Dietary Tributyrin Improves Growth Performance, Meat Quality, Muscle Oxidative Status, and Gut Microbiota in Taihe Silky Fowls under Cyclic Heat Stress
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Ethics
2.2. Diet, Experiment Design, and Animals
2.3. Temperature and Humidity
2.4. Sample Collection
2.5. Growth Performance Determination
2.6. Nutrient Digestibility Determination
2.7. Serum HSP 70 and CORT Levels Determination
2.8. Meat Quality Determination
2.9. Breast Muscle Chemical Composition Determination
2.10. Oxidative Status in the Breast Muscle Determination
2.11. Real-Time PCR Analysis
2.12. DNA Extraction and Sequencing
2.13. Statistical Analyses
3. Results
3.1. Subsection
3.1.1. Growth Performance
3.1.2. Nutrient Digestibility
3.1.3. Serum HSP70 and CORT Levels
3.1.4. Meat Quality and Breast Muscle Chemical Composition
3.1.5. Oxidative Status in the Breast Muscle
3.1.6. Gene Expression of Antioxidant Enzymes in the Breast Muscle
3.1.7. Cecum Microbiota
4. Discussion
4.1. Successful Construction of Heat Stress Models
4.2. Growth Performance, Nutrient Digestibility, and Cecum Microbiota
4.3. Meat Quality
4.4. Muscle Oxidative Status
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Farag, M.R.; Alagawany, M. Physiological alterations of poultry to the high environmental temperature. J. Therm. Biol. 2018, 76, 101–106. [Google Scholar] [CrossRef]
- Ratriyanto, A.; Mosenthin, R. Osmoregulatory function of betaine in alleviating heat stress in poultry. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1634–1650. [Google Scholar] [CrossRef]
- Chen, Y.; Cheng, Y.; Du, M.; Zhou, Y. Protective effects of dietary synbiotic supplementation on meat quality and oxidative status in broilers under heat stress. Environ. Sci. Pollut. Res. Int. 2021, 28, 30197–30206. [Google Scholar] [CrossRef]
- Liu, L.L.; He, J.H.; Xie, H.B.; Yang, Y.S.; Li, J.C.; Zou, Y. Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens. Poult. Sci. 2014, 93, 54–62. [Google Scholar] [CrossRef]
- Liao, X.; Shi, X.; Hu, H.; Han, X.; Jiang, K.; Liu, Y.; Xiong, G. Comparative metabolomics analysis reveals the unique nutritional characteristics of breed and feed on muscles in Chinese Taihe black-bone silky fowl. Metabolites 2022, 12, 914. [Google Scholar] [CrossRef]
- Yuan, L.; Wu, H.; Wang, J.; Zhou, M.; Zhang, L.; Xiang, J.; Liao, Q.; Luo, L.; Qian, M.; Zhang, D. Pharmacokinetics, withdrawal time, and dietary risk assessment of enrofloxacin and its metabolite ciprofloxacin, and sulfachloropyridazine-trimethoprim in Taihe black-boned silky fowls. J. Food Sci. 2023, 88, 1743–1752. [Google Scholar] [CrossRef]
- Wasti, S.; Sah, N.; Lee, C.N.; Jha, R.; Mishra, B. Dietary supplementation of alpha-lipoic acid mitigates the negative effects of heat stress in broilers. PLoS ONE 2021, 16, e0254936. [Google Scholar] [CrossRef]
- Chaudhary, A.; Mishra, P.; Amaz, S.A.; Mahato, P.L.; Das, R.; Jha, R.; Mishra, B. Dietary supplementation of microalgae mitigates the negative effects of heat stress in broilers. Poult Sci. 2023, 102, 102958. [Google Scholar] [CrossRef]
