Next Article in Journal
A New Species of the Feather Mite Genus Grallolichus Gaud, 1960 (Acariformes: Pterolichidae): First Report of a Commensal Mite Specific to the Sungrebe (Heliornis fulica)
Previous Article in Journal
CAMLLA-YOLOv8n: Cow Behavior Recognition Based on Improved YOLOv8n
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 20
10.3390/ani14203034
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Diversity of the Casein Gene Cluster in Bovidae: Insights from SNP Microarray Analysis

by
Tadeusz Malewski
1,
Stanisław Kamiński
2,
Jan Śmiełowski
3,
Kamil Oleński
2 and
Wiesław Bogdanowicz
1,*
1
Department of Molecular and Biometric Techniques, Museum and Institute of Zoology, Polish Academy of Sciences, 00-818 Warszawa, Poland
2
Department of Animal Genetics, University of Warmia and Mazury, 10-718 Olsztyn, Poland
3
Independent Researcher, 60-809 Poznań, Poland
*
Author to whom correspondence should be addressed.
Animals 2024, 14(20), 3034; https://doi.org/10.3390/ani14203034
Submission received: 17 September 2024 / Revised: 17 October 2024 / Accepted: 18 October 2024 / Published: 19 October 2024
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

This study explores the genetic diversity of the casein gene cluster, a key component in milk protein production, across various Bovidae species, including cattle, buffaloes, and antelopes. The lack of genetic data for wild bovids hampers the understanding of milk protein expression and the improvement of dairy breeds. The researchers assessed the feasibility of using a cattle-specific SNP microarray to analyze genetic variation in 12 Bovidae taxa, representing 5 different subfamilies. The positive results enabled the examination of genetic variations and their potential impact on milk protein production. The findings revealed high genetic diversity in these genes among domestic cattle and certain wild species, such as the lechwe, suggesting variations in milk protein expression. The study demonstrated that cattle-derived SNP chips are effective tools for examining genetic diversity in other Bovidae species. Moreover, the relatively low cost of SNP microarrays and the ability of third-party companies to scan them make genomic analysis applicable to a wide range of research areas.

Abstract

The casein gene cluster spans 250 to 350 kb across mammalian species and is flanked by non-coding DNA with largely unknown functions. These regions likely harbor elements regulating the expression of the 4 casein genes. In Bovidae, this cluster is well studied in domestic cattle and to a lesser extent in zebu and water buffalo. This study used a cattle-specific SNP microarray to analyze 12 Bovidae taxa and estimate casein gene cluster variability across 5 bovid subfamilies. Genotyping identified 126 SNPs covering the entire casein gene cluster and 2 Mb of upstream and downstream regions. Dairy cattle, watusi, and zebu showed the highest polymorphism: 63.7–68.2% in the 5′-upstream region, 35.6–40.0% in the casein cluster, and 40.4–89.4% in the 3′-downstream region. Among wild bovids, only a ‘semi-aquatic’ lechwe revealed high polymorphism similar to cattle. Other species exhibited lower variability, ranging from 9.1–27.3% in the 5′-upstream, 8.9–20.0% in the casein, and 4.2–10.6% in the 3′-downstream regions. For the first time, genome variability data were obtained for impala, waterbuck, and lechwe. It appears that higher variability in cattle’s casein gene cluster may relate to its intense expression. This study confirms the effectiveness of cattle-derived microarrays for genotyping Bovidae.

1. Introduction

Lactation is a key aspect of mammalian life history. In the family of cloven-hoofed mammals, Bovidae, caseins are the most abundant milk proteins. They provide nursing infants with essential amino acids, calcium, phosphorus, and potentially bioactive peptides, and their composition varies among species, driven by reproductive strategies, the developmental needs of the young, and the environment of the maternal–infant pair. Bovidae, which includes species with diverse milk yields and compositions—differing in its content of protein, fat, and solids [1]—rely on caseins for critical nutrition and development. Given their nutritional significance, Bovidae contribute to approximately 96% of the world’s milk production, primarily from cattle (81%), water buffaloes (15%), goats (2.3%), and sheep (1.4%) [2].
Caseins belong to the secretory calcium-binding phosphoproteins (SCPPs) family and are believed to have evolved from ancestral genes through duplication and exon changes. These ancestral genes derived from other Scpp genes, either the ameloblast-associated gene (Odam), the SCPP-Pro-Gln-rich 1 gene (Scpppq1), or the follicular dendritic cell secreted peptide gene (Fdcsp) [3].
The bovid casein gene cluster spans 250 kb and consists of 7 genes: α-S1-casein (Csn1s1), β-casein (Csn2), histatin (Htn), statherin (Stath), α-S2-casein (Csn1s2), the ameloblast-associated gene (Odam), and κ-casein (Csn3) [4,5]. This gene cluster is highly conserved in mammals, although some differences in its organization and content have been reported. For example, in humans, two histatin genes (Htn1 and Htn3) and the follicular dendritic cell secreted peptide gene (Fdcsp) are located between the casein genes. In contrast, the gene clusters of mice and rats lack the statherin and histatin genes [6]. Among the casein gene cluster members, the Odam gene is proposed to be the ancestral gene from which all other casein genes evolved [3].
Among bovids, the exon–intron structure of 4 casein genes has been analyzed in cattle and, to some extent, in water buffaloes [7,8,9]. Additionally, the evolution of individual casein genes, such as β-casein [10] and κ-casein [11], has been studied. Interspecies comparisons have shown that κ-casein is the most conserved of the casein genes, likely due to its essential role in stabilizing casein micelles [12]. Casein genes are highly expressed in epithelial cells during late pregnancy, lactation, and early involution of the mammary gland [13,14,15]. These genes are separated and flanked by stretches of non-coding DNA with mostly unknown functions, believed to contain elements that regulate their spatio-temporal expression patterns [4,16,17,18]. Sequence characterization of the Csn3 promoter region has revealed several variations in putative transcription factor binding sites that affect gene transcription in cattle [19], zebu, and water buffalo [20].
Although Bovidae comprises more than 140 species [21], detailed data on the casein gene cluster are limited to a few species, such as Bos taurus [4,12,22], Bos indicus [4,20,23]; Bubalus bubalis [7,20], Capra hircus [24], and Ovis aries [25], with most research focusing on milk composition (as, e.g., in the case of Hippotragus niger [26], Damaliscus pygargus phillipsi, Connochaetes gnou, C. taurinus [27], Taurotragus oryx, Kobus leche [28], Aepyceros melampus, and Damaliscus lunatus lunatus [29]) rather than on genetic structure. Broader studies on casein gene structures are limited by the high cost of next-generation sequencing (NGS). They can be extended by microarray technology, which is a more cost-effective solution. This study aims to (1) analyze the diversity of the casein gene cluster in both domestic and wild Bovidae species using a bovine SNP microarray and (2) identify the specific segments of the casein gene cluster wherein differences in SNP frequencies are most significant. Identifying these segments could offer new insights into the well-known variations in milk biosynthesis, particularly the low production in wild bovids and the high production in their domesticated counterparts.

2. Materials and Methods

Blood samples were collected from 76 animals representing 5 subfamilies of the family Bovidae: (i) Aepycerotinae: Aepyceros melampus (Lichtenstein, 1812) (n = 5); (ii) Alcelaphinae: Connochaetes taurinus (Burchell, 1823) (n = 5); (iii) Bovinae: Bos taurus Linnaeus, 1758 (Holstein breed, n = 12 and watusi, n = 5), B. indicus Linnaeus, 1758 (n = 5), Syncerus caffer (Sparrman, 1779) (n = 9), Tragelaphus angasii Angas, 1849 (n = 5), T. imberbis (Blyth, 1869) (n = 5); (iv) Hippotraginae (n = 5): Hippotragus equinus (É. Geoffroy Saint-Hilaire, 1803) (n = 5), H. niger (Harris, 1838) (n = 5); (v) Reduncinae: Kobus leche Gray, 1850 (n = 5), and K. ellipsiprymnus (Ogilby, 1833) (n = 5) (Figure 1). These animals came from the zoo in Dvůr Králové nad Labem, Czechia. Their ancestors originated from diverse regions in Africa. They were imported to the Dvůr Králové zoo, Czechia in the 1970s and bred to avoid inbreeding by exchanging reproductive individuals among zoological gardens, thus adhering to the guidelines of the European Association of Zoos and Aquaria (EAZA). Blood samples were taken during routine veterinary inspections in 2016–2020 and frozen in −20 °C until DNA preparation.
Genomic DNA was isolated by the use of a NucleoSpin Tissue Mini kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s protocol. All animals were genotyped using Illumina Bovine MDv2 Chip (Illumina, San Diego, CA, USA), according to the manufacturer’s protocol. The raw SNP data passed standard quality control in Illumina GenomeStudio software ver. 2011.1 [30], following the protocol provided by Illumina. The quality control process included checking for cluster separation, call frequency, AB T mean, rep errors (repeatability of genotype calls), het excess (excess calls of heterozygotes), minor frequency, and gender estimation. The P-C errors (Mendelian inheritance errors) option was not used because our populations did not consist of parents and offspring. Initial data cleanup removed poorly performing SNPs or/and samples giving an insufficient number of informative genotypes. Monomorphic SNPs, SNPs showing a significant deviation (p < 0.001) from the Hardy–Weinberg equilibrium (HWE), and SNPs with a minor allele frequency (MAF) < 0.01 were also removed from further analysis. Additionally, the similarity of 10 randomly selected Illumina probe sequences related to the casein gene cluster (Table 1) was checked using BLASTn against the available genome assembly of the analyzed species.
GenAlEx v. 6.501 was used to calculate genetic diversity indices, including observed (Ho) and expected (He) heterozygosities, expected unbiased heterozygosity (uHe), and the fixation index (Fst) [31,32]. The bovine UMD3.1 genome assembly was used to annotate the detected SNPs. Phylogenetic relationships were reconstructed using MEGA X ver. 10.0.5 [33].

