285–1291. [Google Scholar] [CrossRef]
- Shan, B.; Cai, Y.-Z.; Brooks, J.D.; Corke, H. The in vitro antibacterial activity of dietary spice and medicinal herb extracts. Int. J. Food Microbiol. 2007, 117, 112–119. [Google Scholar] [CrossRef]
- Schinella, G.R.; Tournier, H.A.; Prieto, J.M.; de Buschiazzo, P.M.; Ríos, J.L. Antioxidant activity of anti-inflammatory plant extracts. Life Sci. 2002, 70, 1023–1033. [Google Scholar] [CrossRef]
- Scheck, A.C.; Perry, K.; Hank, N.C.; Clark, W.D. Anticancer activity of extracts derived from the mature roots of Scutellaria baicalensis on human malignant brain tumor cells. BMC Complement. Altern. Med. 2006, 6, 27. [Google Scholar] [CrossRef]
- Lam, T.L.; Lam, M.L.; Au, T.K.; Ip, D.T.; Ng, T.B.; Fong, W.P.; Wan, D.C. A comparison of human immunodeficiency virus type-1 protease inhibition activities by the aqueous and methanol extracts of Chinese medicinal herbs. Life Sci. 2000, 67, 2889–2896. [Google Scholar] [CrossRef]
- Xiao, Y.; Halter, B.; Boyer, C.; Cline, M.A.; Liu, D.; Gilbert, E.R. Dietary Supplementation of Baicalein Affects Gene Expression in Broiler Adipose Tissue During the First Week Post-hatch. Front. Physiol. 2021, 12, 697384. [Google Scholar] [CrossRef] [PubMed]
- Al Amaz, S.; Shahid, M.A.H.; Jha, R.; Mishra, B. Pre-hatch thermal manipulation of embryos and post-hatch baicalein supplementation increased liver metabolism, and muscle proliferation in broiler chickens. Poult. Sci. 2024, 103, 104155. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Voy, B.H. Fighting fat with fat: N-3 polyunsaturated fatty acids and adipose deposition in broiler chickens. Front. Physiol. 2021, 12, 755317. [Google Scholar] [CrossRef] [PubMed]
- Matsubara, Y.; Sato, K.; Ishii, H.; Akiba, Y. Changes in mRNA expression of regulatory factors involved in adipocyte differentiation during fatty acid induced adipogenesis in chicken. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2005, 141, 108–115. [Google Scholar] [CrossRef] [PubMed]
- MacDougald, O.A.; Lane, M.D. Transcriptional regulation of gene expression during adipocyte differentiation. Annu. Rev. Biochem. 1995, 64, 345–373. [Google Scholar] [CrossRef]
- Cao, H.; Wen, Y.; Xu, X.; Liu, K.; Liu, H.; Tan, Y.; Zhou, W.; Mao, H.; Dong, X.; Xu, N.; et al. Investigation of the CEBPA gene expression pattern and association analysis of its polymorphisms with meat quality traits in chickens. Anim. Biotechnol. 2022, 33, 448–456. [Google Scholar] [CrossRef]
- Wang, G.; Kim, W.K.; Cline, M.A.; Gilbert, E.R. Factors affecting adipose tissue development in chickens: A review. Poult. Sci. 2017, 96, 3687–3699. [Google Scholar] [CrossRef]
- Sato, K.; Akiba, Y.; Chida, Y.; Takahashi, K. Lipoprotein hydrolysis and fat accumulation in chicken adipose tissues are reduced by chronic administration of lipoprotein lipase monoclonal antibodies. Poult. Sci. 1999, 78, 1286–1291. [Google Scholar] [CrossRef]
