Faecal DNA Metabarcoding for Diet Analysis of Endangered Fish Species, Odontobutis obscurus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Study Sites and Sample Collection
2.3. DNA Metabarcoding
2.4. Bioinformatics
2.5. Dietary Analyses
2.5.1. Dietary Metrics
2.5.2. Costello Method
2.5.3. Selectivity Index and Reference Data
2.5.4. Statistical Analysis
3. Results
3.1. Overview of the Metabarcoding Results
3.2. Dietary Metrics and Comparison of the Two Major Prey Groups
3.3. Graphical Diet Analysis Through Costello Method
3.4. Comparison with Field Survey and Prey Selectivity of O. obscurus
4. Discussion
4.1. Dietary Characteristics of O. obscurus and Suggestions for Translocation
- We suggest a habitat with a high density of fish and benthic invertebrates, particularly Zacco spp.
- As a generalist, they have the potential to easily adapt to new alternative habitats. However, they showed preferences for certain prey items, so habitats covering such prey selectivity are more recommended.
- We suggest clean flat water with complex substrates and a low water depth suitable for ambush-type predators.
4.2. Faecal DNA Metabarcoding for Diet Analysis of Endangered Fish Species
4.3. Limitations and Further Study
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Sequence (5′->3′) | Template strand | Length | Start | Stop | Tm | GC% | Length (bp) | |
---|---|---|---|---|---|---|---|---|
Block_1_F | CCCCCGATATAGCCTTCCCT | Plus | 20 | 179 | 198 | 60.25 | 60 | 143 |
Block_1_R | CAGGTTTCCTGCTAACGGGG | Minus | 20 | 321 | 302 | 60.68 | 60 |
Appendix B
References
- Iwata, A.; Jeon, S.-R.; Mizuno, N.; Choi, K.-C. A Revision of the Eleotrid Goby Genus Odontobutis in Japan, Korea and China. Jpn. J. Ichthyol. 1985, 31, 373–388. [Google Scholar] [CrossRef]
- Yamagishi, H.; Maruyama, T.; Mashiko, K. Social relation in a small experimental population of Odontobutis obscurus (Temminck et Schlegel) as related to individual growth and food intake. Oecologia 1974, 17, 187–202. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Li, H.; Sakai, H.; Mukai, T.; Young Suk, H.; Li, C. Molecular phylogenetics of the fresh water sleepers Odontobutis (Gobiiformes: Odontobutidae) and its implications on biogeography of freshwater ichthyofauna of East Asia. Mol. Phylogenetics Evol. 2023, 186, 107871. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-H.; Kim, J.-H.; Baek, S.-H.; Jo, H. Distribution and Habitat Characteristics of Odontobutis obscura, Endangered Species. Korean J. Ecol. Environ. 2021, 54, 79–86. [Google Scholar] [CrossRef]
- Chae, B.-S. First Record of Odontobutid fish, Odontobutis obscura (Pisces, Gobioidei) from Korea. Korean J. Ichthyol. 1999, 11, 12–16. [Google Scholar]
- Choi, G.T.; Byun, Y.H.; Park, H.K.; Won, J.A. A Study on the Characteristics of Freshwater Fish and Distribution in Geo-Je Island; The Korea Science Center & Museum Association: Daejeon, Republic of Korea, 2009. [Google Scholar]