- Sikandar, A.; Zaneb, H.; Younus, M.; Masood, S.; Aslam, A.; Khattak, F.; Ashraf, S.; Yousaf, M.S.; Rehman, H. Effect of sodium butyrate on performance, immune status, microarchitecture of small intestinal mucosa and lymphoid organs in broiler chickens. Asian-Australas. J. Anim. Sci. 2017, 30, 690–699. [Google Scholar] [CrossRef]
- Sadurní, M.; Barroeta, A.C.; Sol, C.; Puyalto, M.; Castillejos, L. Effects of dietary crude protein level and sodium butyrate protected by medium-chain fatty acid salts on performance and gut health in weaned piglets. J. Anim. Sci. 2023, 101. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Eweedah, N.M.; Elbialy, Z.I.; Abdelhamid, A.I. Dietary sodium butyrate ameliorated the blood stress biomarkers, heat shock proteins, and immune response of Nile tilapia (Oreochromis niloticus) exposed to heat stress. J. Therm. Biol. 2020, 88, 102500. [Google Scholar] [CrossRef]
- Sivaprakasam, S.; Bhutia, Y.D.; Yang, S.; Ganapathy, V. Short-chain fatty acid transporters: Role in colonic homeostasis. Compr. Physiol. 2017, 8, 299–314. [Google Scholar] [CrossRef]
- Getachew, B.; Csoka, A.B.; Garden, A.R.; Copeland, R.L.; Tizabi, Y. Sodium butyrate protects against ethanol-induced toxicity in SH-SY5Y cell line. Neurotox Res. 2021, 39, 2186–2193. [Google Scholar] [CrossRef]
- Gu, T.; Duan, M.; Liu, J.; Chen, L.; Tian, Y.; Xu, W.; Zeng, T.; Lu, L. Effects of tributyrin supplementation on liver fat deposition, lipid levels and lipid metabolism-related gene expression in broiler chickens. Genes 2022, 13, 2219. [Google Scholar] [CrossRef]
- Ghare, S.S.; Charpentier, B.T.; Ghooray, D.T.; Zhang, J.; Vadhanam, M.V.; Reddy, S.; Joshi-Barve, S.; McClain, C.J.; Barve, S.S. Tributyrin mitigates ethanol-induced lysine acetylation of Histone-H3 and p65-NFκB downregulating CCL2 expression and consequent liver inflammation and injury. Nutrients 2023, 15, 4397. [Google Scholar] [CrossRef]
- Sotira, S.; Dell’Anno, M.; Caprarulo, V.; Hejna, M.; Pirrone, F.; Callegari, M.L.; Tucci, T.V.; Rossi, L. Effects of tributyrin supplementation on growth performance, insulin, blood metabolites and gut microbiota in weaned piglets. Animals 2020, 10, 726. [Google Scholar] [CrossRef]
- Papadopoulos, G.A.; Poutahidis, T.; Chalvatzi, S.; Kroustallas, F.; Karavanis, E.; Fortomaris, P. Effects of a tributyrin and monolaurin blend compared to high ZnO levels on growth performance, faecal microbial counts, intestinal histomorphometry and immunohistochemistry in weaned piglets: A field study in two pig herds. Res. Vet. Sci. 2022, 144, 54–65. [Google Scholar] [CrossRef]
- Gong, L.; Xiao, G.; Zheng, L.; Yan, X.; Qi, Q.; Zhu, C.; Feng, X.; Huang, W.; Zhang, H. Effects of dietary tributyrin on growth performance, biochemical indices, and intestinal microbiota of yellow-feathered broilers. Animals 2021, 11, 3425. [Google Scholar] [CrossRef]
- Sakdee, J.; Poeikhamph, T.; Rakangthon, C.; Poungpong, K.; Bunchasak, C. Effect of tributyrin supplementation in diet on production performance and gastrointestinal tract of healthy nursery pigs. Pak. J. Nutr. 2016, 15, 954–962. [Google Scholar] [CrossRef]
