Occurrence and Genotypic Identification of Blastocystis spp. and Enterocytozoon bieneusi in Bamaxiang Pigs in Bama Yao Autonomous County of Guangxi Province, China
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fecal Sample Collection
2.2. DNA Extraction
2.3. PCR Amplification
2.4. Sequencing and Phylogenetic Analysis
2.5. Statistical Analysis
3. Results
3.1. Occurrence of Blastocystis spp. and E. bieneusi
3.2. Distributions of Blastocystis spp. Subtypes
3.3. Genotypes of E. bieneusi
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, W.; Bielefeldt-Ohmann, H.; Traub, R.J.; Cuttell, L.; Owen, H. Location and pathogenic potential of Blastocystis in the porcine intestine. PLoS ONE 2014, 9, e103962. [Google Scholar] [CrossRef] [PubMed]
 - Santín, M.; Fayer, R. Microsporidiosis: Enterocytozoon bieneusi in domesticated and wild animals. Res. Vet. Sci. 2011, 90, 363–371. [Google Scholar] [CrossRef] [PubMed]
 - Hu, Y.; Feng, Y.; Huang, C.; Xiao, L. Occurrence, source, and human infection potential of Cryptosporidium and Enterocytozoon bieneusi in drinking source water in Shanghai, China, during a pig carcass disposal incident. Environ. Sci. Technol. 2014, 48, 14219–14227. [Google Scholar] [CrossRef] [PubMed]
 - Rojas-Velázquez, L.; Morán, P.; Serrano-Vázquez, A.; Portillo-Bobadilla, T.; González, E.; Pérez-Juárez, H.; Hernández, E.; Partida-Rodríguez, O.; Nieves-Ramírez, M.; Padilla, A.; et al. The regulatory function of Blastocystis spp. on the immune inflammatory response in the gut microbiome. Front. Cell. Infect. Microbiol. 2022, 12, 967724. [Google Scholar] [CrossRef]
 - Han, B.; Pan, G.; Weiss, L.M. Microsporidiosis in Humans. Clin. Microbiol. Rev. 2021, 34, e0001020. [Google Scholar] [CrossRef]
 - Li, W.; Xiao, L. Ecological and public health significance of Enterocytozoon bieneusi. One Health 2021, 12, 100209. [Google Scholar] [CrossRef]
 - Jiang, S.; Yu, S.; Feng, Y.; Zhang, L.; Santin, M.; Xiao, L.; Li, W. Widespread distribution of human-infective Enterocytozoon bieneusi genotypes in small rodents in northeast China and phylogeny and zoonotic implications revisited. Acta Trop. 2024, 253, 107160. [Google Scholar] [CrossRef]
 - Yang, J.; Song, M.; Wan, Q.; Li, Y.; Lu, Y.; Jiang, Y.; Tao, W.; Li, W. Enterocytozoon bieneusi genotypes in children in Northeast China and assessment of risk of zoonotic transmission. J. Clin. Microbiol. 2014, 52, 4363–4367. [Google Scholar] [CrossRef]
 - Zhao, W.; Wang, Y.; Xin, X.; Liu, J.; Zhang, X.; Yan, B.; Liang, S. Investigating Enterocytozoon bieneusi in pigs farmed in Zhejiang Province, China: Occurrence, genotype identification, evolutionary analysis, and zoonotic risk assessment. Vet. J. 2024, 306, 106191. [Google Scholar] [CrossRef]
 - Dashti, A.; Santín, M.; Köster, P.C.; Bailo, B.; Ortega, S.; Imaña, E.; Habela, M.Á.; Rivero-Juarez, A.; Vicente, J.; WE&H Group; et al. Zoonotic Enterocytozoon bieneusi genotypes in free-ranging and farmed wild ungulates in Spain. Med. Mycol. 2022, 60, myac070. [Google Scholar] [CrossRef]
 - Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and Public Health Implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef] [PubMed]
 - Taghipour, A.; Bahadory, S.; Khazaei, S.; Zaki, L.; Ghaderinezhad, S.; Sherafati, J.; Abdoli, A. Global molecular epidemiology of microsporidia in pigs and wild boars with emphasis on Enterocytozoon bieneusi: A systematic review and meta-analysis. Vet. Med. Sci. 2022, 8, 1126–1136. [Google Scholar] [CrossRef] [PubMed]
 - Li, D.F.; Zhang, Y.; Jiang, Y.X.; Xing, J.M.; Tao, D.Y.; Zhao, A.Y.; Cui, Z.H.; Jing, B.; Qi, M.; Zhang, L.X. Genotyping and Zoonotic Potential of Enterocytozoon bieneusi in Pigs in Xinjiang, China. Front. Microbiol. 2019, 10, 2401. [Google Scholar] [CrossRef] [PubMed]
 - Li, W.; Xiao, L. Multilocus Sequence Typing and Population Genetic Analysis of Enterocytozoon bieneusi: Host Specificity and Its Impacts on Public Health. Front. Genet. 2019, 10, 307. [Google Scholar] [CrossRef]
 - Santin, M.; Figueiredo, A.; Molokin, A.; George, N.S.; Köster, P.C.; Dashti, A.; González-Barrio, D.; Carmena, D.; Maloney, J.G. Division of Blastocystis ST10 into three new subtypes: ST42-ST44. J. Eukaryot. Microbiol. 2024, 71, e12998. [Google Scholar] [CrossRef]
 - Heydarian, M.; Manouchehri Naeini, K.; Kheiri, S.; Abdizadeh, R. Prevalence and subtyping of Blastocystis sp. in ruminants in Southwestern, Iran. Sci. Rep. 2024, 14, 20254. [Google Scholar] [CrossRef]
 - Marangi, M.; Boughattas, S.; De Nittis, R.; Pisanelli, D.; Delli Carri, V.; Lipsi, M.R.; La Bella, G.; Serviddio, G.; Niglio, M.; Lo Caputo, S.; et al. Prevalence and genetic diversity of Blastocystis sp. among autochthonous and immigrant patients in Italy. Microb. Pathog. 2023, 185, 106377. [Google Scholar] [CrossRef]
 - Wang, J.; Wang, Y.; Huang, W.; Zhang, T.; Yu, K.; Chen, J.; Zhou, L.; Cao, W.; Xu, J.; Ma, J.; et al. Molecular prevalence, subtype distribution, and zoonotic potential of Blastocystis sp. in wild rodents and shrews inhabiting Zhejiang province of China. Front. Vet. Sci. 2024, 11, 1427490. [Google Scholar] [CrossRef]
 - Asghari, A.; Sadrebazzaz, A.; Shamsi, L.; Shams, M. Global prevalence, subtypes distribution, zoonotic potential, and associated risk factors of Blastocystis sp. in domestic pigs (Sus domesticus) and wild boars (Sus scrofa): A systematic review and meta-analysis. Microb. Pathog. 2021, 160, 105183. [Google Scholar] [CrossRef]
 - Zou, Y.; Yang, W.B.; Zou, F.C.; Lin, R.Q.; Zhu, X.Q.; Hou, J.L. Molecular detection and subtype distribution of Blastocystis in farmed pigs in southern China. Microb. Pathog. 2021, 151, 104751. [Google Scholar] [CrossRef]
 - Gong, H.; Xiao, S.; Li, W.; Huang, T.; Huang, X.; Yan, G.; Huang, Y.; Qiu, H.; Jiang, K.; Wang, X.; et al. Unravelling the genetic loci for growth and carcass traits in Chinese Bamaxiang pigs based on a 1.4 million SNP array. J. Anim. Breed. Genet. 2019, 136, 3–14. [Google Scholar] [CrossRef] [PubMed]
 - Yang, H.; Xu, X.L.; Xu, D.; Ma, H.M.; Li, L.L. The complete sequence of mitochondrial genome of Bama miniature pig (Sus scrofa). Mitochondrial DNA 2016, 27, 238–239. [Google Scholar] [CrossRef] [PubMed]