- MOLTM. Basic Plan for River Disaster Prevention Project; Ministry of Land, Transport and Maritime Affairs: Sejong-si, Republic of Korea, 2008. [Google Scholar]
- Conant, S. Saving Endangered Species by Translocation: Are We Tinkering with Evolution? BioScience 1988, 38, 254–257. [Google Scholar] [CrossRef]
- Griffith, B.; Scott, J.M.; Carpenter, J.W.; Reed, C. Translocation as a Species Conservation Tool: Status and Strategy. Science 1989, 245, 477–480. [Google Scholar] [CrossRef]
- Schwartz, M.W.; Martin, T.G. Translocation of imperiled species under changing climates. Ann. N. Y. Acad. Sci. 2013, 1286, 15–28. [Google Scholar] [CrossRef]
- Bradley, H.S.; Tomlinson, S.; Craig, M.D.; Cross, A.T.; Bateman, P.W. Mitigation translocation as a management tool. Conserv. Biol. 2022, 36, e13667. [Google Scholar] [CrossRef]
- IUCN. Guidelines for Reintroductions and Other Conservation Translocations. Version 1.0; IUCN Species Survival Commission: Gland, Switzerland, 2013. [Google Scholar]
- Berger-Tal, O.; Blumstein, D.T.; Swaisgood, R.R. Conservation translocations: A review of common difficulties and promising directions. Anim. Conserv. 2020, 23, 121–131. [Google Scholar] [CrossRef]
- Caravaggi, A.; Banks, P.B.; Burton, A.C.; Finlay, C.M.V.; Haswell, P.M.; Hayward, M.W.; Rowcliffe, M.J.; Wood, M.D. A review of camera trapping for conservation behaviour research. Remote Sens. Ecol. Conserv. 2017, 3, 109–122. [Google Scholar] [CrossRef]
- Leuchtenberger, C.; Zucco, C.A.; Ribas, C.; Magnusson, W.; Mourão, G. Activity patterns of giant otters recorded by telemetry and camera traps. Ethol. Ecol. Evol. 2014, 26, 19–28. [Google Scholar] [CrossRef]
- Bouten, W.; Baaij, E.W.; Shamoun-Baranes, J.; Camphuysen, K.C.J. A flexible GPS tracking system for studying bird behaviour at multiple scales. J. Ornithol. 2013, 154, 571–580. [Google Scholar] [CrossRef]
- Thomsen, P.F.; Willerslev, E. Environmental DNA—An emerging tool in conservation for monitoring past and present biodiversity. Biol. Conserv. 2015, 183, 4–18. [Google Scholar] [CrossRef]
- Zhu, B.; Xie, C.; Wang, M.; Jin, H. A study on feeding, reproduction, age and growth of dark sleeper Odontobutis obscura in Bao’an lake. Acta Hydrobiol. Sin. 1999, 23, 316–323. [Google Scholar] [CrossRef]
- Heng, K.; Chevalier, M.; Lek, S.; Laffaille, P. Seasonal variations in diet composition, diet breadth and dietary overlap between three commercially important fish species within a flood-pulse system: The Tonle Sap Lake (Cambodia). PLoS ONE 2018, 13, e0198848. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Jiliberto, R.; Valdovinos, F.S.; Arias, J.; Alcaraz, C.; García-Berthou, E. A network-based approach to the analysis of ontogenetic diet shifts: An example with an endangered, small-sized fish. Ecol. Complex. 2011, 8, 123–129. [Google Scholar] [CrossRef]
- De Silva, S.S. Exotic Aquatic Organisms in Asia; The Asian Fisheries Society in Association with the International Development Research Centre of Canada and the Australian International Development Assistance Bureau: Manila, Philippines, 1989. [Google Scholar]