- Prasad, A.R.; Bhattacharya, T.K.; Chatterjee, R.N.; Divya, D.; Bhanja, S.K.; Shanmugam, M.; Sagar, N.G. Silencing acetyl-CoA carboxylase A and sterol regulatory element-binding protein 1 genes through RNAi reduce serum and egg cholesterol in chicken. Sci. Rep. 2022, 12, 1191. [Google Scholar] [CrossRef]
- Fu, R.Q.; Liu, R.R.; Zhao, G.P.; Zheng, M.Q.; Chen, J.L.; Wen, J. Expression profiles of key transcription factors involved in lipid metabolism in Beijing-You chickens. Gene 2014, 537, 120–125. [Google Scholar] [CrossRef]
- Ricoult, S.J.H.; Manning, B.D. The multifaceted role of mTORC1 in the control of lipid metabolism. EMBO Rep. 2013, 14, 242–251. [Google Scholar] [CrossRef] [PubMed]
- Newmyer, B.A.; Nandar, W.; Webster, R.I.; Gilbert, E.; Siegel, P.B.; Cline, M.A. Neuropeptide Y is associated with changes in appetite-associated hypothalamic nuclei but not food intake in a hypophagic avian model. Behav. Brain Res. 2013, 236, 327–331. [Google Scholar] [CrossRef] [PubMed]
- Serr, J.; Suh, Y.; Lee, K. Regulation of adipose triglyceride lipase by fasting and refeeding in avian species. Poult. Sci. 2009, 88, 2585–2591. [Google Scholar] [CrossRef] [PubMed]
- Stich, V.; Berlan, M. Physiological regulation of NEFA availability: Lipolysis pathway. Proc. Nutr. Soc. 2004, 63, 369–374. [Google Scholar] [CrossRef]
- Mancinelli, A.C.; Di Veroli, A.; Mattioli, S.; Cruciani, G.; Bosco, A.D.; Castellini, C. Lipid metabolism analysis in liver of different chicken genotypes and impact on nutritionally relevant polyunsaturated fatty acids of meat. Sci. Rep. 2022, 12, 1888. [Google Scholar] [CrossRef]
Gene | Sequences (Forward/Reverse) | Accession No. |
---|---|---|
β-actin | GTCCACCGCAAATGCTTCTAA/TGCGCATTTATGGGTTTTGTT | NM_205518.2 |
C/EBPα | CGCGGCAAATCCAAAAAG/GGCGCACGCGGTACTC | NM_001031459.2 |
C/EBPβ | GCCGCCCGCCTTTAAA/CCAAACAGTCCGCCTCGTAA | NM_205253.3 |
DGAT2 | TTGGCTTTGCTCCATGCAT/CCCACGTGTTCGAGGAGAA | XM_040661932.1 |
LPL | GACAGCTTGGCACAGTGCAA/CACCCATGGATCACCACAAA | NM_205282.2 |
PPARγ | CACTGCAGGAACAGAACAAAGAA/TCCACAGAGCGAAACTGACATC | NM_001001460.2 |
SREBP1 | CATCCATCAACGACAAGATCGT/CTCAGGATCGCCGACTTGTT | NM_204126.3 |
HSL | GCGGTGCTGAGGGAGTAC/CCCGAGACACCTCCCATAGA | XM_040657096.1 |
ATGL | GCCTCTGCGTAGGCCATGT/GCAGCCGGCGAAGGA | NM_001113291.2 |
MGLL | GCGGACGAGCGTAGACTCA/GGGAATAGCCTGGTTTGCAA | NM_001277142.2 |
NPY | CATGCAGGGCACCATGAG/CAGCGACAAGGCGAAAGTC | NM_205473.2 |
Effect 1 | C/EBPα | C/EBPβ | DGAT2 | LPL | PPARγ | SREBP1 | HSL | ATGL | MGLL | NPY |
---|---|---|---|---|---|---|---|---|---|---|
Treatment | ||||||||||
CC | 0.96 ± 0.12 | 1.03 ± 0.07 | 1.13 ± 0.15 | 0.95 ± 0.11 | 0.94 ± 0.07 | 0.96 ± 0.15 | 0.95 ± 0.16 | 1.01 ± 0.13 | 0.94 ± 0.11 | 1.16 ± 0.23 |
CT | 1.32 ± 0.11 | 0.99 ± 0.07 | 1.14 ± 0.15 | 1.29 ± 0.09 | 1.21 ± 0.07 | 1.40 ± 0.14 | 1.49 ± 0.15 | 1.41 ± 0.12 | 1.31 ± 0.10 | 1.39 ± 0.23 |