 - Yu, Y.; Cheng, Y.; Pan, Q.; Zhang, Y.J.; Jia, D.G.; Liu, Y.F. Effect of the selective NLRP3 inflammasome inhibitor mcc950 on transplantation outcome in a pig liver transplantation model with organs from donors after circulatory death preserved by hypothermic machine perfusion. Transplantation 2019, 103, 353–362. [Google Scholar] [CrossRef] [PubMed]
 - Wang, P.; Li, S.; Zou, Y.; Hong, Z.W.; Wang, P.; Zhu, X.Q.; Song, D.P.; Chen, X.Q. Prevalence and subtype distribution of Blastocystis sp. in diarrheic pigs in Southern China. Pathogens 2021, 10, 1189. [Google Scholar] [CrossRef]
 - Yu, X.; Wang, H.; Li, Y.; Mu, X.; Yuan, K.; Wu, A.; Guo, J.; Hong, Y.; Zhang, H. Occurrence and genotypic identification of Blastocystis spp., Enterocytozoon bieneusi, and Giardia duodenalis in Leizhou Black Goats in Zhanjiang City, Guangdong Province, China. Animals 2023, 13, 2777. [Google Scholar] [CrossRef]
 - Feng, Y.; Li, N.; Dearen, T.; Lobo, M.L.; Matos, O.; Cama, V.; Xiao, L. Development of a multilocus sequence typing tool for high-resolution genotyping of Enterocytozoon bieneusi. Appl. Environ. Microbiol. 2011, 77, 4822–4828. [Google Scholar] [CrossRef]
 - Karimi, P.; Shafaghi-Sisi, S.; Meamar, A.R.; Razmjou, E. Molecular identification of Cryptosporidium, Giardia, and Blastocystis from stray and household cats and cat owners in Tehran, Iran. Sci. Rep. 2023, 13, 1554 . [Google Scholar] [CrossRef]
 - Xiao, H.D.; Su, N.; Zhang, Z.D.; Dai, L.L.; Luo, J.L.; Zhu, X.Q.; Xie, S.C.; Gao, W.W. Prevalence and genetic characterization of Giardia duodenalis and Blastocystis spp. in Black Goats in Shanxi Province, North China: From a Public Health Perspective. Animals 2024, 14, 1808. [Google Scholar] [CrossRef]
 - Wang, Y.; Lai, X.; Liu, R.; Li, J.; Ren, G.; Lu, X.; Wu, Y.; Khan, J.; Yu, X.; Qiang, Y.; et al. Molecular prevalence and subtype characteristics of Blastocystis among school children in Hainan, the tropical island province of China. Acta Trop. 2024, 258, 107353. [Google Scholar] [CrossRef]
 - Chen, H.; Hao, Y.; Liu, Y.; Xu, M.; Zhang, W.; Li, H.; Yang, F. The frequency and subtype distribution of Blastocystis sp. in humans and domestic animals in households in Heilongjiang Province, China. Acta Trop. 2023, 240, 106844. [Google Scholar] [CrossRef]
 - Danišová, O.; Valenčáková, A. First detection of Blastocystis sp. in pigs in Slovakia and in Europe. Parasitol. Int. 2021, 81, 102235. [Google Scholar] [CrossRef] [PubMed]
 - Gao, S.; Wang, J.; Wu, X.; Luo, X.; Li, Q.; Chen, D.; Liu, X.; Li, W. Molecular detection and subtyping of Blastocystis sp. in pigs in Anhui Province. Chin. J. Schisto. Control 2023, 35, 508–512. [Google Scholar]
 - Popruk, S.; Udonsom, R.; Koompapong, K.; Mahittikorn, A.; Kusolsuk, T.; Ruangsittichai, J.; Palasuwan, A. Subtype distribution of Blastocystis in Thai-Myanmar border, Thailand. Korean J. Parasitol. 2015, 53, 13–19. [Google Scholar] [CrossRef] [PubMed]
 - Song, J.K.; Hu, R.S.; Fan, X.C.; Wang, S.S.; Zhang, H.J.; Zhao, G.H. Molecular characterization of Blastocystis from pigs in Shaanxi province of China. Acta Trop. 2017, 173, 130–135. [Google Scholar] [CrossRef]