3. Results

Raw SNP data from the casein gene cluster and surrounding 5′- and 3′-regions, which passed the standard quality control in Illumina Genome Studio software, were inspected using scatter plots (Figure 2). Failed or suboptimal SNPs were excluded from further analyses. After editing, 45,556 SNPs were obtained, including 126 located in the casein gene cluster and within 2 Mb of their 5′-upstream and 3′-downstream regions.

3.1. SNP Call Rates

No-call SNPs can result from experimental errors, lack of probe sequence similarity to the DNA of the examined species, or incompatibility of the nucleotide at the 3′ end. To address this issue, the similarities between probe sequences and genomic sequences were examined (Table 2). Out of the 10 probe sequences analyzed across eight species, only one probe (BTA-111108-no-rs) showed no similarity in one of them (A. melampus). In all other cases, sequence identity ranged from 86% to 100%. For probes that were successfully called in all samples, sequence identity ranged from 88% to 100%; for those called in some samples, it ranged from 92% to 94%. In 4 out of 10 probes, the last nucleotide at the 3′ end was incompatible with the analyzed genomic sequence. An example of such a probe is presented in Table 3.
SNP genotyping of samples using the Bovine BeadChip revealed that all SNP call rates ranged from 83.0% to 100.0%. Similarly, the call rate for the casein gene cluster ranged from 82.9% to 100.0% (Table 4).

3.2. SNP Polymorphism

The percentage of SNPs polymorphism in the casein cluster ranged from 8.9% to 55.6%. High levels of polymorphism were detected in K. leche (55.6%), B. taurus (domestic cattle―37.8%, watusi―40.0%), and B. indicus (zebu―35.6%). In other species, the polymorphism was significantly lower; even in S. caffer belonging to the same subfamily, the polymorphism was ca. 2.5-fold lower (15.6%). The lowest level of polymorphism was detected in A. melampus (8.9%) (Table 5).
In the case of the 5′-upstream region, the percentage of polymorphism ranged from 9.1% in K. ellipsiprymnus and T. imberbis to 68.2% in domestic cattle and watusi. For the 3′-downstream region, this ranged from 4.3% in K. ellipsiprymnus to 89.4% in domestic cattle. The level of polymorphism in the regions flanking the casein cluster was generally similar to the polymorphism within the cluster itself in most species. However, in domestic cattle, watusi, and zebu, the polymorphism in the 5′-upstream region was 1.7- to 1.8-fold higher than within the casein cluster. Similarly, in these breeds, the 3′-flanking region was also more polymorphic than the casein cluster (by 2.4-, 1.3-, and 1.1-fold, respectively). In contrast, among wild Bovidae (except A. melampus), the polymorphism in the 3′-downstream region was 1.3- to 3.1-fold lower than in the casein cluster. Furthermore, in all species except domestic cattle, the polymorphism in the 3′-downstream region was 1.1- to 4.3-fold lower than in the 5′-upstream region. Notably, in domestic cattle, the 3′-downstream region was 1.3-fold more polymorphic than the 5′-upstream region (Table 5).
A total of 58 SNPs were identified in the casein gene cluster, with 45 in exons, 6 in introns, and 7 in intergenic regions (Table S1). The lowest level of polymorphism in exons (8.6%) was observed in A. melampus, while the highest was found in species of the genus Bos (domestic cattle—34.3%, watusi—37.1%) and in K. leche (57.1%). Within the genus Kobus, polymorphism varied significantly from 14.3% in K. ellipsiprymnus to 57.1% in K. leche. Generally, SNPs in introns were more conserved than those in exons across most species and varied from 0.0% (A. melampus) to 50.0% (domestic cattle and zebu). In domestic cattle, zebu, and water buffalo, intronic polymorphism was higher than exonic polymorphism. For C. taurinus and T. angasii, SNPs in intergenic sequences were more conserved compared to those in exons (Table 6).

3.3. Genetic Diversity Indices

Heterozygosity observed (Ho) in the 5′-upstream region ranged from 0.045 to 0.373. The lowest heterozygosity was detected in the genus Tragelaphus (0.045 for T. imbersis and 0.066 for T. angasii), while the highest value was found in the genus Bos (0.223, 0.232, and 0.373 for domestic cattle, zebu, and watusi, respectively). Similar patterns were noted in the casein gene cluster, with the lowest Ho values observed in Tragelaphus (0.042 and 0.093 for T. imbersis and T. angasii, respectively) and the highest in Bos (0.122, 0.151, and 0.188 for domestic cattle, zebu, and watusi, respectively). In the 3′-downstream region, Ho values were highest in the genus Bos (0.143, 0.235, and 0.350 for zebu, watusi, and domestic cattle, respectively), while the lowest values were not observed in the genus Tragelaphus, as might be expected (see above), but were observed in the representatives of three other genera, K. ellipsiprymnus (0.040), H. equinus (0.041), and C. taurinus (0.056). Total fixation index values were negative for all analyzed regions (−0.230, −0.307, and −0.202), indicating an excess of heterozygotes in most cases (Table 6).

3.4. Casein Gene Cluster and Flanking Regions-Based Phylogeny

Phylogenetic reconstruction based on SNPs located in the 5′-upstream region, casein genes cluster, and 3′-downstream region, using genetic distance matrix, yielded two main clusters (Figure 3). One cluster consisted of domestic cattle, watusi, and zebu (Bos cluster), while all remaining species were grouped in the second cluster. On the graph inferred from the casein gene cluster, S. caffer was positioned as a sister taxon to the other Bos taxa (Figure 3B; see also Table S2).