- Li, J.; Hou, Y.; Yi, D.; Zhang, J.; Wang, L.; Qiu, H.; Ding, B.; Gong, J. Effects of tributyrin on intestinal energy status, antioxidative capacity and immune response to lipopolysaccharide challenge in broilers. Asian-Australas J. Anim. Sci. 2015, 28, 1784–1793. [Google Scholar] [CrossRef]
- Zhang, C.; Zhao, X.; Wang, L.; Yang, L.; Chen, X.; Geng, Z. Resveratrol beneficially affects meat quality of heat-stressed broilers which is associated with changes in muscle antioxidant status. Anim. Sci. J. 2017, 88, 1569–1574. [Google Scholar] [CrossRef]
- Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.; Gao, F. Chronic heat stress impairs the quality of breast-muscle meat in broilers by affecting redox status and energy-substance metabolism. J. Agric. Food Chem. 2017, 65, 11251–11258. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis, 17th ed.; Association of Official Agricultural Chemists: Arlington, VA, USA, 2000. [Google Scholar]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
- Zhang, J.; Kobert, K.; Flouri, T.; Stamatakis, A. PEAR: A fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics 2014, 30, 614–620. [Google Scholar] [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef]
- Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
- Ye, J.; McGinnis, S.; Madden, T.L. BLAST: Improvements for better sequence analysis. Nucleic Acids Res. 2006, 34, W6–W9. [Google Scholar] [CrossRef]
- Flees, J.; Rajaei-Sharifabadi, H.; Greene, E.; Beer, L.; Hargis, B.M.; Ellestad, L.; Porter, T.; Donoghue, A.; Bottje, W.G.; Dridi, S. Effect of Morinda citrifolia (noni)-enriched diet on hepatic heat shock protein and lipid metabolism-related genes in heat stressed broiler chickens. Front. Physiol. 2017, 8, 919. [Google Scholar] [CrossRef]
- Gonzalez-Gomez, P.L.; Villavicencio, C.P.; Quispe, R.; Schwabl, P.; Cornelius, J.M.; Ramenofsky, M.; Krause, J.S.; Wingfield, J.C. Perspectives on environmental heterogeneity and seasonal modulation of stress response in neotropical birds. Horm. Behav. 2023, 152, 105359. [Google Scholar] [CrossRef]
- Li, D.; Tong, Q.; Shi, Z.; Li, H.; Wang, Y.; Li, B.; Yan, G.; Chen, H.; Zheng, W. Effects of chronic heat stress and ammonia concentration on blood parameters of laying hens. Poult. Sci. 2020, 99, 3784–3792. [Google Scholar] [CrossRef]
- Alaqil, A.A.; Abd El-Atty, H.K.; Abbas, A.O. Intermittent lighting program relieves the deleterious effect of heat stress on growth, stress biomarkers, physiological status, and immune response of broiler chickens. Animals 2022, 12, 1834. [Google Scholar] [CrossRef]
- Liu, W.; Yuan, Y.; Sun, C.; Balasubramanian, B.; Zhao, Z.; An, L. Effects of dietary betaine on growth performance, digestive function, carcass traits, and meat quality in indigenous yellow-feathered broilers under long-term heat stress. Animals 2019, 9, 506. [Google Scholar] [CrossRef]
- Brugaletta, G.; Teyssier, J.R.; Rochell, S.J.; Dridi, S.; Sirri, F. A review of heat stress in chickens. Part I: Insights into physiology and gut health. Front. Physiol. 2022, 13, 934381. [Google Scholar] [CrossRef]