p-value | 0.0399 | 0.6095 | 0.4167 | 0.0216 | 0.0095 | 0.0374 | 0.0226 | 0.0395 | 0.0217 | 0.4773 |
Depot | ||||||||||
Subcutaneous | 1.10 ± 0.12 | 0.99 ± 0.07 | 1.00 ± 0.15 | 1.08 ± 0.11 | 1.08 ± 0.08 | 1.12 ± 0.15 | 1.16 ± 0.17 | 1.15 ± 0.14 | 1.27 ± 0.12 | 1.12 ± 0.24 |
Abdominal | 1.29 ± 0.12 | 1.03 ± 0.07 | 1.27 ± 0.15 | 1.20 ± 0.11 | 1.07 ± 0.08 | 1.28 ± 0.15 | 1.44 ± 0.17 | 1.32 ± 0.14 | 1.10 ± 0.12 | 1.43 ± 0.24 |
p-value | 0.2783 | 0.6971 | 0.9469 | 0.4616 | 0.8957 | 0.4685 | 0.2552 | 0.3835 | 0.2901 | 0.3645 |
Treatment × Depot | 0.1514 | 0.9899 | 0.2729 | 0.4185 | 0.8466 | 0.5333 | 0.1591 | 0.4876 | 0.2760 | 0.7104 |
Effect 1 | C/EBPα | C/EBPβ | DGAT2 | LPL | PPARγ | SREBP1 | HSL | ATGL | MGLL | NPY |
---|---|---|---|---|---|---|---|---|---|---|
Treatment | ||||||||||
EC | 1.36 ± 0.11 | 1.13 ± 0.06 | 0.84 ± 0.11 | 0.99 ± 0.13 | 0.83 ± 0.08 | 1.31 ± 0.16 | 1.21 ± 0.24 | 1.01 ± 0.16 | 1.01 ± 0.13 | 1.28 ± 0.19 |
ET | 0.99 ± 0.14 | 0.95 ± 0.06 | 1.23 ± 0.12 | 1.07 ± 0.13 | 1.14 ± 0.08 | 1.38 ± 0.16 | 1.92 ± 0.23 | 1.19 ± 0.15 | 1.39 ± 0.12 | 0.71 ± 0.20 |
p-value | 0.0467 | 0.0150 | 0.0284 | 0.6963 | 0.0128 | 0.7538 | 0.0442 | 0.4338 | 0.0457 | 0.0500 |
Depot | ||||||||||
Subcutaneous | 1.13 ± 0.10 | 0.95 ± 0.08 | 0.89 ± 0.12 | 0.99 ± 0.12 | 0.94 ± 0.09 | 1.08 ± 0.14 | 1.66 ± 0.36 | 1.08 ± 0.15 | 1.24 ± 0.14 | 1.42 ± 0.24 |
Abdominal | 1.49 ± 0.10 | 1.12 ± 0.08 | 1.13 ± 0.13 | 1.07 ± 0.12 | 1.06 ± 0.10 | 1.62 ± 0.14 | 1.96 ± 0.36 | 1.14 ± 0.16 | 1.20 ± 0.14 | 0.90 ± 0.24 |
p-value | 0.0167 | 0.0191 | 0.1956 | 0.7017 | 0.3760 | 0.0107 | 0.05659 | 0.7718 | 0.8551 | 0.1379 |
Treatment × Depot | 0.8955 | 0.1710 | 0.6911 | 0.6261 | 0.7907 | 0.6097 | 0.3936 | 0.3739 | 0.9966 | 0.4167 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sulaiman, U.; Vaughan, R.; Siegel, P.; Liu, D.; Gilbert, E.; Cline, M. Embryonic Thermal Programming and Dietary Baicalein Supplementation Post-Hatch: Effects on Broiler Adipose Tissue Deposition. Animals 2024, 14, 3563. https://doi.org/10.3390/ani14243563
Sulaiman U, Vaughan R, Siegel P, Liu D, Gilbert E, Cline M. Embryonic Thermal Programming and Dietary Baicalein Supplementation Post-Hatch: Effects on Broiler Adipose Tissue Deposition. Animals. 2024; 14(24):3563. https://doi.org/10.3390/ani14243563
Chicago/Turabian StyleSulaiman, Usman, Reagan Vaughan, Paul Siegel, Dongmin Liu, Elizabeth Gilbert, and Mark Cline. 2024. "Embryonic Thermal Programming and Dietary Baicalein Supplementation Post-Hatch: Effects on Broiler Adipose Tissue Deposition" Animals 14, no. 24: 3563. https://doi.org/10.3390/ani14243563
APA StyleSulaiman, U., Vaughan, R., Siegel, P., Liu, D., Gilbert, E., & Cline, M. (2024). Embryonic Thermal Programming and Dietary Baicalein Supplementation Post-Hatch: Effects on Broiler Adipose Tissue Deposition. Animals, 14(24), 3563. https://doi.org/10.3390/ani14243563