4. Discussion

The genetic polymorphisms of casein genes have been widely studied in domestic cattle [12], water buffaloes [34,35], and goats [24], but data on other bovids remain scarce. For example, in dairy cattle, 10 protein variants for α-S1 casein, 5 for α-S2 casein, 15 for β-casein, and 11 for κ-casein have been documented [36]. In addition to these protein variants, sequence variations have been identified in the upstream and downstream gene regions, which can affect casein gene expression and influence the amount and ratio of different caseins in goat milk [37,38,39,40].
A more comprehensive understanding of the genetic diversity of milk protein genes across a wider range of Bovidae species could offer valuable insights into the evolution of the casein cluster, especially in differentiating wild from domestic bovids. However, this effort has been hindered by the lack of genome-wide SNP data for most wild members of the family and the absence of species-specific SNP microarrays for comparative analysis. Currently, SNP microarrays are only available for domesticated species: domestic cattle, water buffalo [41], and sheep [42]. In this study, the challenge of the missing species-specific SNP microarrays was addressed by using the Illumina Bovine MDv2 Chip. The use of cattle-derived SNP chips proved effective across diverse Bovidae species, with over 83% of SNPs successfully genotyped (Table 2). This finding is consistent with previously reported data; for example, when genotyping water buffalo using the Illumina BovineSNP50 BeadChip, 41,870 of the 54,001 SNPs were successfully genotyped, and 1159 bovine SNPs remained polymorphic in the species [43].
To date, the Illumina BovineSNP50 BeadChip has been successfully applied to genotyping gaur (Bos gaurus), banteng (B. javanicus), yak (B. grunniens), African buffalo (S. caffer), and lowland anoa (Bubalus depressicornis) [44]; European bison (Bison bonasus) and American bison (B. bison) [44,45]; and the scimitar-horned oryx (Oryx dammah) and Arabian oryx (O. leucoryx) [46]. SNPs represented on the Illumina Bovine50K BeadChip are evenly distributed across each cattle chromosome. However, this may not be the case for other species. For instance, in water buffalo, over 14,000 genes lack SNP coverage on the current BeadChip [43]. Conserved cross-species SNPs may limit the chip’s effectiveness in identifying runs of homozygosity (ROH) or estimating linkage disequilibrium (LD) [47]. In our study, 10 randomly chosen Bovine BeadChip probes showed high similarity to genomic sequences of bovids in the range above 86% for at least 98% of the probes (Table 2). This further supports our decision to use this microarray to analyze genetic diversity within the family.
The highest polymorphism levels were found in the genus Bos and lechwe (K. leche) (Table 4), aligning with previous findings of high genetic diversity in cattle and zebu (B. indicus), showing high polymorphism at both the casein gene and whole-genome levels [48,49,50]. In K. leche, the unexpectedly high level of polymorphism, comparable to that of domestic cattle, may be due to the presence of 5 subspecies [51,52], thus contributing significant genetic variability. Similarly, high genetic diversity has been reported in the mitochondrial DNA of the African bushbuck (Tragelaphus scriptus), which also consists of several subspecies [53].
The uniqueness of lechwe may be linked to their adaptations to semi-aquatic wetland environments [54]. They have elongated hooves, a water-repellent coat, and are strong swimmers, using water bodies as a refuge from predators. This wet diet, rich in water and nutrients such as β-carotene, fatty acids, and certain vitamins, can enhance the nutritional quality of their milk by affecting fat content, protein levels, and overall energy. Such a nutrient-rich diet may influence the expression of casein genes and, consequently, the casein content in their milk [55,56]. For wetland-adapted species, there may be evolutionary adaptations that link their diet to milk biosynthesis, ensuring that offspring receive adequate nutrition in a water-rich but potentially less energy-dense environment [57,58]. Interestingly, lechwe milk contains the highest mono-unsaturated fatty acid (MUFA) content among several ruminants [28], which could be particularly beneficial for energy and nutrient absorption, as well as reducing inflammation. The recent sequencing of the red lechwe (K. leche) genome may significantly advance research on this unique species [59].
In our phylogenetic analyses based on SNPs located in the 5′-upstream region and the 3′-downstream region (Figure 3A,C), we identified two main clusters, with one including only members of the genus Bos (domestic cattle, watusi, and zebu). This result is not surprising, as Bos is one of the few bovid genera (along with Bubalus, Capra, Ovis, and Rangifer) that have been extensively domesticated and bred by humans for thousands of years. Bos species are found worldwide and are known for their high genetic diversity and specialized traits, including milk production, meat, draft power, and other uses. Similarly, water buffalo (genus Bubalus), although not included in our study, is another domesticated species heavily relied upon for dairy production, particularly in South Asia, where breeds like the Murrah and Nili-Ravi are known for their high milk yields [41,60,61]. In another analysis based on SNPs located in the casein gene cluster, the Bos cluster was weakly joined by S. caffer (Figure 3B). Although this relationship should be interpreted with caution, the genera Bos and Syncerus share several characteristics and stand out from many other bovid genera due to their large size, grazing habits, social structures, and adaptations to diverse habitats.
In the subfamily Hippotraginae, intraspecies sequence divergence has only been studied in the roan antelope (Hippotragus equinus) [62] and sable antelope (H. niger) [63]. In 5 re-sequenced roan antelopes, 3.4 million single-nucleotide variations (SNVs) were identified, with homozygous SNVs ranging from 577,765 to 949,845 and heterozygous SNVs from 711,962 to 1,043,928 [62]. In contrast, the sable antelope showed lower diversity, with homozygous SNVs between 260,651 and 377,251, and heterozygous SNVs from 464,813 to 597,659 [63].
Associations between polymorphisms of milk-encoding genes and milk production traits have been the focus of numerous studies in dairy cattle, e.g., [64,65,66]. The most notable effects of the milk protein polymorphisms on economically important traits are their influence on casein content and the cheesemaking properties of milk, primarily in modern breeds of dairy cattle [12]. Similar studies, including production traits such as milk yield and milk composition, were also conducted on water buffalo, e.g., [67,68,69]. Differences in gene promoters and enhancers might explain why water buffaloes produce less milk (5 to 10 times less) but higher-quality milk than cattle [43]. Venturini [70] identified 1562 SNPs associated with milk production and/or quality. Asim [67] demonstrated associations between milk yield and genetic variants in the Csn1s1, Csn2, Csn3, and Blg genes in both cattle and water buffaloes. Pauciullo et al. [69] validated and confirmed the association of three SNPs in key genes (Csn1, Csn3, and LPL) with milk yield, protein, and fat. Medeiros [68] reported an association between a SNP located in the promoter region of Csn1s1 at position -258 (A/G) and identified variants that may affect the gene’s expression.
Sequence variation in transcription factor binding sites can alter the timing, location, and level of gene expression. Analysis of 5′-upstream sequences in 28 milk protein genes revealed C/EBP, CTF/NF1, MAF, and MGF (STAT5) transcription factor binding sites in all of them [71,72]. Comparing high-milk-output cattle with low-yield species like sheep and camels showed that YY1 binding sites are more frequent in sheep than in camels and very sparse in cattle, suggesting that the ratio of YY1 sites may influence milk production [73].
A core composite response element, which primarily controls milk protein gene activity, was identified through a search for elements conserved within all 5′-flanking sequences analyzed in cows and camels. This element, which contains two motifs with essential transcription factor binding sites, likely regulates gene expression in the lactating mammary gland [74]. Intragenic sequences of some major milk protein-encoding genes contribute to hormonal regulation and contain important regulatory elements. They have been identified within introns [75,76] and/or in the 3′ untranslated region (UTR) and flanking regions [77].
Although 3′ flanking regions receive less attention than 5′ promoters, they are also important for regulating casein gene expression at the protein level. In the mammary gland, post-transcriptional regulation, particularly mRNA stability, plays a role in milk protein expression. For instance, miR-101a suppresses β-casein mRNA expression during differentiation and involution in mouse mammary tissue and cells [78]. Various miRNAs (e.g., miR-15a, miR-139, miR-423-5p) affect milk protein synthesis by regulating key genes involved in these pathways [79].
Improving dairy traits has long been a key goal of breeding programs, especially in the genomic selection era. Understanding genetic variations in the casein gene cluster, particularly those related to milk biosynthesis, can help breeders select for traits that enhance milk yield, quality, and adaptability. Such advancements contribute to both food security and economic stability. Although our samples offer valuable insights into the genetic diversity of the casein gene cluster, the limited sample size may not fully reflect the broader genetic variation found in wild populations. Future research with larger and more geographically diverse samples will be crucial to validating and extending these findings, providing a more comprehensive understanding of genetic diversity in both wild and domestic Bovidae.

5. Conclusions

The bovine SNP microarray is a powerful tool for studying genetic diversity within the Bovidae family, highlighting variations in the casein gene cluster, particularly in the 5′ flanking region. The observed differences in genetic diversity within the casein gene cluster suggest potential variability in milk protein expression between wild and domestic species, though further studies are needed to directly link these genetic variations to functional outcomes in milk biosynthesis. The relatively low cost of SNP microarrays makes genomic analysis applicable across a wide range of research areas.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14203034/s1, Table S1: Genotypes and annotation of SNPs localized in the casein gene cluster and 2 Mb of upstream and downstream regions; Table S2: Nei’s genetic distances (below the diagonal) and pairwise F-estimates (above the diagonal) among 12 analyzed Bovidae taxa.

Author Contributions

Conceptualization, S.K. and T.M.; methodology, K.O., S.K. and T.M.; software, K.O., S.K. and T.M.; validation, K.O., S.K., T.M. and W.B.; formal analysis, S.K., T.M. and W.B.; investigation, J.Ś., K.O., S.K., T.M. and W.B.; resources, J.Ś. and S.K.; data curation, S.K. and T.M.; writing—original draft preparation, S.K. and T.M.; writing—review and editing, W.B., S.K., T.M. and K.O.; visualization, S.K. and T.M.; supervision, S.K., T.M. and W.B.; project administration, S.K. and T.M.; funding acquisition, S.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science in the program entitled ‘Regional Initiative of Excellence’ (RID/SP/0025/2024/01).

Institutional Review Board Statement

The blood samples used in this study were taken during routine veterinary inspections in 2016–2020 in accordance with animal welfare guidelines (Directive 2010/63/EU) [80]. Since the blood was not specifically drawn for research purposes, but was surplus from the routine procedures, no additional approval from the Ethics Committee was/is needed.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Materials. Further inquiries can be directed to the corresponding author. The raw data supporting the conclusions of this article are available from the first author upon reasonable request.