- Innal, D.; Erk’akan, F. Effects of exotic and translocated fish species in the inland waters of Turkey. Rev. Fish Biol. Fish. 2006, 16, 39–50. [Google Scholar] [CrossRef]
- Berry, T.E.; Osterrieder, S.K.; Murray, D.C.; Coghlan, M.L.; Richardson, A.J.; Grealy, A.K.; Stat, M.; Bejder, L.; Bunce, M. DNA metabarcoding for diet analysis and biodiversity: A case study using the endangered Australian sea lion (Neophoca cinerea). Ecol. Evol. 2017, 7, 5435–5453. [Google Scholar] [CrossRef]
- Granquist, S.M.; Esparza-Salas, R.; Hauksson, E.; Karlsson, O.; Angerbjörn, A. Fish consumption of harbour seals (Phoca vitulina) in north western Iceland assessed by DNA metabarcoding and morphological analysis. Pol. Biol. 2018, 41, 2199–2210. [Google Scholar] [CrossRef]
- de Sousa, L.L.; Silva, S.M.; Xavier, R. DNA metabarcoding in diet studies: Unveiling ecological aspects in aquatic and terrestrial ecosystems. Environ. DNA 2019, 1, 199–214. [Google Scholar] [CrossRef]
- Taberlet, P.; Bonin, A.; Zinger, L.; Coissac, E. Environmental DNA: For Biodiversity Research and Monitoring; Oxford University Press: Oxford, UK, 2018. [Google Scholar]
- Ruppert, K.M.; Kline, R.J.; Rahman, M.S. Past, present, and future perspectives of environmental DNA (eDNA) metabarcoding: A systematic review in methods, monitoring, and applications of global eDNA. Glob. Ecol. Conserv. 2019, 17, e00547. [Google Scholar] [CrossRef]
- Kumari, P.; Dong, K.; Eo, K.Y.; Lee, W.-S.; Kimura, J.; Yamamoto, N. DNA metabarcoding-based diet survey for the Eurasian otter (Lutra lutra): Development of a Eurasian otter-specific blocking oligonucleotide for 12S rRNA gene sequencing for vertebrates. PLoS ONE 2019, 14, e0226253. [Google Scholar] [CrossRef]
- Young, M.J.; Dutoit, L.; Robertson, F.; van Heezik, Y.; Seddon, P.J.; Robertson, B.C. Species in the faeces: DNA metabarcoding as a method to determine the diet of the endangered yellow-eyed penguin. Wildl. Res. 2020, 47, 509–522. [Google Scholar] [CrossRef]
- Huang, P.-Y.; Poon, E.S.K.; Wong, A.T.C.; So, I.W.Y.; Sung, Y.-H.; Sin, S.Y.W. DNA metabarcoding reveals the dietary composition in the endangered black-faced spoonbill. Sci. Rep. 2021, 11, 18773. [Google Scholar] [CrossRef]
- Kim, I.S.; Park, J.Y. Freshwater fishes of Korea; Kyo hak sa: Busan, Republic of Korea, 2002. [Google Scholar]
- Nelson, J.S.; Grande, T.C.; Wilson, M.V.H. Fishes of the World; John Wiley & Sons: Hoboken, NJ, USA, 2016. [Google Scholar]
- Cummins, K.W. An Evaluation of Some Techniques for the Collection and Analysis of Benthic Samples with Special Emphasis on Lotic Waters. Am. Midl. Nat. 1962, 67, 477–504. [Google Scholar] [CrossRef]
- Leray, M.; Yang, J.Y.; Meyer, C.P.; Mills, S.C.; Agudelo, N.; Ranwez, V.; Boehm, J.T.; Machida, R.J. A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: Application for characterizing coral reef fish gut contents. Front. Zool. 2013, 10, 34. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Alberdi, A.; Aizpurua, O.; Gilbert, M.T.P.; Bohmann, K. Scrutinizing key steps for reliable metabarcoding of environmental samples. Methods Ecol. Evol. 2018, 9, 134–147. [Google Scholar] [CrossRef]
