CRISPR-Cas13a-Based Lateral Flow Assay for Detection of Bovine Leukemia Virus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmids, Bacteria, Viruses, and Clinical Blood Samples
2.2. RAA Primer Design and crisprRNA (crRNA) Preparation
2.3. Evaluation and Optimization of RAA Reactions
2.4. CRISPR-Cas13a-LF Reaction
2.5. Analytical Sensitivity and Specificity of RAA-Cas13a-LF
2.6. Comparison of RAA-Cas13a-LF and BLV-CoCoMo-qPCR-2 Assays for Detection of Field Blood Samples
3. Results
3.1. Screening of Optimal RAA Primers
3.2. Establishment of the CRISPR-Cas13a-LF Assay
3.3. Sensitivity Analysis
3.4. Analytical Specificity of CRISPR-Cas13a-LF Assay
3.5. Evaluation of CRISPR-Cas13a-LF on Field Blood Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Barez, P.; de Brogniez, A.; Carpentier, A.; Gazon, H.; Gillet, N.; Gutiérrez, G.; Hamaidia, M.; Jacques, J.; Perike, S.; Neelature Sriramareddy, S.; et al. Recent Advances in BLV Research. Viruses 2015, 7, 6080–6088. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez, S.; Florins, A.; Gillet, N.; de Brogniez, A.; Sánchez-Alcaraz, M.; Boxus, M.; Boulanger, F.; Gutiérrez, G.; Trono, K.; Alvarez, I.; et al. Preventive and therapeutic strategies for bovine leukemia virus: Lessons for HTLV. Viruses 2011, 3, 1210–1248. [Google Scholar] [CrossRef] [PubMed]
- Benitez, O.; LaDronka, R.; Norby, B.; Grooms, D.; Bartlett, P.C. The effect of bovine leukemia virus on dairy cow longevity. JDS Commun. 2022, 3, 185–188. [Google Scholar] [CrossRef]
- Norby, B.; Bartlett, P.; Byrem, T.; Erskine, R.J. Effect of infection with bovine leukemia virus on milk production in Michigan dairy cows. J. Dairy Sci. 2016, 99, 2043–2052. [Google Scholar] [CrossRef]
- Bartlett, P.; Norby, B.; Byrem, T.; Parmelee, A.; Ledergerber, J.; Erskine, R.J. Bovine leukemia virus and cow longevity in Michigan dairy herds. J. Dairy Sci. 2013, 96, 1591–1597. [Google Scholar] [CrossRef]
- Frie, M.C.; Coussens, P.M. Bovine leukemia virus: A major silent threat to proper immune responses in cattle. Vet. Immunol. Immunopathol. 2015, 163, 103–114. [Google Scholar] [CrossRef] [PubMed]
- Khan, Z.; Abubakar, M.; Arshed, M.; Aslam, R.; Sattar, S.; Shah, N.; Javed, S.; Tariq, A.; Bostan, N.; Manzoor, S. Molecular investigation of possible relationships concerning bovine leukemia virus and breast cancer. Sci. Rep. 2022, 12, 4161. [Google Scholar] [CrossRef]
- Khatami, A.; Pormohammad, A.; Farzi, R.; Saadati, H.; Mehrabi, M.; Kiani, S.; Ghorbani, S. Bovine Leukemia virus (BLV) and risk of breast cancer: A systematic review and meta-analysis of case-control studies. Infect. Agents Cancer 2020, 15, 48. [Google Scholar] [CrossRef]
- Gao, A.; Kouznetsova, V.; Tsigelny, I.F. Bovine leukemia virus relation to human breast cancer: Meta-analysis. Microb. Pathog. 2020, 149, 104417. [Google Scholar] [CrossRef]
- Veenema, T.; Tõke, J. Early detection and surveillance for biopreparedness and emerging infectious diseases. Online J. Issues Nurs. 2006, 11, 3. [Google Scholar] [CrossRef]
- Khudhair, Y.; Al-Shammari, A.; Hasso, S.; Yaseen, N. Isolation of Bovine leukemia virus from cows with persistent lymphocytosis in Iraq. Vet. Anim. Sci. 2021, 14, 100201. [Google Scholar] [CrossRef] [PubMed]