Acknowledgments

We thank the two reviewers for their comments, which helped shape the final version of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rogiński, H. Encyclopedia of Dairy Sciences; Academic Press: London, UK, 2003. [Google Scholar]
  2. FAO [Food and Agriculture Organization of the United Nations]. Food Outlook—Biannual Report on Global Food Markets; FAO: Rome, Italy, 2021; pp. 52–57. [Google Scholar]
  3. Kawasaki, K.; Lafont, A.-G.; Sire, J.-Y. The evolution of milk casein genes from tooth genes before the origin of Mammals. Mol. Biol. Evol. 2011, 28, 2053–2061. [Google Scholar] [CrossRef] [PubMed]
  4. Rijnkels, M. Multispecies comparison of the casein gene loci and evolution of casein gene family. J. Mammary Gland Biol. Neoplasia 2002, 7, 327–345. [Google Scholar] [CrossRef] [PubMed]
  5. Kaimala, S.; Kumar, S. An evolutionarily conserved non-coding element in casein locus acts as transcriptional repressor. Gene 2015, 554, 75–80. [Google Scholar] [CrossRef] [PubMed]
  6. Rijnkels, M.; Elnitski, L.; Miller, W.; Rosen, J.M. Multispecies comparative analysis of a mammalian-specific genomic domain encoding secretory proteins. Genomics 2003, 82, 417–432. [Google Scholar] [CrossRef] [PubMed]
  7. Rehman, S.U.; Feng, T.; Wu, S.; Luo, X.; Lei, A.; Luobu, B.; Hassan, F.U.; Liu, Q. Comparative genomics, evolutionary and gene regulatory regions analysis of casein gene family in Bubalus bubalis. Front. Genet. 2021, 12, 662609. [Google Scholar] [CrossRef]
  8. Cosenza, G.; Feligini, M.; Mancusi, A.; D’Avino, A.; Coletta, A.; Di Bernardino, D.; Ramunno, L. Italian Mediterranean river buffalo CSN2 gene structure and promoter analysis. Ital. J. Anim. Sci. 2009, 8 (Suppl. 2), 57–59. [Google Scholar] [CrossRef]
  9. Cosenza, G.; Gallo, D.; Auzino, B.; Gaspa, G.; Pauciullo, A. Complete CSN1S2 characterization, novel allele identification and association with milk fatty acid composition in river buffalo. Front. Genet. 2021, 11, 622494. [Google Scholar] [CrossRef]
  10. Vincent, S.T.; Momoh, O.M.; Yakubu, A. Bioinformatics analysis of beta-casein gene in some selected mammalian species. Res. Opin. Anim. Vet. Sci. 2014, 4, 564–570. [Google Scholar]
  11. Ward, T.J.; Honeycutt, R.L.; Derr, J.N. Nucleotide sequence evolution at the kappa-casein locus: Evidence for positive selection within the family Bovidae. Genetics 1997, 147, 1863–1872. [Google Scholar] [CrossRef]
  12. Caroli, A.M.; Chessa, S.; Erhardt, G.J. Invited review: Milk protein polymorphisms in cattle: Effect on animal breeding and human nutrition. J. Dairy Sci. 2009, 92, 5335–5352. [Google Scholar] [CrossRef]
  13. Wickramasinghe, S.; Rincon, G.; Islas-Trejo, A.; Medrano, J.F. Transcriptional profiling of bovine milk using RNA sequencing. BMC Genom. 2012, 13, 45. [Google Scholar] [CrossRef] [PubMed]
  14. Qian, X.; Zhao, F.Q. Current major advances in the regulation of milk protein gene expression. Crit. Rev. Eukaryot. Gene Expr. 2014, 24, 357–378. [Google Scholar] [CrossRef] [PubMed]
  15. Lee, H.K.; Willi, M.; Liu, C.; Hennighausen, L. Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat. Commun. 2023, 14, 4992. [Google Scholar] [CrossRef] [PubMed]
  16. Threadgill, D.W.; Womack, J.E. 1990. Genomic analysis of the major bovine milk protein genes. Nucleic Acids Res. 1990, 18, 6935–6942. [Google Scholar] [CrossRef]
  17. Ryskaliyeva, A.; Henry, C.; Miranda, G.; Faye, B.; Konuspayeva, G.; Martin, P. Alternative splicing events expand molecular diversity of camel CSN1S2 increasing its ability to generate potentially bioactive peptides. Sci. Rep. 2019, 9, 5243. [Google Scholar] [CrossRef]
  18. Pauciullo, A.; Shuiep, E.T.; Ogah, M.D.; Cosenza, G.; Di Stasio, L.; Erhardt, G. Casein gene cluster in camelids: Comparative genome analysis and new findings on haplotype variability and physical mapping. Front. Genet. 2019, 10, 748. [Google Scholar] [CrossRef]
  19. Keating, A.F.; Davoren, P.; Smith, T.J.; Ross, R.P.; Cairns, M.T. Bovine kappa-casein gene promoter haplotypes with potential implications for milk protein expression. J. Dairy Sci. 2007, 90, 4092–4099. [Google Scholar] [CrossRef]
  20. Kishore, A.; Mukesh, M.; Sobti, R.C.; Kataria, R.S.; Mishra, B.P.; Sodhi, M. Analysis of genetic variations across regulatory and coding regions of kappa-casein gene of Indian native cattle (Bos indicus) and buffalo (Bubalus bubalis). Meta Gene 2014, 2, 769–781. [Google Scholar] [CrossRef]
  21. Wilson, D.E.; Reeder, D.M. (Eds.) Mammal Species of the World: A Taxonomic and Geographic Reference, 3rd ed.; Johns Hopkins University Press: Baltimore, MD, USA, 2005. [Google Scholar]
  22. Kuznetsov, S.B.; Solodneva, E.V.; Semina, M.T.; Beketov, S.V.; Turbina, I.S.; Stolpovsky, Y.A. New combinations of alleles in the variants of the cluster of bovine casein genes and revision of the nomenclature of these genes. Russ. J. Genet. 2022, 58, 915–926. [Google Scholar] [CrossRef]
  23. Ahmed, A.S.; Rahmatalla, S.; Bortfeldt, R.; Arends, D.; Reissmann, M.; Brockmann, G.A. Milk protein polymorphisms and casein haplotypes in Butana cattle. J. Appl. Genet. 2017, 58, 261–271. [Google Scholar] [CrossRef]
  24. Rahmatalla, S.A.; Arends, D.; Brockmann, G.A. Review: Genetic and protein variants of milk caseins in goats. Front. Genet. 2022, 13, 995349. [Google Scholar] [CrossRef] [PubMed]
  25. Luigi-Sierra, M.G.; Mármol-Sánchez, E.; Amills, M. Comparing the diversity of the casein genes in the Asian mouflon and domestic sheep. Anim. Genet. 2020, 51, 470–475. [Google Scholar] [CrossRef] [PubMed]
  26. Osthoff, G.; Hugo, A.; De Wit, M. Milk composition of free-ranging sable antelope (Hippotragus niger). Mamm. Biol. 2007, 72, 116–122. [Google Scholar] [CrossRef]
  27. Osthoff, G.; Hugo, A.; De Wit, M. Comparison of the milk composition of free-ranging blesbok, black wildebeest and blue wildebeest of the subfamily Alcelaphinae (family: Bovidae). Comp. Biochem. Physiol. B 2009, 154, 48–54. [Google Scholar] [CrossRef] [PubMed]
  28. Osthoff, G.; Hugo, A.; De Wit, M. Comparison of the milk composition of free-ranging eland and kudu (subfamily Bovinae, tribe Tragelaphini), and gemsbok and scimitar oryx (subfamily Hippotraginae) with observations on lechwe, okapi and Southern pudu. S. Afr. J. Wildl. Res. 2012, 42, 23–34. [Google Scholar] [CrossRef]
  29. Osthoff, G.; Hugo, A.; Madende, M.; Schmidt, L.; Kobeni, S.; Deacon, F. Milk composition of free-ranging impala (Aepyceros melampus) and tsessebe (Damaliscus lunatus lunatus), and comparison with other African Bovidae. Animals 2021, 11, 516. [Google Scholar] [CrossRef]