- Labussière, E.; Achard, C.; Dubois, S.; Combes, S.; Castex, M.; Renaudeau, D. Saccharomyces cerevisiae boulardii CNCM I-1079 supplementation in finishing male pigs helps to cope with heat stress through feeding behaviour and gut microbiota modulation. Br. J. Nutr. 2022, 127, 353–368. [Google Scholar] [CrossRef]
- Niu, Q.; Li, P.; Hao, S.; Zhang, Y.; Kim, S.W.; Li, H.; Ma, X.; Gao, S.; He, L.; Wu, W.; et al. Dynamic distribution of the gut microbiota and the relationship with apparent crude fiber digestibility and growth stages in pigs. Sci. Rep. 2015, 5, 9938. [Google Scholar] [CrossRef]
- Kaczmarek, S.A.; Barri, A.; Hejdysz, M.; Rutkowski, A. Effect of different doses of coated butyric acid on growth performance and energy utilization in broilers. Poult. Sci. 2016, 95, 851–859. [Google Scholar] [CrossRef]
- Bortoluzzi, C.; Pedroso, A.A.; Mallo, J.J.; Puyalto, M.; Kim, W.K.; Applegate, T.J. Sodium butyrate improved performance while modulating the cecal microbiota and regulating the expression of intestinal immune-related genes of broiler chickens. Poult. Sci. 2017, 96, 3981–3993. [Google Scholar] [CrossRef]
- Donovan, J.D.; Bauer, L.; Fahey, G.C.; Lee, Y. In Vitro digestion and fermentation of microencapsulated tributyrin for the delivery of butyrate. J. Food Sci. 2017, 82, 1491–1499. [Google Scholar] [CrossRef]
- Beisner, J.; Filipe Rosa, L.; Kaden-Volynets, V.; Stolzer, I.; Günther, C.; Bischoff, S.C. Prebiotic inulin and sodium butyrate attenuate obesity-induced intestinal barrier dysfunction by induction of antimicrobial peptides. Front. Immunol. 2021, 12, 678360. [Google Scholar] [CrossRef]
- Lan, R.; Zhao, Z.; Li, S.; An, L. Sodium butyrate as an effective feed additive to improve performance, liver function, and meat quality in broilers under hot climatic conditions. Poult. Sci. 2020, 99, 5491–5500. [Google Scholar] [CrossRef]
- Zhang, W.H.; Jiang, Y.; Zhu, Q.F.; Gao, F.; Dai, S.F.; Chen, J.; Zhou, G.H. Sodium butyrate maintains growth performance by regulating the immune response in broiler chickens. Br. Poult. Sci. 2011, 52, 292–301. [Google Scholar] [CrossRef]
- Guo, Y.J.; Wang, Z.Y.; Wang, Y.S.; Chen, B.; Huang, Y.Q.; Li, P.; Tan, Q.; Zhang, H.Y.; Chen, W. Impact of drinking water supplemented 2-hydroxy-4-methylthiobutyric acid in combination with acidifier on performance, intestinal development, and microflora in broilers. Poult Sci. 2022, 101, 101661. [Google Scholar] [CrossRef]
- Rao, R.K.; Samak, G. Protection and restitution of gut barrier by probiotics: Nutritional and clinical implications. Curr. Nutr. Food Sci. 2013, 9, 99–107. [Google Scholar] [CrossRef]
- Lightfoot, Y.L.; Selle, K.; Yang, T.; Goh, Y.J.; Sahay, B.; Zadeh, M.; Owen, J.L.; Colliou, N.; Li, E.; Johannssen, T.; et al. SIGNR3-dependent immune regulation by Lactobacillus acidophilus surface layer protein A in colitis. EMBO J. 2015, 34, 881–895. [Google Scholar] [CrossRef]
- Dec, M.; Puchalski, A.; Stępień-Pyśniak, D.; Marek, A.; Urban-Chmiel, R. Susceptibility of chicken Lactobacillus bacteria to coccidiostats. J. Vet. Med. Sci. 2020, 82, 333–336. [Google Scholar] [CrossRef]
- Wen, C.; Yan, W.; Mai, C.; Duan, Z.; Zheng, J.; Sun, C.; Yang, N. Joint contributions of the gut microbiota and host genetics to feed efficiency in chickens. Microbiome 2021, 9, 126. [Google Scholar] [CrossRef]