- Deagle, B.E.; Thomas, A.C.; McInnes, J.C.; Clarke, L.J.; Vesterinen, E.J.; Clare, E.L.; Kartzinel, T.R.; Eveson, J.P. Counting with DNA in metabarcoding studies: How should we convert sequence reads to dietary data? Mol. Ecol. 2019, 28, 391–406. [Google Scholar] [CrossRef]
- Amundsen, P.-A.; Gabler, H.-M.; Staldvik, F.J. A new approach to graphical analysis of feeding strategy from stomach contents data—Modification of the Costello (1990) method. J. Fish Biol. 1996, 48, 607–614. [Google Scholar] [CrossRef]
- Jacobs, J. Quantitative measurement of food selection. Oecologia 1974, 14, 413–417. [Google Scholar] [CrossRef]
- Mann, H.B.; Whitney, D.R. On a Test of Whether one of Two Random Variables is Stochastically Larger than the Other. Ann. Math. Stat. 1947, 18, 50–60. [Google Scholar] [CrossRef]
- ter Braak, C.J.F. Canonical Correspondence Analysis: A New Eigenvector Technique for Multivariate Direct Gradient Analysis. Ecology 1986, 67, 1167–1179. [Google Scholar] [CrossRef]
- Castle, S.T.; Allan, N.; Clifford, D.; Aylward, C.M.; Ramsey, J.; Fascetti, A.J.; Pesapane, R.; Roy, A.; Statham, M.; Sacks, B.; et al. Diet composition analysis provides new management insights for a highly specialized endangered small mammal. PLoS ONE 2020, 15, e0240136. [Google Scholar] [CrossRef]
- Xiong, M.; Wang, D.; Bu, H.; Shao, X.; Zhang, D.; Li, S.; Wang, R.; Yao, M. Molecular dietary analysis of two sympatric felids in the Mountains of Southwest China biodiversity hotspot and conservation implications. Sci. Rep. 2017, 7, 41909. [Google Scholar] [CrossRef]
- Sung, Y.-H.; Liew, J.H.; Chan, H.K.; Lee, W.-H.; Wong, B.H.-F.; Dingle, C.; Karraker, N.E.; Spencer, R.-J.; Fong, J.J. Assessing the diet of the endangered Beale’s eyed turtle (Sacalia bealei) using faecal content and stable isotope analyses: Implications for conservation. Aquat. Conserv. Mar. Freshw. Ecosyst. 2021, 31, 2804–2813. [Google Scholar] [CrossRef]
- Vázquez, P.D.; Simberloff, D. Ecological Specialization and Susceptibility to Disturbance: Conjectures and Refutations. Am. Nat. 2002, 159, 606–623. [Google Scholar] [CrossRef]
- Kang, H.J.; Baek, M.J.; Kang, J.H.; Bae, Y.J. Diversity and DNA Barcode Analysis of Chironomids (Diptera: Chironomidae) from Large Rivers in South Korea. Insects 2022, 13, 346. [Google Scholar] [CrossRef]
- Mo, H.-h.; Kim, Y.; Lee, Y.-S.; Bae, Y.J.; Khim, J.S.; Cho, K. Burrowing mayfly Ephemera orientalis (Ephemeroptera: Ephemeridae) as a new test species for pesticide toxicity. Environ. Sci. Pollut. Res. 2016, 23, 18766–18776. [Google Scholar] [CrossRef]
- Bae, Y.J. Ephemera separigata, a new species of Ephemeridae (Insecta: Ephemeroptera) from Korea. Korean J. Syst. Zool. 1995, 11, 159–166. [Google Scholar]
