Comparison of Development and Antioxidative Ability in Fertilized Crossbred (Yorkshire × Landrace × Duroc) Oocytes Using Duroc and Landrace Sperm
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Sperm Characteristics
2.3. In Vtiro Fertilization (IVF)
2.4. Detection of Intracellular H2O2 and GSH in Embryos
2.5. Gene Analysis
2.6. Blastocyst Cell Number
2.7. Statistical Analysis
3. Results
3.1. Comparison of Sperm Characteristics Between Duroc and Landrace Sperm
3.2. Comparison of Fertility and Blastocyst Formation in Fertilized Crossbred Oocytes with Duroc and Landrace Sperm
3.3. Evaluation of Antioxidative Enzyme Genes, Intracellular H2O2, and GSH in Fertilized Crossbred Oocytes by Duroc and Landrace Sperm
3.4. Differential Gene Expression in Fertilized Crossbred Oocytes with Duroc and Landrace Sperm
3.5. Evaluation of Blastocyst Cell Numbers in In Vitro Produced Embryos
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Samorè, A.B.; Fontanesi, L. Genomic selection in pigs: State of the art and perspectives. Ital. J. Anim. Sci. 2016, 15, 211–232. [Google Scholar] [CrossRef]
- Lunney, J.K.; Van Goor, A.; Walker, K.E.; Hailstock, T.; Franklin, J.; Dai, C. Importance of the pig as a human biomedical model. Sci. Transl. Med. 2021, 13, eabd5758. [Google Scholar] [CrossRef] [PubMed]
- Benjamin, M.; Yik, S. Precision livestock farming in swine welfare: A review for swine practitioners. Animals 2019, 9, 133. [Google Scholar] [CrossRef] [PubMed]
- Lopez, B.I.M.; Song, C.; Seo, K. Genetic parameters and trends for production traits and their relationship with litter traits in Landrace and Yorkshire pigs. Anim. Sci. J. 2018, 89, 1381–1388. [Google Scholar] [CrossRef]
- Zhang, S.; Zhang, J.; Olasege, B.S.; Ma, P.; Qiu, X.; Gao, H.; Wang, C.; Wang, Y.; Zhang, Q.; Yang, H. Estimation of genetic parameters for reproductive traits in connectedness groups of Duroc, Landrace and Yorkshire pigs in China. J. Anim. Breed. Genet. 2020, 137, 211–222. [Google Scholar] [CrossRef]
- Ogawa, S.; Konta, A.; Kimata, M.; Ishii, K.; Uemoto, Y.; Satoh, M. Estimation of genetic parameters for farrowing traits in purebred Landrace and Large White pigs. Anim. Sci. J. 2019, 90, 23–28. [Google Scholar] [CrossRef]
- Ding, R.; Quan, J.; Yang, M.; Wang, X.; Zheng, E.; Yang, H.; Fu, D.; Yang, Y.; Yang, L.; Li, Z. Genome-wide association analysis reveals genetic loci and candidate genes for feeding behavior and eating efficiency in Duroc boars. PLoS ONE 2017, 12, e0183244. [Google Scholar] [CrossRef]
- Tang, Z.; Yin, L.; Yin, D.; Zhang, H.; Fu, Y.; Zhou, G.; Zhao, Y.; Wang, Z.; Liu, X.; Li, X. Development and application of an efficient genomic mating method to maximize the production performances of three-way crossbred pigs. Brief. Bioinf. 2023, 24, bbac587. [Google Scholar] [CrossRef]
- Fernández-López, P.; Garriga, J.; Casas, I.; Yeste, M.; Bartumeus, F. Predicting fertility from sperm motility landscapes. Commun. Biol. 2022, 5, 1027. [Google Scholar] [CrossRef]
- Myromslien, F.D.; Tremoen, N.H.; Andersen-Ranberg, I.; Fransplass, R.; Stenseth, E.B.; Zeremichael, T.T.; van Son, M.; Grindflek, E.; Gaustad, A.H. Sperm DNA integrity in Landrace and Duroc boar semen and its relationship to litter size. Reprod. Domest. Anim. 2019, 54, 160–166. [Google Scholar] [CrossRef]