- Hosomi, K.; Saito, M.; Park, J.; Murakami, H.; Shibata, N.; Ando, M.; Nagatake, T.; Konishi, K.; Ohno, H.; Tanisawa, K.; et al. Oral administration of Blautia wexlerae ameliorates obesity and type 2 diabetes via metabolic remodeling of the gut microbiota. Nat. Commun. 2022, 13, 4477. [Google Scholar] [CrossRef]
- Sebastià, C.; Folch, J.M.; Ballester, M.; Estellé, J.; Passols, M.; Muñoz, M.; García-Casco, J.M.; Fernández, A.I.; Castelló, A.; Sánchez, A.; et al. Interrelation between gut microbiota, SCFA, and fatty acid composition in pigs. mSystems 2024, 9, e0104923. [Google Scholar] [CrossRef]
- Tang, W.; Xiang, X.; Wang, H.; Zhou, W.; He, L.; Yin, Y.; Li, T. Zinc lactate alleviates oxidative stress by modulating crosstalk between constitutive androstane receptor signaling pathway and gut microbiota profile in weaned piglets. Anim. Nutr. 2023, 16, 23–33. [Google Scholar] [CrossRef]
- Zaboli, G.; Huang, X.; Feng, X.; Ahn, D.U. How can heat stress affect chicken meat quality?—A review. Poult. Sci. 2019, 98, 1551–1556. [Google Scholar] [CrossRef]
- Wen, C.; Chen, Y.; Leng, Z.; Ding, L.; Wang, T.; Zhou, Y. Dietary betaine improves meat quality and oxidative status of broilers under heat stress. J. Sci. Food Agric. 2019, 99, 620–623. [Google Scholar] [CrossRef]
- Song, D.J.; King, A.J. Effects of heat stress on broiler meat quality. World Poult. Sci. J. 2015, 71, 701–709. [Google Scholar] [CrossRef]
- Gonzalez-Rivas, P.A.; Chauhan, S.S.; Ha, M.; Fegan, N.; Dunshea, F.R.; Warner, R.D. Effects of heat stress on animal physiology, metabolism, and meat quality: A review. Meat Sci. 2020, 162, 108025. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Jia, G.Q.; Zuo, J.J.; Zhang, Y.; Lei, J.; Ren, L.; Feng, D.Y. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult. Sci. 2012, 91, 2931–2937. [Google Scholar] [CrossRef]
- Okeudo, N.J.; Moss, B.W. Interrelationships amongst carcass and meat quality characteristics of sheep. Meat Sci. 2005, 69, 1–8. [Google Scholar] [CrossRef]
- Huang, C.; Jiao, H.; Song, Z.; Zhao, J.; Wang, X.; Lin, H. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci. 2015, 93, 2144–2153. [Google Scholar] [CrossRef]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Biophys. Acta. Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef]
- Fakhri, S.; Pesce, M.; Patruno, A.; Moradi, S.Z.; Iranpanah, A.; Farzaei, M.H.; Sobarzo-Sánchez, E. Attenuation of Nrf2/Keap1/ARE in alzheimer’s disease by plant secondary metabolites: A mechanistic review. Molecules 2020, 25, 4926. [Google Scholar] [CrossRef]
- Wang, J.; Zhang, H.; Bai, S.; Zeng, Q.; Su, Z.; Zhuo, Y.; Mao, X.; Yin, H.; Feng, B.; Liu, J.; et al. Dietary tributyrin improves reproductive performance, antioxidant capacity, and ovary function of broiler breeders. Poult. Sci. 2021, 100, 101429. [Google Scholar] [CrossRef]
- Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.; Gao, F. Dietary taurine supplementation improves breast meat quality in chronic heat-stressed broilers via activating the Nrf2 pathway and protecting mitochondria from oxidative attack. J. Sci. Food Agric. 2019, 99, 1066–1072. [Google Scholar] [CrossRef]