 - Shan, F.; Wang, F.; Chang, S.; Wang, N.; Liu, Y.; Chen, X.; Zhao, G.; Zhang, L. Predominance of the Blastocystis subtype ST5 among free-living sympatric rodents within pig farms in China suggests a novel transmission route from farms. One Health 2024, 18, 100723. [Google Scholar] [CrossRef]
 - Wang, W.; Owen, H.; Traub, R.J.; Cuttell, L.; Inpankaew, T.; Bielefeldt-Ohmann, H. Molecular epidemiology of Blastocystis in pigs and their in-contact humans in Southeast Queensland, Australia, and Cambodia. Vet. Parasitol. 2014, 203, 264–269. [Google Scholar] [CrossRef]
 - Ning, C.Q.; Hu, Z.; Chen, J.; Ai, L.; Tian, L.G. Epidemiology of Blastocystis infection from 1990 to 2019 in China. Infect. Dis. Poverty 2020, 9, 1–14. [Google Scholar] [CrossRef]
 - El Saftawy, E.A.; Amin, N.M.; Hamed, D.H.; Elkazazz, A.; Adel, S. The hidden impact of different Blastocystis genotypes on C-3 and IgE serum levels: A matter of debate in asthmatic Egyptian children. J. Parasit. Dis. 2019, 43, 443–451. [Google Scholar] [CrossRef]
 - Didier, E.S. Microsporidiosis: An emerging and opportunistic infection in humans and animals. Acta Trop. 2005, 94, 61–76. [Google Scholar] [CrossRef]
 - Li, X.M.; Wang, X.Y.; Wei, Y.J.; Jiang, J.; Cai, Y.; Zhang, X.X.; Yang, X.; Cao, H. Meta-analysis of the global prevalence and risk factors of Enterocytozoon bieneusi infection in pigs from 1999 to 2021. Prev. Vet. Med. 2024, 225, 106159. [Google Scholar] [CrossRef]
 - Zou, Y.; Hou, J.L.; Li, F.C.; Zou, F.C.; Lin, R.Q.; Ma, J.G.; Zhang, X.X.; Zhu, X.Q. Prevalence and genotypes of Enterocytozoon bieneusi in pigs in southern China. Infect. Genet. Evol. 2018, 66, 52–56. [Google Scholar] [CrossRef] [PubMed]
 - Li, W.; Feng, Y.; Xiao, L. Diagnosis and molecular typing of Enterocytozoon bieneusi: The significant role of domestic animals in transmission of human microsporidiosis. Res. Vet. Sci. 2020, 133, 251–261. [Google Scholar] [CrossRef] [PubMed]
 - Li, N.; Xiao, L.; Wang, L.; Zhao, S.; Zhao, X.; Duan, L.; Guo, M.; Liu, L.; Feng, Y. Molecular surveillance of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi by genotyping and subtyping parasites in wastewater. PLoS. Negl. Trop. Dis. 2012, 6, e1809. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, N.; Wu, R.; Ji, T.; Cui, L.; Cao, H.; Li, D.; Li, J.; Zhang, L.; Huang, C.; Zhou, D. Molecular detection, multilocus genotyping, and population genetics of Enterocytozoon bieneusi in pigs in Southeastern China. J. Eukaryot Microbiol. 2020, 67, 107–114. [Google Scholar] [CrossRef]
 - Shi, K.; Li, M.; Wang, X.; Li, J.; Karim, M.R.; Wang, R.; Zhang, L.; Jian, F.; Ning, C. Molecular survey of Enterocytozoon bieneusi in sheep and goats in China. Parasit. Vectors. 2016, 9, 1–8. [Google Scholar] [CrossRef]
 - He, S.; Wu, L.; Liu, X.; Shi, H.; Chen, Z.; Zhang, H.; Pang, C.; Li, Y. Investigation on the infection of Blastocystis hominis in populations in Bama Yao Autonomous County of Guangxi. Chin. J. Schisto. Control 2013, 31, 76–77. [Google Scholar]
 