- Barquero, V.; Roldan, E.R.; Soler, C.; Yániz, J.L.; Camacho, M.; Valverde, A. Predictive capacity of boar sperm morphometry and morphometric sub-populations on reproductive success after artificial insemination. Animals 2021, 11, 920. [Google Scholar] [CrossRef] [PubMed]
- Van Voorhis, B.J. In vitro fertilization. N. Engl. J. Med. 2007, 356, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Dhillon, R.; McLernon, D.; Smith, P.; Fishel, S.; Dowell, K.; Deeks, J.; Bhattacharya, S.; Coomarasamy, A. Predicting the chance of live birth for women undergoing IVF: A novel pretreatment counselling tool. Hum. Reprod. 2016, 31, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska-Nitsche, K.; Chan, A.W. Effect of sperm entry on blastocyst development after in vitro fertilization and intracytoplasmic sperm injection—Mouse model. J. Assist. Reprod. Genet. 2013, 30, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Catalá, M.G.; Izquierdo, D.; Rodríguez-Prado, M.; Hammami, S.; Paramio, M.-T. Effect of oocyte quality on blastocyst development after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) in a sheep model. Fertil. Steril. 2012, 97, 1004–1008. [Google Scholar] [CrossRef]
- Sirard, M.-A. 40 years of bovine IVF in the new genomic selection context. Reproduction 2018, 156, R1–R7. [Google Scholar] [CrossRef]
- Gil, M.; Cuello, C.; Parrilla, I.; Vazquez, J.; Roca, J.; Martinez, E. Advances in swine in vitro embryo production technologies. Reprod. Domest. Anim. 2010, 45, 40–48. [Google Scholar] [CrossRef]
- Nguyen, B.X.; Kikuchi, K.; Uoc, N.T.; Dang-Nguyen, T.Q.; Linh, N.V.; Men, N.T.; Nguyen, T.T.; Nagai, T. Production of B an miniature pig embryos by in vitro fertilization: A comparative study with L andrace. Anim. Sci. J. 2015, 86, 487–493. [Google Scholar] [CrossRef]
- Fowler, K.E.; Mandawala, A.A.; Griffin, D.K.; Walling, G.A.; Harvey, S.C. The production of pig preimplantation embryos in vitro: Current progress and future prospects. Reprod. Biol. 2018, 18, 203–211. [Google Scholar] [CrossRef]
- Jochems, R.; Gaustad, A.H.; Zak, L.J.; Grindflek, E.; Zeremichael, T.T.; Oskam, I.C.; Myromslien, F.D.; Kommisrud, E.; Krogenæs, A.K. Effect of two ‘progressively motile sperm–oocyte’ratios on porcine in vitro fertilization and embryo development. Zygote 2022, 30, 543–549. [Google Scholar] [CrossRef]
- Schulze, M.; Buder, S.; Rüdiger, K.; Beyerbach, M.; Waberski, D. Influences on semen traits used for selection of young AI boars. Anim. Reprod. Sci. 2014, 148, 164–170. [Google Scholar] [CrossRef] [PubMed]
- Jiesisibieke, D.; Tian, T.; Zhu, X.; Fang, S.; Zhang, N.; Ma, J.; Xia, Y.; Li, R.; Liu, P.; Qiao, J. Reproductive Outcomes of Conventional In Vitro Fertilization and Intracytoplasmic Sperm Injection in Patients with Non-Severe MaleInfertility Across Poor and Different Sub-Optimal Ovarian Response Categories: A Cohort Study Based on 30,352 Fresh Cycles from 2009–2019. Reprod. Sci. 2024, 31, 1353–1362. [Google Scholar] [PubMed]