- Hou, J.; Lian, L.; Lu, L.; Gu, T.; Zeng, T.; Chen, L.; Xu, W.; Li, G.; Wu, H.; Tian, Y. Effects of dietary Bacillus coagulans and tributyrin on growth performance, serum antioxidants, intestinal morphology, and cecal microbiota of growing yellow-feathered broilers. Animals 2023, 13, 3534. [Google Scholar] [CrossRef]





| Ingredients (%) | Calculated Nutrient Levels | ||
|---|---|---|---|
| Corn | 67.60 | Metabolizable energy (MJ/kg) | 12.97 |
| Soybean meal | 22.00 | Crude protein (%) | 16.19 |
| Fish meal | 2.00 | Calcium (%) | 0.81 |
| Soybean oil | 4.00 | Available phosphorus (%) | 0.38 |
| Dicalcium phosphate | 1.00 | Threonine (%) | 0.69 |
| Limestone | 1.10 | Lysine (%) | 0.86 |
| DL-Methionine | 0.09 | Methionine (%) | 0.36 |
| Threonine | 0.05 | Methionine + cystine (%) | 0.65 |
| Salt | 0.30 | ||
| Zeolite powder | 1.36 | ||
| Premix * | 0.50 | ||
| Total | 100.00 | ||
| Target Genes | Accession No. | Primer Sequences (5′ to 3′ Direction) |
|---|---|---|
| Keap1 | MN416132.1 | F: ATGTACCAGATCGACAGCGT R: AACTCCTCCTGCTTGGAGAC |
| Nrf2 | MN416129.1 | F: GCCACCCTAAAGCTCCATTC R: ACTGAACTGCTCCTTCGACA |
| NQO1 | NM_001277621.1 | F: CCTCTACGCCATAGGGTTCA R: TGCAGTGGGAACTGGAAGAT |
| HO-1 | NM_205344.1 | F: GAAAGCTGCCCTGGAGAAAG R: CCCAGACAGGTCTCCCAAAT |
| SOD | NM_205064.1 | F: ATGTGACTGCAAAGGGAGGA R: AGCTAAACGAGGTCCAGCAT |
| GSH-Px | NM_001277853.2 | F: ACGGCTTCAAACCCAACTTC R: CTCTCTCAGGAAGGCGAACA |
| β-actin | NM_205518.1 | F: ATCAGCAAGCAGGAGTACGA R: AAAGCCATGCCAATCTCGTC |
| Items | NC | HS + T | NC vs. HS | HS + T | |||||
|---|---|---|---|---|---|---|---|---|---|
| 0% | 0.04% | 0.08% | 0.16% | 0.32% | p-Value | SEM | p-Value | ||
| IBW | 916.40 | 913.50 | 916.00 | 916.50 | 917.60 | 911.60 | 0.592 | 1.77 | 0.841 |
| FBW | 1173.33 | 1052.78 b | 1073.33 ab | 1079.86 ab | 1097.22 a | 1099.11 a | <0.001 | 5.54 | 0.039 |
| ADFI (g/d) | 50.78 | 43.33 | 43.06 | 43.72 | 44.33 | 44.69 | 0.011 | 0.52 | 0.874 |
| ADG (g/d) | 9.35 | 4.97 b | 5.62 ab | 5.84 ab | 6.42 a | 6.53 a | <0.001 | 0.19 | 0.046 |
| FCR | 5.44 | 8.76 a | 7.81 ab | 7.55 b | 6.92 b | 6.96 b | <0.001 | 0.20 | 0.012 |
| Items | NC | HS + T | NC vs. HS | HS + T | |||||
|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.04 | 0.08 | 0.16 | 0.32 | p-Value | SEM | p-Value | ||
| Dry matter (%) | 73.57 | 71.60 | 72.50 | 72.12 | 72.50 | 72.24 | 0.038 | 0.30 | 0.876 |
| Crude protein (%) | 46.89 | 41.54 b | 42.20 ab | 44.28 a | 44.77 a | 44.68 a | <0.001 | 0.44 | 0.035 |
| Ether extract (%) | 82.99 | 82.05 | 81.57 | 81.78 | 82.51 | 82.47 | 0.252 | 0.28 | 0.808 |
| Items | NC | HS + T | NC vs. HS | HS + T | |||||
|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.04 | 0.08 | 0.16 | 0.32 | p-Value | SEM | p-Value | ||
| HSP 70 (pg/mL) | 150.36 | 234.42 a | 212.28 ab | 206.60 ab | 172.58 b | 178.04 b | 0.001 | 6.99 | 0.017 |
| CORT (ng/mL) | 3.63 | 4.76 a | 4.59 a | 4.46 ab | 3.66 b | 3.63 b | 0.005 | 0.15 | 0.026 |
| Items | NC | HS + T | NC vs. HS | HS + T | |||||
|---|---|---|---|---|---|---|---|---|---|
| 0% | 0.04% | 0.08% | 0.16% | 0.32% | p-Value | SEM | p-Value | ||
| pH45 min | 6.46 | 6.37 | 6.40 | 6.43 | 6.40 | 6.39 | 0.042 | 0.01 | 0.760 |
| pH24 h | 6.07 | 6.12 | 6.19 | 6.15 | 6.13 | 6.13 | 0.143 | 0.01 | 0.368 |
| Lightness (L*) | 43.64 | 43.42 | 43.96 | 43.08 | 43.20 | 43.39 | 0.806 | 0.36 | 0.974 |
| Redness (a*) | 1.66 | 1.40 | 1.48 | 1.47 | 1.46 | 1.48 | 0.367 | 0.10 | 0.999 |
| Yellowness (b*) | 4.05 | 3.31 | 3.23 | 3.42 | 3.77 | 3.81 | 0.369 | 0.21 | 0.912 |
| Drip loss (%) | 1.28 | 1.69 a | 1.54 ab | 1.49 b | 1.47 b | 1.43 b | 0.003 | 0.03 | 0.035 |
| Cooking loss (%) | 13.13 | 14.37 | 14.89 | 14.61 | 14.27 | 14.38 | 0.268 | 0.34 | 0.989 |
| Shear force (N) | 17.22 | 14.65 b | 15.15 ab | 15.80 a | 16.09 a | 15.88 a | 0.003 | 0.17 | 0.034 |
| Items | NC | HS + T | NC vs. HS | HS + T | |||||
|---|---|---|---|---|---|---|---|---|---|
| 0% | 0.04% | 0.08% | 0.16% | 0.32% | p-Value | SEM | p-Value | ||
| Moisture (%) | 69.30 | 69.72 | 70.28 | 70.18 | 70.10 | 69.63 | 0.487 | 0.15 | 0.594 |
| Ether extract (%) | 1.84 | 2.66 a | 2.46 ab | 2.43 ab | 2.12 b | 2.14 b | 0.029 | 0.07 | 0.047 |
| Crude protein (%) | 29.75 | 28.65 | 28.25 | 28.45 | 28.64 | 28.57 | 0.005 | 0.13 | 0.874 |
| Items | NC | HS + T | NC vs. HS | HS + T | |||||
|---|---|---|---|---|---|---|---|---|---|
| 0% | 0.04% | 0.08% | 0.16% | 0.32% | p-Value | SEM | p-Value | ||
| T-AOC (mmol/g protein) | 0.106 | 0.101 | 0.105 | 0.104 | 0.105 | 0.104 | 0.516 | 0.003 | 0.995 |
| SOD (U/mg protein) | 34.05 | 25.48 | 25.50 | 27.21 | 27.64 | 27.55 | 0.004 | 0.59 | 0.628 |
| GSH-Px (U/mg protein) | 28.55 | 11.83 b | 15.61 ab | 19.17 ab | 24.50 a | 24.74 a | <0.001 | 1.64 | 0.028 |
| MDA (nmol/mg protein) | 0.123 | 0.213 a | 0.187 ab | 0.191 ab | 0.177 b | 0.170 b | <0.001 | 0.005 | 0.035 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, C.; Qu, M.; Li, G.; Wan, G.; Liu, P.; Omar, S.M.; Mei, W.; Hu, Z.; Zhou, Q.; Xu, L. Dietary Tributyrin Improves Growth Performance, Meat Quality, Muscle Oxidative Status, and Gut Microbiota in Taihe Silky Fowls under Cyclic Heat Stress. Animals 2024, 14, 3041. https://doi.org/10.3390/ani14203041
Chen C, Qu M, Li G, Wan G, Liu P, Omar SM, Mei W, Hu Z, Zhou Q, Xu L. Dietary Tributyrin Improves Growth Performance, Meat Quality, Muscle Oxidative Status, and Gut Microbiota in Taihe Silky Fowls under Cyclic Heat Stress. Animals. 2024; 14(20):3041. https://doi.org/10.3390/ani14203041
Chicago/Turabian StyleChen, Chuanbin, Mingren Qu, Guanhong Li, Gen Wan, Ping Liu, Salma Mbarouk Omar, Wenliang Mei, Ziyu Hu, Qian Zhou, and Lanjiao Xu. 2024. "Dietary Tributyrin Improves Growth Performance, Meat Quality, Muscle Oxidative Status, and Gut Microbiota in Taihe Silky Fowls under Cyclic Heat Stress" Animals 14, no. 20: 3041. https://doi.org/10.3390/ani14203041
APA StyleChen, C., Qu, M., Li, G., Wan, G., Liu, P., Omar, S. M., Mei, W., Hu, Z., Zhou, Q., & Xu, L. (2024). Dietary Tributyrin Improves Growth Performance, Meat Quality, Muscle Oxidative Status, and Gut Microbiota in Taihe Silky Fowls under Cyclic Heat Stress. Animals, 14(20), 3041. https://doi.org/10.3390/ani14203041