- Ando, H.; Mukai, H.; Komura, T.; Dewi, T.; Ando, M.; Isagi, Y. Methodological trends and perspectives of animal dietary studies by noninvasive fecal DNA metabarcoding. Environ. DNA 2020, 2, 391–406. [Google Scholar] [CrossRef]
- Nalley, E.M.; Donahue, M.J.; Heenan, A.; Toonen, R.J. Quantifying the diet diversity of herbivorous coral reef fishes using systematic review and DNA metabarcoding. Environ. DNA 2022, 4, 191–205. [Google Scholar] [CrossRef]
- Jakubavičiūtė, E.; Bergström, U.; Eklöf, J.S.; Haenel, Q.; Bourlat, S.J. DNA metabarcoding reveals diverse diet of the three-spined stickleback in a coastal ecosystem. PLoS ONE 2017, 12, e0186929. [Google Scholar] [CrossRef]
- Waraniak, J.M.; Marsh, T.L.; Scribner, K.T. 18S rRNA metabarcoding diet analysis of a predatory fish community across seasonal changes in prey availability. Ecolo. Evol. 2019, 9, 1410–1430. [Google Scholar] [CrossRef]
- Su, M.; Liu, H.; Liang, X.; Gui, L.; Zhang, J. Dietary Analysis of Marine Fish Species: Enhancing the Detection of Prey-Specific DNA Sequences via High-Throughput Sequencing Using Blocking Primers. Estuar. Coasts 2018, 41, 560–571. [Google Scholar] [CrossRef]
Target Organisms (Region) | Name | Sequences | References |
---|---|---|---|
Animal (COI) | mlCOIintF | GGWACWGGWTGAACWGTWTAYCCYCC | Leray et al. 2013 [34] |
jgHCO2198 | TAIACYTCIGGRTGICCRAARAAYCA |
Prey Group | Class | Genus + Species | Max Score | Identity (%) | Query (%) | Genbank Accession |
---|---|---|---|---|---|---|
Fish | Actinopteri | Micropterus salmoides | 579 | 100.0 | 100 | MT455106.1 |
Misgurnus anguillicaudatus | 579 | 100.0 | 100 | MF122502.1 | ||
Carassius cuvieri | 579 | 100.0 | 100 | MT571744.1 | ||
Zacco sp. 1 | 556 | 98.7 | 100 | MT457508.1 | ||
Zacco sp. 2 | 579 | 100.0 | 100 | MT457518.1 | ||
Rhinogobius brunneus | 579 | 100.0 | 100 | OL674307.1 | ||
Hemibarbus labeo | 573 | 99.7 | 100 | OL674364.1 | ||
Benthic macro invertebrates | Insecta | Chironomus flaviplumus | 534 | 97.4 | 100 | MN521255.1 |
Cricotopus triannulatus | 579 | 100.0 | 100 | LC050962.1 | ||
Polypedilum japonicum | 573 | 99.7 | 100 | LC329191.1 | ||
Polypedilum yongsanensis | 579 | 100.0 | 100 | NC_072650.1 | ||
Ephemera orientalis | 562 | 99.0 | 100 | OL664518.1 | ||
Platycnemis phyllopoda | 573 | 99.7 | 100 | KF257109.1 | ||
Gastropoda | Radix sp. | 564 | 99.0 | 100 | LC658589.1 | |
Clitellata | Limnodrilus sp. | 579 | 100.0 | 100 | KY369698.1 |
Date | Sample Number | Water Quality | Physical Environment | Sample Length and Weight | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Temp (°C) | DO (mg/L) | Conduc (us/cm) | Salinity (psu) | pH | Depth (cm) | Flow Velocity (m/s) | Substrate | TL (mm) | L (mm) | Weight (g) | ||
4 June 2019 | 1 | 23.8 | 10.66 | 277.8 | 0.11 | 7.46 | 60 | <0.1 | gravel, boulder | 86 | 72 | 7.8 |
2 | 23.5 | 11.68 | 233.6 | 0.11 | 7.55 | 30 | <0.1 | gravel, sand | 82 | 66 | 8.1 | |
3 | 24.0 | 11.74 | 277.0 | 0.11 | 7.71 | 30 | <0.1 | gravel, sand | 96 | 81 | 13.8 | |
4 | 23.9 | 11.31 | 236.0 | 0.11 | 7.67 | 30 | <0.1 | gravel, sand | 94 | 82 | 12.8 | |
5 | 23.7 | 9.83 | 202.2 | 0.11 | 7.57 | 20 | <0.1 | gravel, sand | 82 | 67 | 6.8 | |
6 | 23.9 | 10.78 | 231.4 | 0.11 | 7.65 | 20 | <0.1 | gravel, sand | 91 | 72 | 12.0 | |
7 | 24.2 | 10.04 | 230.5 | 0.11 | 7.62 | 40 | <0.1 | gravel, sand | 89 | 71 | 9.9 | |
8 | 23.6 | 9.77 | 227.7 | 0.11 | 7.53 | 30 | <0.1 | gravel, sand | 89 | 70 | 9.4 | |
9 | 23.5 | 9.80 | 225.1 | 0.11 | 7.51 | 40 | <0.1 | gravel, sand | 90 | 76 | 10.5 | |
10 | 24.9 | 7.71 | 248.0 | 0.12 | 7.45 | 20 | <0.1 | gravel, sand, boulder | 87 | 72 | 9.5 | |
11 | 25.7 | 7.73 | 254.8 | 0.12 | 7.46 | 10 | <0.1 | gravel, sand, boulder | 98 | 81 | 12.1 | |
12 | 25.7 | 7.73 | 254.8 | 0.12 | 7.46 | 10 | <0.1 | gravel, sand, boulder | 86 | 72 | 8.7 | |
13 | 24.6 | 9.25 | 255.1 | 0.12 | 7.42 | 20 | <0.1 | gravel, sand | 96 | 82 | 11.8 | |
14 | 26.3 | 7.84 | 260.1 | 0.12 | 7.24 | 20 | <0.1 | gravel, sand, boulder | 81 | 67 | 7.4 | |
15 | 26.3 | 7.84 | 260.1 | 0.12 | 7.24 | 20 | <0.1 | gravel, sand, boulder | 83 | 65 | 9.2 | |
16 | 26.3 | 7.84 | 260.1 | 0.12 | 7.24 | 20 | <0.1 | gravel, sand, boulder | 97 | 81 | 13.2 | |
17 | 25.5 | 9.07 | 249.0 | 0.11 | 7.18 | 20 | <0.1 | gravel, sand, boulder | 88 | 75 | 9.8 | |
18 | 26.4 | 7.47 | 270.0 | 0.12 | 7.51 | 30 | <0.1 | gravel, sand, silt, boulder | 84 | 67 | 7.6 | |
19 | 26.4 | 7.47 | 270.0 | 0.12 | 7.51 | 30 | <0.1 | gravel, sand, silt, boulder | 83 | 66 | 8.4 | |
20 | 26.4 | 7.47 | 270.0 | 0.12 | 7.51 | 30 | <0.1 | gravel, sand, silt, boulder | 84 | 71 | 7.1 | |
21 | 26.4 | 7.47 | 270.0 | 0.12 | 7.51 | 30 | <0.1 | gravel, sand, silt, boulder | 83 | 69 | 8.7 | |
17 July 2019 | 22 | 24.3 | 8.18 | 77.6 | 0.04 | 7.50 | 30 | <0.1 | gravel, sand | 98 | 83 | 12.3 |
23 | 24.3 | 8.18 | 77.6 | 0.04 | 7.50 | 30 | <0.1 | gravel, sand | 83 | 68 | 8.5 | |
24 | 24.3 | 8.18 | 77.6 | 0.04 | 7.50 | 30 | <0.1 | boulder | 98 | 80 | 12.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, K.; You, K.-A.; Kim, J.-H.; Park, S.-H.; Baek, S.-H.; Jeong, K.-S.; Joo, G.-J.; Jo, H. Faecal DNA Metabarcoding for Diet Analysis of Endangered Fish Species, Odontobutis obscurus. Animals 2024, 14, 3083. https://doi.org/10.3390/ani14213083
Kim K, You K-A, Kim J-H, Park S-H, Baek S-H, Jeong K-S, Joo G-J, Jo H. Faecal DNA Metabarcoding for Diet Analysis of Endangered Fish Species, Odontobutis obscurus. Animals. 2024; 14(21):3083. https://doi.org/10.3390/ani14213083
Chicago/Turabian StyleKim, Kanghui, Kyung-A You, Jeong-Hui Kim, Sang-Hyeon Park, Seung-Ho Baek, Kwang-Seuk Jeong, Gea-Jae Joo, and Hyunbin Jo. 2024. "Faecal DNA Metabarcoding for Diet Analysis of Endangered Fish Species, Odontobutis obscurus" Animals 14, no. 21: 3083. https://doi.org/10.3390/ani14213083
APA StyleKim, K., You, K.-A., Kim, J.-H., Park, S.-H., Baek, S.-H., Jeong, K.-S., Joo, G.-J., & Jo, H. (2024). Faecal DNA Metabarcoding for Diet Analysis of Endangered Fish Species, Odontobutis obscurus. Animals, 14(21), 3083. https://doi.org/10.3390/ani14213083