- Dcunha, R.; Hussein, R.S.; Ananda, H.; Kumari, S.; Adiga, S.K.; Kannan, N.; Zhao, Y.; Kalthur, G. Current insights and latest updates in sperm motility and associated applications in assisted reproduction. Reprod. Sci. 2022, 29, 7–25. [Google Scholar] [CrossRef] [PubMed]
- Dordas-Perpinyà, M.; Yanez-Ortiz, I.; Sergeant, N.; Mevel, V.; Bruyas, J.-F.; Catalán, J.; Delehedde, M.; Briand-Amirat, L.; Miró, J. ProAKAP4 concentration is related to sperm motility and motile sperm subpopulations in frozen–thawed horse semen. Animals 2022, 12, 3417. [Google Scholar] [CrossRef]
- Li, J.; Li, Y.; Cheng, M.; Ye, F.; Li, W.; Wang, C.; Huang, Y.; Wu, Y.; Xuan, R.; Liu, G. Gut microbial diversity among Yorkshire, Landrace and Duroc boars and its impact on semen quality. AMB Express 2022, 12, 158. [Google Scholar] [CrossRef]
- Barranco, I.; Rubio, C.P.; Tvarijonaviciute, A.; Rodriguez-Martinez, H.; Roca, J. Measurement of oxidative stress index in seminal plasma can predict in vivo fertility of liquid-stored porcine artificial insemination semen doses. Antioxidants 2021, 10, 1203. [Google Scholar] [CrossRef]
- Hu, J.; Cheng, D.; Gao, X.; Bao, J.; Ma, X.; Wang, H. Vitamin C enhances the in vitro development of porcine pre-implantation embryos by reducing oxidative stress. Reprod. Domest. Anim. 2012, 47, 873–879. [Google Scholar] [CrossRef]
- Truong, T.; Gardner, D. Antioxidants improve IVF outcome and subsequent embryo development in the mouse. Hum. Reprod. 2017, 32, 2404–2413. [Google Scholar] [CrossRef]
- Jochems, R.; Gaustad, A.H.; Styrishave, B.; Zak, L.J.; Oskam, I.C.; Grindflek, E.; Myromslien, F.D.; Kommisrud, E.; Krogenæs, A.K. Follicular fluid steroid hormones and in vitro embryo development in Duroc and Landrace pigs. Theriogenology 2022, 190, 15–21. [Google Scholar] [CrossRef]
- Kim, B.; Min, Y.; Jeong, Y.; Ramani, S.; Lim, H.; Jo, Y.; Kim, W.; Choi, Y.; Park, S. Comparison of growth performance and related gene expression of muscle and fat from Landrace, Yorkshire, and Duroc and Woori black pigs. J. Anim. Sci. Technol. 2023, 65, 160. [Google Scholar] [CrossRef]
- Lee, S.-H.; Park, C.-K. Effect of magnetized extender on sperm membrane integrity and development of oocytes in vitro fertilized with liquid storage boar semen. Anim. Reprod. Sci. 2015, 154, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.-S.; Lee, S.-H.; Lee, S.; Yang, B.-K. Effects of curcumin on sperm motility, viability, mitochondrial activity and plasma membrane integrity in boar semen. Biomed. Sci. Lett. 2017, 23, 406–410. [Google Scholar] [CrossRef]
- Silva, P.; Gadella, B. Detection of damage in mammalian sperm cells. Theriogenology 2006, 65, 958–978. [Google Scholar] [CrossRef] [PubMed]
- Papaioannou, K.; Murphy, R.; Monks, R.; Hynes, N.; Ryan, M.; Boland, M.; Roche, J. Assessment of viability and mitochondrial function of equine spermatozoa using double staining and flow cytometry. Theriogenology 1997, 48, 299–312. [Google Scholar] [CrossRef]
- Lee, Y.-J.; Kim, Y.-J.; Lee, S.-H.; Cheong, H.-T.; Yang, B.-K.; Park, C.-K. Effect of washing culture oil on in vitro development in porcine embryos. Reprod. Dev. Biol. 2014, 38, 93–98. [Google Scholar] [CrossRef]