| Parasite | Gene | Primer Sequences (5′-3′) | Annealing Temperature (°C)  | Fragment Length (bp)  | Reference | |
|---|---|---|---|---|---|---|
| E. biseneusi | ITS | F1 | GATGGTCATAGGGATGAAGAGCTT | 57 | 392 | [25] | 
| R1 | TATGCTTAAGTCCAGGGAG | |||||
| F2 | AGGGATGAAGAGCTTCGGCTCTG | 55 | ||||
| R2 | AGTGATCCTGTATTAGGGATATT | |||||
| Blastocystis spp. | SSU rRNA | F | GGAGGTAGTGACAATAAAC | 56 | 550–585 | [27] | 
| R | TAAGACTACGAGGGTATCTA | |||||
| Age (Months)  | Sample Size (n)  | Blastocystis | E. bieneusi | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| No. Positive  | Subtypes (n)  | Prevalence % (95% CI)  | OR  (95% CI)  | p Value | No. Positive  | Subtypes (n)  | Prevalence % (95% CI)  | OR  (95% CI)  | p Value  | ||
| Suckling piglets (<21 days)  | 70 | 25 | ST5 (n = 24) ST1 (n = 1)  | 35.71% (27.2–47.2%)  | 1.97 (0.98–3.96)  | <0.05 | 12 | EbpC (n = 11) CHG23 (n = 1) | 17.14% (8.1–26.2%)  | 6.07 (1.64–22.45)  | <0.001 | 
| Weaned piglets (21–70 days)  | 72 | 27 | ST5 (n = 22) ST1 (n = 3) ST3 (n = 2)  | 37.50% (26.0–49.0%)  | 2.13 (1.07–4.24)  | 22 | EbpC (n = 19) CHG23 (n = 3)  | 30.56% (19.7–41.5%)  | 12.91 (3.68–45.29)  | ||
| Fattening pigs (71–180 days)  | 78 | 34 | ST5 (n = 32) ST3 (n = 1) ST1 (n = 1)  | 43.59% (32.3–54.8%)  | 2.74 (1.41–5.35)  | 20 | EbpC (n = 19) CHG23 (n = 1)  | 25.64% (15.7–35.5%)  | 10.12 (2.88–35.59)  | ||
| Sows  (>180 days)  | 91 | 20 | ST5 (n = 17) ST1 (n = 3)  | 21.98% (13.3–30.6%)  | Reference | 3 | EbpC (n = 3) | 3.30% (0.4–7.0%)  | Reference | ||
| Total | 311 | 106 | ST5 (n = 95) ST1 (n = 8) ST3 (n = 3)  | 34.08% (28.8–39.4%)  | 57 | EbpC (n = 52) CHG23 (n = 5) | 18.33% (14.0–221,222.7%)  | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, X.; Mu, X.; Yuan, K.; Wang, S.; Li, Y.; Xu, H.; Li, Q.; Zeng, W.; Li, Z.; Guo, J.; et al. Occurrence and Genotypic Identification of Blastocystis spp. and Enterocytozoon bieneusi in Bamaxiang Pigs in Bama Yao Autonomous County of Guangxi Province, China. Animals 2024, 14, 3344. https://doi.org/10.3390/ani14223344
Yu X, Mu X, Yuan K, Wang S, Li Y, Xu H, Li Q, Zeng W, Li Z, Guo J, et al. Occurrence and Genotypic Identification of Blastocystis spp. and Enterocytozoon bieneusi in Bamaxiang Pigs in Bama Yao Autonomous County of Guangxi Province, China. Animals. 2024; 14(22):3344. https://doi.org/10.3390/ani14223344
Chicago/Turabian StyleYu, Xingang, Xuanru Mu, Kaijian Yuan, Sifan Wang, Yilong Li, Hui Xu, Qiaoyu Li, Wenjing Zeng, Zhili Li, Jianchao Guo, and et al. 2024. "Occurrence and Genotypic Identification of Blastocystis spp. and Enterocytozoon bieneusi in Bamaxiang Pigs in Bama Yao Autonomous County of Guangxi Province, China" Animals 14, no. 22: 3344. https://doi.org/10.3390/ani14223344
APA StyleYu, X., Mu, X., Yuan, K., Wang, S., Li, Y., Xu, H., Li, Q., Zeng, W., Li, Z., Guo, J., & Hong, Y. (2024). Occurrence and Genotypic Identification of Blastocystis spp. and Enterocytozoon bieneusi in Bamaxiang Pigs in Bama Yao Autonomous County of Guangxi Province, China. Animals, 14(22), 3344. https://doi.org/10.3390/ani14223344
        