  30. Illumina, Inc. GenomeStudio Software, Version 2011.1; Illumina, Inc.: San Diego, CA, USA, 2011.
  31. Peakall, R.; Smouse, P.E. GenALEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–2295. [Google Scholar] [CrossRef]
  32. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  33. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  34. Fan, X.; Gao, S.; Fu, L.; Qiu, L.; Miao, Y. Polymorphism and molecular characteristics of the CSN1S2 gene in river and swamp buffalo. Arch. Anim. Breed. 2020, 63, 345–354. [Google Scholar] [CrossRef]
  35. Khan, K.; Suhail, S.M.; Khan, R.; Ahmed, I.; Khan, F.A.; Khan, M.J. Genetic polymorphism of Β-casein gene and its association with milk production and composition in Azi-Kheli buffalo. Trop. Anim. Health Prod. 2023, 55, 94. [Google Scholar] [CrossRef] [PubMed]
  36. Meier, S.; Korkuć, P.; Arends, D.; Brockmann, G.A. DNA sequence variants and protein haplotypes of casein genes in german black pied cattle (DSN). Front. Genet. 2019, 10, 1129. [Google Scholar] [CrossRef] [PubMed]
  37. Pérez, M.J.; Leroux, C.; Bonastre, A.S.; Martin, P. Occurrence of a LINE sequence in the 3′ UTR of the goat alpha s1-casein E-encoding allele associated with reduced protein synthesis level. Gene 1994, 147, 179–187. [Google Scholar] [CrossRef] [PubMed]
  38. Najafi, M.; Rahimi Mianji, G.; Ansari Pirsaraie, Z. Cloning and comparative analysis of gene structure in promoter site of alpha-s1 casein gene in Naeinian goat and sheep. Meta Gene 2014, 2, 854–861. [Google Scholar] [CrossRef] [PubMed]
  39. Cosenza, G.; Iannaccone, M.; Pico, B.A.; Ramunno, L.; Capparelli, R. The SNP g.1311T>C associated with the absence of β-casein in goat milk influences CSN2 promoter activity. Anim. Genet. 2016, 47, 615–617. [Google Scholar] [CrossRef]
  40. Lewerentz, F.; Vanhala, T.K.; Johansen, L.B.; Paulsson, M.; Glantz, M.; de Koning, D.J. Re-sequencing of the casein genes in Swedish Red cattle giving milk with diverse protein profiles and extreme rennet coagulation properties. JDS Commun. 2024, 5, 299–304. [Google Scholar] [CrossRef]
  41. Iamartino, D.; Nicolazzi, E.L.; Van Tassell, C.P.; Reecy, J.M.; Fritz-Waters, E.R.; Koltes, J.E. Design and validation of a 90K SNP genotyping assay for the water buffalo (Bubalus bubalis). PLoS ONE 2017, 12, e0185220. [Google Scholar] [CrossRef]
  42. Usai, M.G.; Casu, S.; Sechi, T.; Salaris, S.L.; Miari, S.; Sechi, S.; Carta, P.; Carta, A. Mapping genomic regions affecting milk traits in Sarda sheep by using the OvineSNP50 Beadchip and principal components to perform combined linkage and linkage disequilibrium analysis. Genet. Sel. Evol. 2019, 51, 65. [Google Scholar] [CrossRef]
  43. Michelizzi, V.N.; Wu, X.; Dodson, M.V.; Michal, J.J.; Zambrano-Varon, J.; McLean, D.J.; Jiang, Z. A global view of 54,001 single nucleotide polymorphisms (SNPs) on the Illumina Bovine SNP50 BeadChip and their transferability to water buffalo. Int. J. Biol. Sci. 2010, 7, 18–27. [Google Scholar] [CrossRef]
  44. Matukumalli, L.K.; Lawley, C.T.; Schnabel, R.D.; Taylor, J.F.; Allan, M.F.; Heaton, M.P.; O’Connell, J.; Moore, S.S.; Smith, T.P.; Sonstegard, T.S.; et al. Development and characterization of a high density SNP genotyping assay for cattle. PLoS ONE 2009, 4, e5350. [Google Scholar] [CrossRef]
  45. Pertoldi, C.; Wójcik, J.M.; Tokarska, M.; Kawałko, A.; Kristensen, T.N.; Loeschcke, V.; Gregersen, V.R.; Coltman, D.; Wilson, G.A.; Randi, E.; et al. Genome variability in European and American bison detected using BovineSNP50 BeadChip. Conserv. Genet. 2010, 11, 627–634. [Google Scholar] [CrossRef]
  46. Ogden, R.; Baird, J.; Senn, H.; McEwing, R. The use of cross-species genome-wide arrays to discover SNP markers for conservation genetics: A case study from Arabian and scimitar-horned oryx. Conserv. Genet. Resour. 2012, 4, 471–473. [Google Scholar] [CrossRef]
  47. Shafer, A.B.; Miller, J.M.; Kardos, M. Cross-species application of SNP chips is not suitable for identifying runs of homozygosity. J. Hered. 2016, 107, 193–195. [Google Scholar] [CrossRef] [PubMed]
  48. Giovambattista, G.; Ripoli, M.V.; Peral-Garcia, P.; Bouzat, J.L. Indigenous domestic breeds as reservoirs of genetic diversity: The Argentinean Creole cattle. Anim. Genet. 2001, 32, 240–247. [Google Scholar] [CrossRef]
  49. Cañas-Álvarez, J.J.; González-Rodríguez, A.; Munilla, S.; Varona, L.; Díaz, C.; Baro, J.A.; Altarriba, J.; Molina, A.; Piedrafita, J. Genetic diversity and divergence among Spanish beef cattle breeds assessed by a bovine high-density SNP chip. J. Anim. Sci. 2015, 93, 5164–5174. [Google Scholar] [CrossRef]
  50. Corredor, F.A.; Figueroa, D.; Estrada, R.; Salazar, W.; Quilcate, C.; Vásquez, H.V.; Gonzales, J.; Maicelo, J.L.; Medina, P.; Arbizu, C.I. Genetic diversity and population structure of a Peruvian cattle herd using SNP data. Front. Genet. 2023, 14, 1073843. [Google Scholar] [CrossRef]
  51. Cotterill, F.P.D. The Upemba lechwe, Kobus anselli: An antelope new to science emphasizes the conservation importance of Katange, Democratic Republic of Congo. J. Zool. 2005, 265, 113–132. [Google Scholar] [CrossRef]
  52. IUCN SSC Antelope Specialist Group. Kobus leche. The IUCN Red List of Threatened Species: E.T11033A50189021. 2017. Available online: https://www.iucnredlist.org/species/11033/50189021 (accessed on 3 September 2024).
  53. Moodley, Y.; Bruford, M.W. Molecular biogeography: Towards an integrated framework for conserving pan-African biodiversity. PLoS ONE 2007, 2, e454. [Google Scholar] [CrossRef]
  54. Nefdt, R.J.C. Reproductive seasonality in Kafue lechwe antelope. J. Zool. 1996, 238, 155–166. [Google Scholar] [CrossRef]
  55. Coulon, J.B.; Dupont, D.; Pochet, S.; Pradel, P.; Duployer, H. Effect of genetic potential and level of feeding on milk protein composition. J. Dairy Res. 2001, 68, 569–577. [Google Scholar] [CrossRef]
  56. Li, B.; Khan, M.Z.; Khan, I.M.; Ullah, Q.; Cisang, Z.M.; Zhang, N.; Wu, D.; Huang, B.; Ma, Y.; Khan, A.; et al. Genetics, environmental stress, and amino acid supplementation affect lactational performance via mTOR signaling pathway in bovine mammary epithelial cells. Front. Genet. 2023, 14, 1195774. [Google Scholar] [CrossRef] [PubMed]
  57. Vesey-Fitzgerald, L.D.E.F. Lechwe pastures. Puku 1965, 3, 143–147. [Google Scholar]
  58. Cotterill, F.P.D. Reduncine antelope of the Zambezi basin. In Biodiversity of the Zambezi Basin Wetlands; Timberlake, J.R., Ed.; Biodiversity Foundation for Africa: Bulawayo, Zimbabwe; Zambezi Society: Harare, Zimbabwe, 2000; pp. 145–199. [Google Scholar]