- Park, J.-E.; Lee, S.-H.; Hwangbo, Y.; Park, C.-K. Porcine follicular fluid derived from> 8 mm sized follicles improves oocyte maturation and embryo development during in vitro maturation of pigs. Zygote 2021, 29, 27–32. [Google Scholar] [CrossRef]
- Yao, X.; Jiang, H.; NanXu, Y.; Piao, X.; Gao, Q.; Kim, N.-H. Kaempferol attenuates mitochondrial dysfunction and oxidative stress induced by H2O2 during porcine embryonic development. Theriogenology 2019, 135, 174–180. [Google Scholar] [CrossRef]
- Zak, L.J.; Gaustad, A.H.; Bolarin, A.; Broekhuijse, M.L.; Walling, G.A.; Knol, E.F. Genetic control of complex traits, with a focus on reproduction in pigs. Mol. Reprod. Dev. 2017, 84, 1004–1011. [Google Scholar] [CrossRef]
- Terada, K.; Ohtani, T.; Ogawa, S.; Hirooka, H. Genetic parameters for carcass and meat quality traits in Jinhua, Duroc, and their crossbred pigs. J. Anim. Breed. Genet. 2024, 141, 33–41. [Google Scholar] [CrossRef]
- Barquero, V.; Soler, C.; Sevilla, F.; Calderón-Calderón, J.; Valverde, A. A Bayesian analysis of boar spermatozoa kinematics and head morphometrics and their relationship with litter size fertility variables. Reprod. Domest. Anim. 2021, 56, 1024–1033. [Google Scholar] [CrossRef]
- Dang-Nguyen, T.Q.; Kikuchi, K.; Somfai, T.; Ozawa, M.; Nakai, M.; Maedomari, N.; Viet-Linh, N.; Kanai, Y.; Nguyen, B.X.; Nagai, T. Evaluation of developmental competence of in vitro-produced porcine embryos based on the timing, pattern and evenness of the first cleavage and onset of the second cleavage. J. Reprod. Dev. 2010, 56, 593–600. [Google Scholar] [CrossRef] [PubMed]
- Isom, S.C.; Li, R.F.; Whitworth, K.M.; Prather, R.S. Timing of first embryonic cleavage is a positive indicator of the in vitro developmental potential of porcine embryos derived from in vitro fertilization, somatic cell nuclear transfer and parthenogenesis. Mol. Reprod. Dev. 2012, 79, 197–207. [Google Scholar] [CrossRef] [PubMed]
- Leite, R.F.; Annes, K.; Ispada, J.; De Lima, C.B.; Dos Santos, É.C.; Fontes, P.K.; Nogueira, M.F.G.; Milazzotto, M.P. Oxidative stress alters the profile of transcription factors related to early development on in vitro produced embryos. Oxid. Med. Cell. Longev. 2017, 2017, 1502489. [Google Scholar] [CrossRef] [PubMed]
- Ufer, C.; Wang, C.C. The roles of glutathione peroxidases during embryo development. Front. Mol. Neurosci. 2011, 4, 11531. [Google Scholar] [CrossRef]
- Takahashi, M. Oxidative stress and redox regulation on in vitro development of mammalian embryos. J. Reprod. Dev. 2012, 58, 1–9. [Google Scholar] [CrossRef]
- Joo, Y.E.; Jeong, P.-S.; Lee, S.; Jeon, S.-B.; Gwon, M.-A.; Kim, M.J.; Kang, H.-G.; Song, B.-S.; Kim, S.-U.; Cho, S.-K. Anethole improves the developmental competence of porcine embryos by reducing oxidative stress via the sonic hedgehog signaling pathway. J. Anim. Sci. Biotechnol. 2023, 14, 32. [Google Scholar] [CrossRef]
- Padgett, J.; Santos, S.D. From clocks to dominoes: Lessons on cell cycle remodelling from embryonic stem cells. FEBS Lett. 2020, 594, 2031–2045. [Google Scholar] [CrossRef]
- Kim, S.-H.; Choi, K.-H.; Lee, M.; Lee, D.-K.; Lee, C.-K. Porcine OCT4 reporter system can monitor species-specific pluripotency during somatic cell reprogramming. Cell. Reprogram. 2021, 23, 168–179. [Google Scholar] [CrossRef]