- Schoepf, K.; Kapaga, A.; Msami, H.; Hyera, J.M.K. Serological evidence of the occurrence of enzootic bovine leukosis (EBL) virus infection in cattle in Tanzania. Trop. Anim. Health Prod. 1997, 29, 15–19. [Google Scholar] [CrossRef]
- Zaghawa, A.; Beier, D.; Abd El-Rahim, I.; Karim, I.; El-ballal, S.; Conraths, F.; Marquardt, O. An outbreak of enzootic bovine leukosis in upper Egypt: Clinical, laboratory and molecular-epidemiological studies. J. Vet. Med. Ser. B 2002, 49, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Jimba, M.; Takeshima, S.; Matoba, K.; Endoh, D.; Aida, Y. BLV-CoCoMo-qPCR: Quantitation of bovine leukemia virus proviral load using the CoCoMo algorithm. Retrovirology 2010, 7, 91. [Google Scholar] [CrossRef]
- LaDronka, R.; Ainsworth, S.; Wilkins, M.; Norby, B.; Byrem, T.; Bartlett, P.C. Prevalence of Bovine Leukemia Virus Antibodies in US Dairy Cattle. Vet. Med. Int. 2018, 2018, 5831278. [Google Scholar] [CrossRef] [PubMed]
- Fechner, H.; Kurg, A.; Geue, L.; Blankenstein, P.; Mewes, G.; Ebner, D.; Beier, D. Evaluation of polymerase chain reaction (PCR) application in diagnosis of bovine leukaemia virus (BLV) infection in naturally infected cattle. J. Vet. Med. Ser. B 1996, 43, 621–630. [Google Scholar] [CrossRef]
- Takeshima, S.; Kitamura-Muramatsu, Y.; Yuan, Y.; Polat, M.; Saito, S.; Aida, Y. BLV-CoCoMo-qPCR-2: Improvements to the BLV-CoCoMo-qPCR assay for bovine leukemia virus by reducing primer degeneracy and constructing an optimal standard curve. Arch. Virol. 2015, 160, 1325–1332. [Google Scholar] [CrossRef]
- Deiman, B.; van Aarle, P.; Sillekens, P. Characteristics and applications of nucleic acid sequence-based amplification (NASBA). Mol. Biotechnol. 2002, 20, 163–179. [Google Scholar] [CrossRef]
- Tapia-Sidas, D.; Vargas-Hernández, B.; Ramírez-Pool, J.; Núñez-Muñoz, L.; Calderón-Pérez, B.; González-González, R.; Brieba, L.; Lira-Carmona, R.; Ferat-Osorio, E.; López-Macías, C.; et al. Starting from scratch: Step-by-step development of diagnostic tests for SARS-CoV-2 detection by RT-LAMP. PLoS ONE 2023, 18, e0279681. [Google Scholar] [CrossRef]
- Qian, J.; Boswell, S.A.; Chidley, C.; Lu, Z.-X.; Pettit, M.E.; Gaudio, B.L.; Fajnzylber, J.M.; Ingram, R.T.; Ward, R.H.; Li, J.Z.; et al. An enhanced isothermal amplification assay for viral detection. Nat. Commun. 2020, 11, 5920. [Google Scholar] [CrossRef]
- Cui, H.; Tu, F.; Zhang, C.; Zhang, C.; Zhao, K.; Liu, J.; Dong, S.; Chen, L.; Liu, J.; Guo, Z. NReal-Time Reverse Transcription Recombinase-Aided Amplification Assay for Rapid Amplification of the Gene of SARS-CoV-2. Int. J. Mol. Sci. 2022, 23, 5269. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Liu, J.; Cheng, N.; Kang, X.; Huang, Z.; Wang, G.; Xiong, X.; Lu, T.; Gong, Z.; Huang, Z.; et al. Four thermostatic steps: A novel CRISPR-Cas12-based system for the rapid at-home detection of respiratory pathogens. Appl. Microbiol. Biotechnol. 2023, 107, 3983–3996. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.; Macaluso, N.; Pizzano, B.; Cash, M.; Spacek, J.; Karasek, J.; Miller, M.; Lednicky, J.; Dinglasan, R.; Salemi, M.; et al. A thermostable Cas12b from Brevibacillus leverages one-pot discrimination of SARS-CoV-2 variants of concern. eBioMedicine 2022, 77, 103926. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Qiu, M.; Li, X.; Yang, J.; Li, J. CRISPR-Cas13a system: A novel tool for molecular diagnostics. Front. Microbiol. 2022, 13, 1060947. [Google Scholar] [CrossRef]
- Patchsung, M.; Jantarug, K.; Pattama, A.; Aphicho, K.; Suraritdechachai, S.; Meesawat, P.; Sappakhaw, K.; Leelahakorn, N.; Ruenkam, T.; Wongsatit, T.; et al. Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA. Nat. Biomed. Eng. 2020, 4, 1140–1149. [Google Scholar] [CrossRef]
- Harrington, L.; Burstein, D.; Chen, J.; Paez-Espino, D.; Ma, E.; Witte, I.; Cofsky, J.; Kyrpides, N.; Banfield, J.; Doudna, J.A. Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Science 2018, 362, 839–842. [Google Scholar] [CrossRef]
- Kellner, M.; Koob, J.; Gootenberg, J.; Abudayyeh, O.; Zhang, F. SHERLOCK: Nucleic acid detection with CRISPR nucleases. Nat. Protoc. 2019, 14, 2986–3012. [Google Scholar] [CrossRef]
- de Puig, H.; Lee, R.; Najjar, D.; Tan, X.; Soeknsen, L.; Angenent-Mari, N.; Donghia, N.; Weckman, N.; Ory, A.; Ng, C.; et al. Minimally instrumented SHERLOCK (miSHERLOCK) for CRISPR-based point-of-care diagnosis of SARS-CoV-2 and emerging variants. Sci. Adv. 2021, 7, eabh2944. [Google Scholar] [CrossRef]
- Barnes, K.; Lachenauer, A.; Nitido, A.; Siddiqui, S.; Gross, R.; Beitzel, B.; Siddle, K.; Freije, C.; Dighero-Kemp, B.; Mehta, S.; et al. Deployable CRISPR-Cas13a diagnostic tools to detect and report Ebola and Lassa virus cases in real-time. Nat. Commun. 2020, 11, 4131. [Google Scholar] [CrossRef]
- Wei, N.; Zheng, B.; Niu, J.; Chen, T.; Ye, J.; Si, Y.; Cao, S. Rapid Detection of Genotype II African Swine Fever Virus Using CRISPR Cas13a-Based Lateral Flow Strip. Viruses 2022, 14, 179. [Google Scholar] [CrossRef]
- Wang, J.; Zhu, X.; Yin, D.; Cai, C.; Liu, H.; Yang, Y.; Guo, Z.; Yin, L.; Shen, X.; Dai, Y.; et al. Rapid and Easy-Read Porcine Circovirus Type 4 Detection with CRISPR-Cas13a-Based Lateral Flow Strip. Microorganisms 2023, 11, 354. [Google Scholar] [CrossRef]
- Zhao, J.; Li, Y.; Xue, Q.; Zhu, Z.; Zou, M.; Fang, F. A novel rapid visual detection assay for Toxoplasma gondii combining recombinase-aided amplification and lateral flow dipstick coupled with CRISPR-Cas13a fluorescence (RAA-Cas13a-LFD). Parasite 2022, 29, 21. [Google Scholar] [CrossRef] [PubMed]
- Ma, B.; Gong, Q.; Sheng, C.; Liu, Y.; Ge, G.; Li, D.; Diao, N.; Shi, K.; Li, J.; Sun, Z.; et al. Prevalence of bovine leukemia in 1983-2019 in China: A systematic review and meta-analysis. Microb. Pathog. 2021, 150, 104681. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Fan, W.; Mao, Y.; Yang, Z.; Lu, G.; Zhang, R.; Zhang, H.; Szeto, C.; Wang, C. Bovine leukemia virus infection in cattle of China: Association with reduced milk production and increased somatic cell score. J. Dairy Sci. 2016, 99, 3688–3697. [Google Scholar] [CrossRef]
- Rhodes, J.; Pelzer, K.; Johnson, Y.J. Economic implications of bovine leukemia virus infection in mid-Atlantic dairy herds. J. Am. Vet. Med. Assoc. 2003, 223, 346–352. [Google Scholar] [CrossRef] [PubMed]
- Pelzer, K.D. Economics of bovine leukemia virus infection. Vet. Clin. N. Am. Food Anim. Pract. 1997, 13, 129–141. [Google Scholar] [CrossRef] [PubMed]
- Yu, C.; Wang, X.; Zhou, Y.; Wang, Y.; Zhang, X.; Zheng, Y. Genotyping bovine leukemia virus in dairy cattle of Heilongjiang, northeastern China. BMC Vet. Res. 2019, 15, 179. [Google Scholar] [CrossRef]
- Gootenberg, J.; Abudayyeh, O.; Lee, J.; Essletzbichler, P.; Dy, A.; Joung, J.; Verdine, V.; Donghia, N.; Daringer, N.; Freije, C.; et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 2017, 356, 438–442. [Google Scholar] [CrossRef]
- Zhu, Y.; Xing, C.; Yang, L.; Li, Q.; Wang, X.; Zhou, J.; Zhang, C.; Ren, C.; Liu, F.; He, J.; et al. Dual-gene detection in a single-tube system based on CRISPR-Cas12a/Cas13a for severe fever thrombocytopenia syndrome virus. Front. Microbiol. 2022, 13, 977382. [Google Scholar] [CrossRef]
- Bai, X.; Gao, P.; Qian, K.; Yang, J.; Deng, H.; Fu, T.; Hu, Y.; Han, M.; Zheng, H.; Cao, X.; et al. A Highly Sensitive and Specific Detection Method for Mycobacterium tuberculosis Fluoroquinolone Resistance Mutations Utilizing the CRISPR-Cas13a System. Front. Microbiol. 2022, 13, 847373. [Google Scholar] [CrossRef]
- Komiyama, C.; Suzuki, K.; Miura, Y.; Sentsui, H. Development of loop-mediated isothermal amplification method for diagnosis of bovine leukemia virus infection. J. Virol. Methods 2009, 157, 175–179. [Google Scholar] [CrossRef] [PubMed]










| Primer Names | Sequences (5′-3′) | |
|---|---|---|
| Primer pol 1 | BLV-pol1-F1 | ACCTTCCCATGACTCAGGC |
| BLV-pol1-R1 | CTCCCGAGGCTTCGACTA | |
| Primer env | BLV-env-F1 | GGGGGCTTGATTGGTTGTACAT |
| BLV-env-R1 | GAACAGGCTTAGAACAGAA | |
| Primer pol 2 | BLV-pol2-F1 | TGTCTCGATGGCCGAACCCACGTA |
| BLV-pol2-R1 | GGCATGAGTAGCTCCAGAGTAAG | |
| Names | Sequences (5′-3′) |
|---|---|
| BLV-crRNA1 | TTGCTGTCATTTCAGAGGGCGGAGAAAC |
| BLV-crRNA2 | TGCGAGAGAGGCTGGAGATCACCGAGGC |
| BLV-crRNA3 | GGGGCCCACCCTCTCTGAATAGTTCGCAT |
| RNA reporter | /56-FAM/mArArUrGrGrCmAmArArUrGrGrCmA/3 Bio/ |
| Assay | Number of Samples | |
|---|---|---|
| Positive | Negative | |
| BLV-CoCoMo-qPCR-2 | 78 | 22 |
| CRISPR-Cas13a-LF | 78 | 22 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Dai, J.; Zhang, Z.; Chen, J.; Chen, Y.; Hu, C.; Chen, X.; Guo, A. CRISPR-Cas13a-Based Lateral Flow Assay for Detection of Bovine Leukemia Virus. Animals 2024, 14, 3262. https://doi.org/10.3390/ani14223262
Zhao Y, Dai J, Zhang Z, Chen J, Chen Y, Hu C, Chen X, Guo A. CRISPR-Cas13a-Based Lateral Flow Assay for Detection of Bovine Leukemia Virus. Animals. 2024; 14(22):3262. https://doi.org/10.3390/ani14223262
Chicago/Turabian StyleZhao, Yuxi, Jingwen Dai, Zhen Zhang, Jianguo Chen, Yingyu Chen, Changmin Hu, Xi Chen, and Aizhen Guo. 2024. "CRISPR-Cas13a-Based Lateral Flow Assay for Detection of Bovine Leukemia Virus" Animals 14, no. 22: 3262. https://doi.org/10.3390/ani14223262
APA StyleZhao, Y., Dai, J., Zhang, Z., Chen, J., Chen, Y., Hu, C., Chen, X., & Guo, A. (2024). CRISPR-Cas13a-Based Lateral Flow Assay for Detection of Bovine Leukemia Virus. Animals, 14(22), 3262. https://doi.org/10.3390/ani14223262