  59. Wang, B.; Wang, Z.; Zhou, J.; Liu, W.; Lin, Z.; Zhang, C.; Liu, G.; Zhou, B.; Wan, W.; Zhao, R.; et al. The draft genome of red lechwe, Kobus leche leche. Front. Genet. 2020, 11, 582638. [Google Scholar] [CrossRef] [PubMed]
  60. George, L.; Alex, R.; Gowane, G.; Vohra, V.; Joshi, P.; Kumar, R.; Verma, A. Weighted single step GWAS reveals genomic regions associated with economic traits in Murrah buffaloes. Anim. Biotechnol. 2024, 35, 2319622. [Google Scholar] [CrossRef] [PubMed]
  61. Lázaro, S.F.; Tonhati, H.; Oliveira, H.R.; Silva, A.A.; Scalez, D.C.B.; Nascimento, A.V.; Santos, D.J.A.; Stefani, G.; Carvalho, I.S.; Sandoval, A.F.; et al. Genetic parameters and genome-wide association studies for mozzarella and milk production traits, lactation length, and lactation persistency in Murrah buffaloes. J. Dairy Sci. 2024, 107, 992–1021. [Google Scholar] [CrossRef]
  62. Gonçalves, M.; Siegismund, H.R.; van Vuuren, B.J.; Koepfli, K.-P.; Ferrand, N.; Godinho, R. De novo whole-genome assembly and resequencing resources for the roan (Hippotragus equinus), an iconic African antelope. G3 2021, 11, jkab002. [Google Scholar] [CrossRef]
  63. Koepfli, K.P.; Tamazian, G.; Wildt, D.; Dobrynin, P.; Kim, C.; Frandsen, P.B.; Godinho, R.; Yurchenko, A.A.; Komissarov, A.; Krasheninnikova, K.; et al. Whole genome sequencing and re-sequencing of the sable antelope (Hippotragus niger): A resource for monitoring diversity in ex situ and in situ populations. G3 2019, 9, 1785–1793. [Google Scholar] [CrossRef]
  64. Fang, Z.H.; Bovenhuis, H.; van Valenberg, H.J.F.; Martin, P.; Duchemin, S.I.; Huppertz, T.; Visker, M.H.P.W. Genome-wide association study for αS1- and αS2-casein phosphorylation in Dutch Holstein Friesian. J. Dairy Sci. 2019, 102, 1374–1385. [Google Scholar] [CrossRef]
  65. Mahmoudi, P.; Rostamzadeh, J.; Rashidi, A.; Zergani, E.; Razmkabir, M. A meta-analysis on association between CSN3 gene variants and milk yield and composition in cattle. Anim. Genet. 2020, 51, 369–381. [Google Scholar] [CrossRef]
  66. Ozdemir, M.; Motmain, Z.; Ekinci, K.; Saygılı, E. Associations between BLG, CSN3, DGAT1, GH, PIT1, and PRL gene polymorphisms and milk production traits in Holstein dairy cows: A meta-analysis. Biochem. Genet. 2024. [Google Scholar] [CrossRef]
  67. Asim, M.; Saif-ur Rehman, M.; Hassan, F.-u.; Awan, F.S. Genetic variants of CSN1S1, CSN2, CSN3, and BLG genes and their association with dairy production traits in Sahiwal cattle and Nili-Ravi buffaloes. Anim. Biotechnol. 2023, 34, 2951–2962. [Google Scholar] [CrossRef] [PubMed]
  68. Medeiros, N.B.C.; Guerreiro, S.L.M.; Pereira, R.S.R.; Sá, A.L.; Rodrigues, M.; Mezzomo, R.; Maciel, R.P.; Hamoy, I.G.; Rodrigues, M.D.N. CSN1S1 and CSN3 gene variants in female Murrah buffaloes in the Brazilian Amazon. An. Acad. Bras. Cienc. 2022, 94 (Suppl. 3), e20211394. [Google Scholar] [CrossRef] [PubMed]
  69. Pauciullo, A.; Gaspa, G.; Zhang, Y.; Liu, Q.; Cosenza, G. CSN1S1, CSN3 and LPL: Three validated gene polymorphisms useful for more sustainable dairy production in the Mediterranean river buffalo. Animals 2024, 14, 1414. [Google Scholar] [CrossRef] [PubMed]
  70. Venturini, G.C.; Cardoso, D.F.; Baldi, F.; Freitas, A.C.; Aspilcueta-Borquis, R.R.; Santos, D.J.; Camargo, G.M.; Stafuzza, N.B.; Albuquerque, L.G.; Tonhati, H. Association between single-nucleotide polymorphisms and milk production traits in buffalo. Genet. Mol. Res. 2014, 13, 10256–10268. [Google Scholar] [CrossRef] [PubMed]
  71. Malewski, T.; Zwierzchowski, L. Computer-aided analysis of potential transcription–factor binding sites in the rabbit β–casein gene promoter. BioSystems 1995, 36, 109–119. [Google Scholar] [CrossRef]
  72. Malewski, T. Computer analysis of distribution of putative cis- and trans-regulatory elements in milk protein gene promoters. BioSystems 1998, 45, 29–44. [Google Scholar] [CrossRef]
  73. Parveen, S.; Zhu, P.; Shafique, L.; Lan, H.; Xu, D.; Ashraf, S.; Sherazi, M.; Liu, Q. Molecular characterization and phylogenetic analysis of casein gene family in Camelus ferus. Genes 2023, 14, 256. [Google Scholar] [CrossRef]
  74. Kappeler, S.R.; Farah, Z.; Puhan, Z. 5′-flanking regions of camel milk genes are highly similar to homologue regions of other species and can be divided into two distinct groups. J. Dairy Sci. 2003, 86, 498–508. [Google Scholar] [CrossRef]
  75. Kang, Y.K.; Lee, C.S.; Chung, A.S.; Lee, K.K. Prolactin-inducible enhancer activity of the first intron of the bovine beta-casein gene. Mol. Cells. 1998, 8, 259–265. [Google Scholar] [CrossRef]
  76. Kolb, A. The first intron of the murine beta-casein gene contains a functional promoter. Biochem. Biophys. Res. Commun. 2003, 306, 1099–1105. [Google Scholar] [CrossRef]
  77. Song, N.; Luo, J.; Huang, L.; Tian, H.; Chen, Y.; He, Q. miR-204-5p and miR-211 synergistically downregulate the αS1-casein content and contribute to the lower allergy of goat milk. J. Agric. Food Chem. 2021, 69, 5353–5362. [Google Scholar] [CrossRef] [PubMed]
  78. Tanaka, T.; Haneda, S.; Imakawa, K.; Sakai, S.; Nagaoka, K. A microRNA, miR-101a, controls mammary gland development by regulating cyclooxygenase-2 expression. Differentiation 2009, 77, 181–187. [Google Scholar] [CrossRef] [PubMed]
  79. Cai, W.; Li, C.; Li, J.; Song, J.; Zhang, S. Integrated Small RNA Sequencing, Transcriptome and GWAS Data reveal microRNA regulation in response to milk protein traits in Chinese Holstein cattle. Front. Genet. 2021, 12, 726706. [Google Scholar] [CrossRef] [PubMed]
  80. Directive 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes. Off. J. Eur. Union 2010, L 267, 33–79.
Animals 14 03034 g001
Figure 1. Bovidae taxa included in the analysis of casein gene cluster diversity: (A) impala (Aepyceros melampus), (B) blue wildebeest (Connochaetes taurinus), (C) domestic cattle (Bos taurus taurus, Holstein–Friesian breed), (D) watusi (B. t. taurus), (E) zebu (Bos indicus), (F) African buffalo (Syncerus caffer caffer), (G) African forest buffalo (S. c. nanus), (H) nyala (Tragelaphus angassi), (I) lesser kudu (T. imbersis), (J) roan antelope (Hippotragus equinus), (K) sable antelope (H. niger), (L) red lechwe (Kobus leche), and (M) waterbuck (K. ellipsiprymnus). Photographs: (A,B,D–M)—J. Śmiełowski; (C)—M. Marciniak.
Figure 1. Bovidae taxa included in the analysis of casein gene cluster diversity: (A) impala (Aepyceros melampus), (B) blue wildebeest (Connochaetes taurinus), (C) domestic cattle (Bos taurus taurus, Holstein–Friesian breed), (D) watusi (B. t. taurus), (E) zebu (Bos indicus), (F) African buffalo (Syncerus caffer caffer), (G) African forest buffalo (S. c. nanus), (H) nyala (Tragelaphus angassi), (I) lesser kudu (T. imbersis), (J) roan antelope (Hippotragus equinus), (K) sable antelope (H. niger), (L) red lechwe (Kobus leche), and (M) waterbuck (K. ellipsiprymnus). Photographs: (A,B,D–M)—J. Śmiełowski; (C)—M. Marciniak.