- Santamaría, D.; Barrière, C.; Cerqueira, A.; Hunt, S.; Tardy, C.; Newton, K.; Cáceres, J.F.; Dubus, P.; Malumbres, M.; Barbacid, M. Cdk1 is sufficient to drive the mammalian cell cycle. Nature 2007, 448, 811–815. [Google Scholar] [CrossRef]
Genes | Sequence (5′–3′) | Annealing Temp. (°C) | Cycle | Product Size (bp) | Accession No. |
---|---|---|---|---|---|
Oct4 | F: AAGCAGTGACTATTCGCAAC | 60 | 40 | 136 | NM_001113060.1 |
R: CAGGGTGGTGAAGTGAGG | |||||
Nanog | F: TTCCTTCCTCCATGGATCTG | 60 | 40 | 214 | NM_001129971.1 |
R: ATCTGCTGGAGGCTGAGGTA | |||||
Sox2 | F: CGCAGACCTACATGAACG | 60 | 40 | 103 | NM_001123197.1 |
R: TCGGACTTGACCACTGAG | |||||
SOD1 | F: TGCAGGTCCTCACTTCAATC | 60 | 40 | 257 | NM_001190422.1 |
R: CCAAACGACTTCCAGCATTTC | |||||
SOD2 | F: GTTGGCTCGGTTTCAACAAG | 60 | 40 | 212 | NM_214127.2 |
R: GGCGTATCGCTCAGTTACAT | |||||
CAT | F: CGAAGGCGAAGGTGTTTG | 52 | 40 | 374 | NM_214301.2 |
R: AGTGTGCGATCCATATCC | |||||
GPx1 | F: GGACTACACCCAGATGAATGAG | 60 | 40 | 216 | NM_214201.1 |
R: AAGAGCGGGTGAGCATTT | |||||
Bax | F: CTCAGGATGCATCTACCAAGAA | 60 | 40 | 213 | XM_003127290.5 |
R: GCACCAGTTTACTGGCAAAG | |||||
Bcl-2 | F: AACTTGGATGGCCACTTACC | 60 | 40 | 199 | NM_214285.1 |
R: TTTCCGACTGAAGAGCGAAC | |||||
Cdc2 | F: GGTGTTCCTAGTACTGCCATTC | 60 | 40 | 179 | NM_001159304.2 |
R: GAATCCATGAACTGACCAGGAG | |||||
CCNB1 | F: GTGTCAGGCTTTCTCTGATGT | 62 | 40 | 199 | NM_001170768.1 |
R: CCAGTCAATTAGGATGGCTCTC | |||||
β-actin | F: GGACTTCGAGCAGGAGATGG | 60 | 40 | 233 | XM_003124280 |
R: GCACCGTGTTGGCGTAGAGG |
Group | No. of Oocytes | Cleavage (%) | No. of Embryo Development to (%) | ||||
---|---|---|---|---|---|---|---|
2 Cell | 4 Cell | 8 Cell | >16 Cell | Blastocyst | |||
DS+YLDO 1 | 537 | 460 (84.83 ± 3.64) | 29 (5.78 ± 1.14) | 19 (3.38 ± 0.47) | 86 (16.02 ± 3.38) | 258 (48.28 ± 5.83) | 68 (15.18 ± 3.64) |
LS+YLDO 2 | 554 | 470 (84.4 ± 3.09) | 25 (4.54 ± 0.97) | 34 (6.44 ± 1.16) * | 80 (13.38 ± 3.53) | 225 (42.63 ± 5.15) | 106 (17.41 ± 3.54) * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, H.; Kim, H.; An, J.; Cheong, H.-T.; Lee, S.-H. Comparison of Development and Antioxidative Ability in Fertilized Crossbred (Yorkshire × Landrace × Duroc) Oocytes Using Duroc and Landrace Sperm. Animals 2024, 14, 3562. https://doi.org/10.3390/ani14243562
Lee H, Kim H, An J, Cheong H-T, Lee S-H. Comparison of Development and Antioxidative Ability in Fertilized Crossbred (Yorkshire × Landrace × Duroc) Oocytes Using Duroc and Landrace Sperm. Animals. 2024; 14(24):3562. https://doi.org/10.3390/ani14243562
Chicago/Turabian StyleLee, Hayoung, Hyewon Kim, Jisoon An, Hee-Tae Cheong, and Sang-Hee Lee. 2024. "Comparison of Development and Antioxidative Ability in Fertilized Crossbred (Yorkshire × Landrace × Duroc) Oocytes Using Duroc and Landrace Sperm" Animals 14, no. 24: 3562. https://doi.org/10.3390/ani14243562
APA StyleLee, H., Kim, H., An, J., Cheong, H.-T., & Lee, S.-H. (2024). Comparison of Development and Antioxidative Ability in Fertilized Crossbred (Yorkshire × Landrace × Duroc) Oocytes Using Duroc and Landrace Sperm. Animals, 14(24), 3562. https://doi.org/10.3390/ani14243562