Animals 14 03034 g001
Animals 14 03034 g002
Figure 2. Example of the cluster quality of a single SNP in the Illumina Bovine EuroG_MDv2 Chip, located within the casein α-S1 gene (Csn1s1). Dots of different colors represent individuals from different Bovidae taxa. The clusters are clearly separated into three distinct areas, indicating that clustering is unambiguous and SNP genotypes were identified reliably. To enhance cluster quality, Bovidae species were analyzed alongside a large number of B. taurus (Holstein breed) individuals (blue dots).
Figure 2. Example of the cluster quality of a single SNP in the Illumina Bovine EuroG_MDv2 Chip, located within the casein α-S1 gene (Csn1s1). Dots of different colors represent individuals from different Bovidae taxa. The clusters are clearly separated into three distinct areas, indicating that clustering is unambiguous and SNP genotypes were identified reliably. To enhance cluster quality, Bovidae species were analyzed alongside a large number of B. taurus (Holstein breed) individuals (blue dots).
Animals 14 03034 g002
Animals 14 03034 g003
Figure 3. The dendrogram of the Bovidae species based on the Nei unbiased genetic distance inferred from SNPs located in the (A) 5′-upstream region, (B) casein gene cluster, and (C) 3′-downstream region.
Figure 3. The dendrogram of the Bovidae species based on the Nei unbiased genetic distance inferred from SNPs located in the (A) 5′-upstream region, (B) casein gene cluster, and (C) 3′-downstream region.
Animals 14 03034 g003
Table 1. Probes selected to test their similarity to the genome sequences of Bovidae.
Table 1. Probes selected to test their similarity to the genome sequences of Bovidae.
Probe NameSequence
EuroG10K_Hapmap 60224CCAACCAGAGGTCCACCAGAGTCACCCTAGAGAGAAAAGGATATATATAA
Hapmap 59186CCATGTGAGTGTCAATGTTGGCTTGAACAGTGTTGTTTTCCTGGCAACCA
Hapmap 25708-BTC-043671CTAGAAGTCCTCCTGAGAAGACATAAGAGAAAAGCCAAAGACACTGTCAT
Hapmap 24184-BTC-070077GAGCACAACAAATTATAACTGCAAAGCATCAAAAAGACCACATCAAACAC
BTA-111108-no-rsTTAATAAACAGTAAAGGTCAGGCAGATGGTCCCTCTCCCTCACATATTCA
Hapmap 52348TACTTTCCACCTTATTTATTACCCAGAGCCACACAGTTAAGCAAGCGATT
BTA-77173-no-rsGCATACAGGATAAATTATAAATGTGTGCCCATTATAATAAGGCCTGCAAA
ARS-BFGL-NGS-2418GTTTTTGTTTTTTATTTCACTTTCAGGAAGGCCCACTACAATGGCAGAGT
BTA-118117AAATAAGATGTGATGTTTAAGAGACACTGATGGAACCTGGTGCTTATTTA
BTB-00268331CGCCTGGCAAGAACTGCCATCCTAAAACATACCCAAAGTTGCCTTGGATT
Table 2. Identity (%) of the Illumina bovine probe with genomic DNA of different Bovidae species.
Table 2. Identity (%) of the Illumina bovine probe with genomic DNA of different Bovidae species.
SpeciesGenBank Accession NoEuroG10KHapmap 60224Hapmap 59186Hapmap 25708-BTC-043671Hapmap 24184-BTC-070077Hapmap 25779-BTC-072896Hapmap 52348BTA-77173-no-rsARS-BFGL-NGS-2418BTA-118117BTB-00268331
B. indicusGCF_000247795.11001001009698100100100100100
A. melampusGCA_006408695.1100969694ns9296 **9086 **92
C. taurinusGCA_006408615.11009690 **94 **9293 * (80)9692 * (60)90 **92
S. cafferGCA_006408785.298969610098981009810088
T. imberbisGCA_006410775.198889494929498929492 * (80)
H. nigerGCA_006942125.11009892929098929294 * (60)92
K. lecheGCA_014926565.110096949294 * (80)989892 * (80)94 * (40)90
K. ellipsiprymnusGCA_006410655.1100969492 * (80)94981009294 * (20)88
*―SNP called only in a portion of samples (in parentheses, % of samples), ns―no-call in all samples, **―nucleotide non-compatible with the genomic sequence at the probe 3′ end.
Table 3. Similarity of the probe Hapmap 24184-BTC-070077 sequence to analyze genomic sequences. The 3′-nucleotide is underlined, and the sequence of C. taurinus with an incompatible last 3′-nucleotide is shaded.
Table 3. Similarity of the probe Hapmap 24184-BTC-070077 sequence to analyze genomic sequences. The 3′-nucleotide is underlined, and the sequence of C. taurinus with an incompatible last 3′-nucleotide is shaded.
SpeciesProbe Sequence
B. taurusGAGCACAACAAATTATAACTGCAAAGCATCAAAAAGACCACATCAAACAC
B. indicus........................................Y.W.......
A. melampus...G............G.........................C.......
C. taurinus...G............G................................T
S. caffer..................................................
T. imberbis...............CG..A..............................
H. niger...G....A.......G...T.............................
K. leche................G..........T..........TG..........
K. ellipsiprymnus................G..........T..........TG..........
Table 4. SNP call rates (%) in 12 analyzed taxa. Note that domestic cattle and watusi belong to the same species, B. taurus.
Table 4. SNP call rates (%) in 12 analyzed taxa. Note that domestic cattle and watusi belong to the same species, B. taurus.
SpeciesnCall Rate
All SNPsCasein Gene Cluster
A. melampus583.082.9
C. taurinus585.184.2
Domestic cattle12100.0100.0
Watusi598.398.0
B. indicus (zebu)599.599.5
S. caffer995.094.5
T. angasii588.787.5
T. imberbis689.687.6
H. equinus587.187.1
H. niger587.987.6
K. leche583.184.0
K. ellipsiprymnus583.383.6
Table 5. Percentage of polymorphic loci in the casein gene cluster and its 5′-upstream and 3′-dowstream regions in individual species and genera. Note that domestic cattle and watusi belong to the same species, B. taurus.
Table 5. Percentage of polymorphic loci in the casein gene cluster and its 5′-upstream and 3′-dowstream regions in individual species and genera. Note that domestic cattle and watusi belong to the same species, B. taurus.
Taxon5′-Upstream
Total		Casein Gene Cluster3′-Downstream
Total
TotalExonsIntronsIntergenic
Species
A. melampus13.648.898.570.0028.578.51
C. taurinus27.2717.7820.0016.6714.296.38
Domestic cattle68.1837.7834.2950.0071.4389.36
Watusi68.1840.0037.1433.3357.1453.19
B. indicus (zebu)63.6435.5628.5750.0042.8640.43
S. caffer18.1815.5614.2916.6728.578.51
T. imberbis9.0911.1114.290.0014.298.51
T. angasii18.1820.0022.8616.670.0010.64
H. equinus22.7315.5617.140.0028.576.38
H. niger18.1815.5617.140.0028.576.38
K. leche54.5555.5657.1433.3371.4336.17
K. ellipsiprymnus9.0913.3314.290.0028.574.26
Genus
Bos90.9155.5651.4350.0085.7191.49
Tragelaphus18.1826.6728.5716.6728.5717.02
Hippotragus22.7220.0022.860.0028.578.51
Kobus54.5460.0062.8633.3371.4338.30
Mean30.4222.5622.6416.6731.8721.27
SE6.624.073.785.346.307.20
Table 6. Summary of the genetic diversity indices (mean ± SE) of (A) 22 SNPs in the 5′-upstream region, (B–E) 45 SNPs in the casein gene cluster, and (F) 47 SNPs in the 3′-downstream region. Note that domestic cattle and watusi belong to the same species, B. taurus.
Table 6. Summary of the genetic diversity indices (mean ± SE) of (A) 22 SNPs in the 5′-upstream region, (B–E) 45 SNPs in the casein gene cluster, and (F) 47 SNPs in the 3′-downstream region. Note that domestic cattle and watusi belong to the same species, B. taurus.
TaxonHoHeuHeFst
A. 5′-upstream region
A. melampus0.121 ± 0.0680.066 ± 0.0360.077 ± 0.042−0.833 ± 0.062
C. taurinus0.205 ± 0.0850.123 ± 0.0440.186 ± 0.072−0.556 ± 0.172
Domestic cattle0.223 ± 0.0510.230 ± 0.0450.240 ± 0.0470.028 ± 0.078
Watusi0.373 ± 0.0750.275 ± 0.0450.309 ± 0.051−0.322 ± 0.104
B. indicus (zebu)0.232 ± 0.0500.197 ± 0.0390.220 ± 0.043−0.164 ± 0.058
S. caffer0.091 ± 0.0630.083 ± 0.0390.109 ± 0.0550.000 ± 0.246
T. angasii0.066 ± 0.0470.055 ± 0.0280.062 ± 0.031−0.063 ± 0.175
T. imberbis0.045 ± 0.0450.037 ± 0.0260.041 ± 0.0290.000 ± 0.302
H. equinus0.152 ± 0.0750.105 ± 0.0430.144 ± 0.062−0.333 ± 0.201
H. niger0.125 ± 0.0650.072 ± 0.0350.106 ± 0.055−0.619 ± 0.095
K. leche0.232 ± 0.0770.196 ± 0.0440.249 ± 0.061−0.069 ± 0.163
K. ellipsiprymnus0.091 ± 0.0630.045 ± 0.0310.052 ± 0.036−1.000 ± 0.000
Total0.163 ± 0.0190.124 ± 0.0120.150 ± 0.015−0.230 ± 0.039
B. Total casein gene cluster
A. melampus0.089 ± 0.0430.044 ± 0.0210.074 ± 0.037−1.000 ± 0.000
C. taurinus0.172 ± 0.0560.088 ± 0.0290.141 ± 0.048−0.950 ± 0.021
Domestic cattle0.122 ± 0.0290.112 ± 0.0260.117 ± 0.027−0.082 ± 0.023
Watusi0.188 ± 0.0420.151 ± 0.0300.169 ± 0.034−0.227 ± 0.065
B. indicus (zebu)0.151 ± 0.0360.124 ± 0.0270.138 ± 0.030−0.200 ± 0.050
S. caffer0.077 ± 0.0350.047 ± 0.0190.057 ± 0.024−0.429 ± 0.065
T. angasii0.093 ± 0.0380.061 ± 0.0210.079 ± 0.030−0.349 ± 0.077
T. imberbis0.042 ± 0.0240.033 ± 0.0160.040 ± 0.019−0.196 ± 0.075
H. equinus0.104 ± 0.0440.064 ± 0.0230.094 ± 0.037−0.492 ± 0.113
H. niger0.144 ± 0.0520.075 ± 0.0260.122 ± 0.044−0.905 ± 0.038
K. leche0.150 ± 0.0400.175 ± 0.0260.207 ± 0.0320.196 ± 0.106
K. ellipsiprymnus0.122 ± 0.0480.064 ± 0.0250.104 ± 0.042−0.889 ± 0.041
Total0.118 ± 0.0110.083 ± 0.0070.110 ± 0.010−0.307 ± 0.024
C. Exon casein gene cluster
A. melampus0.086 ± 0.0480.043 ± 0.0240.067 ± 0.038−1.000 ± 0.000
C. taurinus0.193 ± 0.0660.099 ± 0.0340.153 ± 0.055−0.943 ± 0.026
Domestic cattle0.088 ± 0.0260.089 ± 0.0270.093 ± 0.028−0.013 ± 0.015
Watusi0.171 ± 0.0470.138 ± 0.0330.154 ± 0.037−0.225 ± 0.076
B. indicus (zebu)0.109 ± 0.0330.093 ± 0.0270.104 ± 0.030−0.160 ± 0.045
S. caffer0.085 ± 0.0440.048 ± 0.0240.059 ± 0.030−0.545 ± 0.079
T. angasii0.114 ± 0.0480.073 ± 0.0260.095 ± 0.037−0.379 ± 0.092
T. imberbis0.054 ± 0.0300.042 ± 0.0200.051 ± 0.024−0.196 ± 0.085
H. equinus0.106 ± 0.0490.068 ± 0.0270.092 ± 0.039−0.407 ± 0.134
H. niger0.157 ± 0.0610.082 ± 0.0310.138 ± 0.054−0.889 ± 0.046
K. leche0.155 ± 0.0480.187 ± 0.0300.222 ± 0.0370.239 ± 0.126
K. ellipsiprymnus0.129 ± 0.0560.068 ± 0.0290.106 ± 0.047−0.867 ± 0.050
Total0.121 ± 0.0140.086 ± 0.0080.111 ± 0.011−0.284 ± 0.030
D. Intron casein gene cluster
A. melampus0.0000.0000.000
C. taurinus0.167 ± 0.1670.083 ± 0.0830.167 ± 0.167−1.000 ± 0.167
Domestic cattle0.250 ± 0.1200.190 ± 0.0890.198 ± 0.093−0.302 ± 0.037
Watusi0.200 ± 0.1260.140 ± 0.0890.156 ± 0.098−0.429 ± 0.000
B. indicus (zebu)0.333 ± 0.1610.213 ± 0.0980.237 ± 0.109−0.528 ± 0.098
S. caffer0.056 ± 0.0560.046 ± 0.0460.056 ± 0.056−0.200 ± 0.056
T. angasii0.033 ± 0.0330.030 ± 0.0300.033 ± 0.033−0.111 ± 0.033
T. imberbis0.0000.0000.000
H. equinus0.0000.0000.000
H. niger0.0000.0000.000
K. leche0.042 ± 0.0420.090 ± 0.0580.101 ± 0.0650.429 ± 0.330
K. ellipsiprymnus0.0000.0000.000
Total0.090 ± 0.0270.066 ± 0.0180.079 ± 0.022−0.292 ± 0.055
E. Intergenic casein gene cluster
A. melampus0.286 ± 0.1840.143 ± 0.0920.238 ± 0.158−1.000 ± 0.000
C. taurinus0.143 ± 0.1430.071 ± 0.0710.143 ± 0.143−1.000 ± 0.143
Domestic cattle0.226 ± 0.0770.219 ± 0.0740.228 ± 0.077−0.056 ± 0.080
Watusi0.207 ± 0.0880.198 ± 0.0780.223 ± 0.088−0.081 ± 0.146
B. indicus (zebu)0.086 ± 0.0400.111 ± 0.0610.124 ± 0.0670.101 ± 0.139
S. caffer0.286 ± 0.1840.143 ± 0.0920.190 ± 0.123−1.000 ± 0.000
T. angasii0.0000.0000.000
T. imberbis0.036 ± 0.0360.031 ± 0.0310.036 ± 0.036−0.143 ± 0.036
H. equinus0.286 ± 0.1840.143 ± 0.0920.229 ± 0.154−1.000 ± 0.000
H. niger0.286 ± 0.1840.143 ± 0.0920.190 ± 0.123−1.000 ± 0.000
K. leche0.195 ± 0.1060.234 ± 0.0680.278 ± 0.0830.211 ± 0.277
K. ellipsiprymnus0.214 ± 0.1490.125 ± 0.0820.214 ± 0.149−0.667 ± 0.178
Total0.167 ± 0.0340.121 ± 0.0200.162 ± 0.030−0.271 ± 0.063
F. 3′-downstream region
A. melampus0.080 ± 0.0390.040 ± 0.0190.072 ± 0.036−1.000 ± 0.000
C. taurinus0.056 ± 0.0320.030 ± 0.0170.051 ± 0.030−0.889 ± 0.027
Domestic cattle0.350 ± 0.0310.313 ± 0.0240.326 ± 0.025−0.101 ± 0.033
Watusi0.235 ± 0.0380.205 ± 0.0290.230 ± 0.032−0.160 ± 0.061
B. indicus (zebu)0.143 ± 0.0320.149 ± 0.0270.166 ± 0.0300.052 ± 0.068
S. caffer0.067 ± 0.0350.037 ± 0.0180.050 ± 0.027−0.723 ± 0.057
T. angasii0.084 ± 0.0390.044 ± 0.0200.067 ± 0.032−0.822 ± 0.056
T. imberbis0.080 ± 0.0390.040 ± 0.0190.071 ± 0.035−1.000 ± 0.000
H. equinus0.041 ± 0.0250.025 ± 0.0150.038 ± 0.023−0.583 ± 0.054
H. niger0.060 ± 0.0340.030 ± 0.0170.052 ± 0.030−1.000 ± 0.000
K. leche0.074 ± 0.0300.103 ± 0.0220.132 ± 0.0330.314 ± 0.102
K. ellipsiprymnus0.040 ± 0.0280.020 ± 0.0140.032 ± 0.023−1.000 ± 0.000
Total0.110 ± 0.0110.086 ± 0.0070.108 ± 0.010−0.202 ± 0.023
Abbreviations: Ho―heterozygosity observed, He―heterozygosity expected, uHe―unbiased heterozygosity expected, Fst―fixation index.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Malewski, T.; Kamiński, S.; Śmiełowski, J.; Oleński, K.; Bogdanowicz, W. Molecular Diversity of the Casein Gene Cluster in Bovidae: Insights from SNP Microarray Analysis. Animals 2024, 14, 3034. https://doi.org/10.3390/ani14203034

AMA Style

Malewski T, Kamiński S, Śmiełowski J, Oleński K, Bogdanowicz W. Molecular Diversity of the Casein Gene Cluster in Bovidae: Insights from SNP Microarray Analysis. Animals. 2024; 14(20):3034. https://doi.org/10.3390/ani14203034

Chicago/Turabian Style

Malewski, Tadeusz, Stanisław Kamiński, Jan Śmiełowski, Kamil Oleński, and Wiesław Bogdanowicz. 2024. "Molecular Diversity of the Casein Gene Cluster in Bovidae: Insights from SNP Microarray Analysis" Animals 14, no. 20: 3034. https://doi.org/10.3390/ani14203034

APA Style

Malewski, T., Kamiński, S., Śmiełowski, J., Oleński, K., & Bogdanowicz, W. (2024). Molecular Diversity of the Casein Gene Cluster in Bovidae: Insights from SNP Microarray Analysis. Animals, 14(20), 3034. https://doi.org/10.3390/ani14203034

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop