Effects of Different Photoperiods on Growth Performance, Glucose Metabolism, Acetylcholine, and Its Relative Acetylcholine Receptor Modulation in Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds and Experimental Design
2.2. Sample Collection
2.3. Growth Performance
2.4. Serum Glycolysis Metabolism Analysis
2.5. ACh Concentration Analyses of the Hypothalamus and Medulla Oblongata
2.6. Total RNA Extraction, Reverse Transcription Analysis, and Quantitative Real-Time PCR
2.7. Statistical Analysis
3. Results
3.1. Effects of Different Photoperiods on Growth Performance
3.2. Effects of Different Photoperiods on Glucose Metabolites in Broilers
3.3. Effects of Different Photoperiods on ACh and Its Relative ACh Receptor Modulation in Broilers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lewis, P.D. Lighting, ventilation and temperature. Br. Poult. Sci. 2010, 51 (Suppl. S1), 35–43. [Google Scholar] [CrossRef]
- Lewis, P.D.; Gous, R.M. Broilers perform better on short or step-up photoperiods. S. Afr. J. Anim. Sci. 2007, 37, 90–96. [Google Scholar] [CrossRef]
- Kim, H.J.; Son, J.; Jeon, J.J.; Kim, H.S.; Yun, Y.S.; Kang, H.K.; Hong, E.C.; Kim, J.H. Effects of Photoperiod on the Performance, Blood Profile, Welfare Parameters, and Carcass Characteristics in Broiler Chickens. Anim. Open Access J. 2022, 12, 2290. [Google Scholar] [CrossRef]
- Olanrewaju, H.A.; Purswell, J.L.; Collier, S.D.; Branton, S.L. Interactive effects of photoperiod and light intensity on blood physiological and biochemical reactions of broilers grown to heavy weights. Poult. Sci. 2013, 92, 1029–1039. [Google Scholar] [CrossRef]
- Jiang, S.; Fu, Y.; Cheng, H.W. Daylight exposure and circadian clocks in broilers: Part I-photoperiod effect on broiler behavior, skeletal health, and fear response. Poult. Sci. 2023, 102, 103162. [Google Scholar] [CrossRef]
- Julian, R.J. Production and growth related disorders and other metabolic diseases of poultry—A review. Vet. J. 2005, 169, 350–369. [Google Scholar] [CrossRef]
- Lu, J.; Cheng, Y.; Wang, X.; Woodson, K.; Kemper, C.; Disney, E.; Wang, J. Alcohol intake enhances glutamatergic transmission from D2 receptor-expressing afferents onto D1 receptor-expressing medium spiny neurons in the dorsomedial striatum. Neuropsychopharmacol. Off. Publ. Am. Coll. Neuropsychopharmacol. 2019, 44, 1123–1131. [Google Scholar] [CrossRef]
- Nelson, A.B.; Hammack, N.; Yang, C.F.; Shah, N.M.; Seal, R.P.; Kreitzer, A.C. Striatal cholinergic interneurons Drive GABA release from dopamine terminals. Neuron 2014, 82, 63–70. [Google Scholar] [CrossRef]
- Zendehdel, M.; Lankarani Mohajer, L.; Hassanpour, S. Central muscarinic receptor subtypes (M1 and M3) involved in carbacol-induced hypophagia in neonatal broiler chicken. Int. J. Neurosci. 2020, 130, 204–211. [Google Scholar] [CrossRef]
- Crossley, D.A.; Altimiras, J. Effect of selection for commercially productive traits on the plasticity of cardiovascular regulation in chicken breeds during embryonic development. Poult. Sci. 2012, 91, 2628–2636. [Google Scholar] [CrossRef]
- Hall, T.R.; Harvey, S.; Chadwick, A. Effects of putative neurotransmitters on release of prolactin from pituitary glands of the domestic fowl co-incubated with hypothalamic tissue. Gen. Pharmacol. 1985, 16, 483–488. [Google Scholar] [CrossRef]
- Sur, S.; Sharma, A.; Trivedi, A.K.; Bhardwaj, S.K.; Kumar, V. Temperature affects liver and muscle metabolism in photostimulated migratory redheaded buntings (Emberiza bruniceps). J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 2019, 189, 623–635. [Google Scholar] [CrossRef]
- Borck, P.C.; Rickli, S.; Vettorazzi, J.F.; Batista, T.M.; Boschero, A.C.; Vieira, E.; Carneiro, E.M. Effect of nighttime light exposure on glucose metabolism in protein-restricted mice. J. Endocrinol. 2021, 252, 143–154. [Google Scholar] [CrossRef]
- Rumanova, V.S.; Okuliarova, M.; Foppen, E.; Kalsbeek, A.; Zeman, M. Exposure to dim light at night alters daily rhythms of glucose and lipid metabolism in rats. Front. Physiol. 2022, 13, 973461. [Google Scholar] [CrossRef]
- Meng, J.J.; Shen, J.W.; Li, G.; Ouyang, C.J.; Hu, J.X.; Li, Z.S.; Zhao, H.; Shi, Y.M.; Zhang, M.; Liu, R.; et al. Light modulates glucose metabolism by a retina-hypothalamus-brown adipose tissue axis. Cell 2023, 186, 398–412. [Google Scholar] [CrossRef]
- Nakata, M.; Kumari, P.; Kita, R.; Katsui, N.; Takeuchi, Y.; Kawaguchi, T.; Yamazaki, T.; Zhang, B.; Shimba, S.; Yada, T. Circadian Clock Component BMAL1 in the Paraventricular Nucleus Regulates Glucose Metabolism. Nutrients 2021, 13, 4487. [Google Scholar] [CrossRef]
- Du, P.; Wang, H.; Shi, X.; Zhang, X.; Zhu, Y.; Chen, W.; Zhang, H.; Huang, Y. A comparative study to determine the effects of breed and feed restriction on glucose metabolism of chickens. Anim. Nutr. 2023, 13, 261–269. [Google Scholar] [CrossRef]
- Woods, S.C.; Porte, D., Jr. Neural control of the endocrine pancreas. Physiol. Rev. 1974, 54, 596–619. [Google Scholar] [CrossRef]
- Kohnert, K.D.; Axcrona, U.M.; Hehmke, B.; Klöting, I.; Sundler, F.; Ahrén, B. Islet neuronal abnormalities associated with impaired insulin secretion in type 2 diabetes in the Chinese hamster. Regul. Pept. 1999, 82, 71–79. [Google Scholar] [CrossRef]
- Saw, E.L.; Fronius, M.; Katare, R.; Kakinuma, Y. Mini Review: The non-neuronal cardiac cholinergic system in type-2 diabetes mellitus. Front. Cardiovasc. Med. 2024, 11, 1425534. [Google Scholar] [CrossRef]
- Jeong, D.U.; Oh, J.H.; Lee, J.E.; Lee, J.; Cho, Z.H.; Chang, J.W.; Chang, W.S. Basal Forebrain Cholinergic Deficits Reduce Glucose Metabolism and Function of Cholinergic and GABAergic Systems in the Cingulate Cortex. Yonsei Med. J. 2016, 57, 165–172. [Google Scholar] [CrossRef]
- Lin, E.E.; Scott-Solomon, E.; Kuruvilla, R. Peripheral Innervation in the Regulation of Glucose Homeostasis. Trends Neurosci. 2021, 44, 189–202. [Google Scholar] [CrossRef]
- Borgmann, D.; Fenselau, H. Vagal pathways for systemic regulation of glucose metabolism. Semin. Cell Dev. Biol. 2024, 156, 244–252. [Google Scholar] [CrossRef]
- Rui, L. Energy metabolism in the liver. Compr. Physiol. 2014, 4, 177–197. [Google Scholar] [CrossRef]
- NamKoong, C.; Song, W.J.; Kim, C.Y.; Chun, D.H.; Shin, S.; Sohn, J.W.; Choi, H.J. Chemogenetic manipulation of parasympathetic neurons (DMV) regulates feeding behavior and energy metabolism. Neurosci. Lett. 2019, 712, 134356. [Google Scholar] [CrossRef]
- Xu, M.; Zhao, X.; Yu, M.; Wang, G.; Feng, J.; Zhang, M. The amino acid pattern and dynamics of body protein, body fat deposition in male and female broilers under different temperatures. Poult. Sci. 2024, 103, 103525. [Google Scholar] [CrossRef]
- Aviagen. Arbor Acres Broiler Nutrition Specifications; Aviagen: Huntsville, AL, USA, 2019. [Google Scholar]
- Zhang, Y.; Wang, Z.; Dong, Y.; Cao, J.; Chen, Y. Effects of Different Monochromatic Light Combinations on Cecal Microbiota Composition and Cecal Tonsil T Lymphocyte Proliferation. Front. Immunol. 2022, 13, 849780. [Google Scholar] [CrossRef]
- Ingram, D.R.; Hattens, L.F.; McPherson, B.N. Effects of Light Restriction on Broiler Performance and Specific Body Structure Measurements. J. Appl. Poult. Res. 2000, 9, 501–504. [Google Scholar] [CrossRef]
- Olanrewaju, H.A.; Thaxton, J.P.; DozierIii, W.A.; Purswell, J.L.; Roush, W.B.; Branton, S.L. A Review of Lighting Programs for Broiler Production. Int. J. Poult. Sci. 2006, 5, 301–308. [Google Scholar]
- Shynkaruk, T.; Buchynski, K.; Schwean-Lardner, K. Lighting programme as a management tool for broilers raised without antibiotics–impact on productivity and welfare. Br. Poult. Sci. 2022, 63, 761–767. [Google Scholar] [CrossRef]
- Mahmoud, M.F.; Abdelaal, S.; Mohammed, H.O.; El-Shazly, A.M.; Daoud, R.; Abdelfattah, M.A.O.; Sobeh, M. Syzygium aqueum (Burm.f.) Alston Prevents Streptozotocin-Induced Pancreatic Beta Cells Damage via the TLR-4 Signaling Pathway. Front. Pharmacol. 2021, 12, 769244. [Google Scholar] [CrossRef]
- Stumvoll, M.; Goldstein, B.J.; van Haeften, T.W. Type 2 diabetes: Principles of pathogenesis and therapy. Lancet 2005, 365, 1333–1346. [Google Scholar] [CrossRef]
- Wang, J.; Wu, M.; Chen, Z.; Wu, L.; Wang, T.; Cao, D.; Wang, H.; Liu, S.; Xu, Y.; Li, F.; et al. The unconventional activation of the muscarinic acetylcholine receptor M4R by diverse ligands. Nat. Commun. 2022, 13, 2855. [Google Scholar] [CrossRef]
- Conroy, W.G.; Berg, D.K. Nicotinic receptor subtypes in the developing chick brain: Appearance of a species containing the alpha4, beta2, and alpha5 gene products. Mol. Pharmacol. 1998, 53, 392–401. [Google Scholar] [CrossRef]
- Nef, P.; Oneyser, C.; Alliod, C.; Couturier, S.; Ballivet, M. Genes expressed in the brain define three distinct neuronal nicotinic acetylcholine receptors. EMBO J. 1988, 7, 595–601. [Google Scholar] [CrossRef]
- Hogg, R.C.; Raggenbass, M.; Bertrand, D. Nicotinic acetylcholine receptors: From structure to brain function. Rev. Physiol. Biochem. Pharmacol. 2003, 147, 1–46. [Google Scholar] [CrossRef]
- Wess, J. Muscarinic acetylcholine receptor knockout mice: Novel phenotypes and clinical implications. Annu. Rev. Pharmacol. Toxicol. 2004, 44, 423–450. [Google Scholar] [CrossRef]
- Bradley, S.J.; Wiegman, C.H.; Iglesias, M.M.; Kong, K.C.; Butcher, A.J.; Plouffe, B.; Goupil, E.; Bourgognon, J.M.; Macedo-Hatch, T.; LeGouill, C.; et al. Mapping physiological G protein-coupled receptor signaling pathways reveals a role for receptor phosphorylation in airway contraction. Proc. Natl. Acad. Sci. USA 2016, 113, 4524–4529. [Google Scholar] [CrossRef]
- Rodríguez-Colón, S.; He, F.; Bixler, E.O.; Fernandez-Mendoza, J.; Vgontzas, A.N.; Berg, A.; Kawasawa, Y.I.; Liao, D. The circadian pattern of cardiac autonomic modulation and obesity in adolescents. Clin. Auton. Res. Off. J. Clin. Auton. Res. Soc. 2014, 24, 265–273. [Google Scholar] [CrossRef]
- Wu, Y.; Gu, R.; Yang, Q.; Luo, Y.J. How Do Amusement, Anger and Fear Influence Heart Rate and Heart Rate Variability? Front. Neurosci. 2019, 13, 1131. [Google Scholar] [CrossRef]
- Sluga, N.; Postić, S.; Sarikas, S.; Huang, Y.C.; Stožer, A.; Slak Rupnik, M. Dual Mode of Action of Acetylcholine on Cytosolic Calcium Oscillations in Pancreatic Beta and Acinar Cells In Situ. Cells 2021, 10, 1580. [Google Scholar] [CrossRef]
- Kraft, G.; Vrba, A.; Scott, M.; Allen, E.; Edgerton, D.S.; Williams, P.E.; Vafai, S.B.; Azamian, B.R.; Cherrington, A.D. Sympathetic Denervation of the Common Hepatic Artery Lessens Glucose Intolerance in the Fat- and Fructose-Fed Dog. Diabetes 2019, 68, 1143–1155. [Google Scholar] [CrossRef]
- Kwon, E.; Joung, H.Y.; Liu, S.M.; Chua, S.C., Jr.; Schwartz, G.J.; Jo, Y.H. Optogenetic stimulation of the liver-projecting melanocortinergic pathway promotes hepatic glucose production. Nat. Commun. 2020, 11, 6295. [Google Scholar] [CrossRef]
- Nelson, B.W.; Byrne, M.L.; Sheeber, L.; Allen, N.B. Does Context Matter? A Multi-Method Assessment of Affect in Adolescent Depression Across Multiple Affective Interaction Contexts. Clin. Psychol. Sci. J. Assoc. Psychol. Sci. 2017, 5, 239–258. [Google Scholar] [CrossRef]
- Olanrewaju, H.A.; Miller, W.W.; Maslin, W.R.; Collier, S.D.; Purswell, J.L.; Branton, S.L. Influence of light sources and photoperiod on growth performance, carcass characteristics, and health indices of broilers grown to heavy weights. Poult. Sci. 2018, 97, 1109–1116. [Google Scholar] [CrossRef]
- Walk, C.L.; Mullenix, G.J.; Maynard, C.W.; Greene, E.S.; Maynard, C.; Ward, N.; Dridi, S. Novel 4th-generation phytase improves broiler growth performance and reduces woody breast severity through modulation of muscle glucose uptake and metabolism. Front. Physiol. 2024, 15, 1376628. [Google Scholar] [CrossRef]
- Li, L.; Jia, Q.; Chen, L.; Wang, W. Changes in the Expression of MIF and Other Key Enzymes of Energy Metabolism in the Myocardia of Broiler Chickens with Ascites Syndrome. Anim. Open Access J. 2022, 12, 2488. [Google Scholar] [CrossRef]
- Xu, T.T.; Chen, P.; Zhang, C.D.; Shaukat, A.; Lin, L.X.; Yue, K.; Ding, W.L.; Tong, X.; Liu, K.L.; He, Y.F.; et al. Gut microbiome dysregulation drives bone damage in broiler tibial dyschondroplasia by disrupting glucose homeostasis. NPJ Biofilms Microbiomes 2023, 9, 1. [Google Scholar] [CrossRef]
Items | 5–7 d | 8–22 d | 23–33 d |
---|---|---|---|
Ingredient | Content (%) | ||
Corn | 51.44 | 54.08 | 56.85 |
Soybean meal | 40.21 | 36.82 | 33.86 |
Soybean oil | 3.94 | 5.00 | 5.50 |
Limestone | 1.00 | 0.85 | 0.90 |
CaHPO4 | 1.89 | 1.80 | 1.50 |
NaCl | 0.30 | 0.30 | 0.30 |
DL-Methionine | 0.21 | 0. 19 | 0.19 |
L-Lysine | 0.36 | 0.32 | 0.30 |
L-Threonine | 0.15 | 0. 14 | 0.10 |
Premix 1 | 0.50 | 0.50 | 0.50 |
Total | 100 | 100 | 100 |
Nutrient levels 2 | |||
ME/(Kcal/Kg) | 2961 | 3038 | 3095 |
CP (%) | 22.55 | 21.18 | 19.97 |
CF (%) | 10.54 | 10.38 | 11.35 |
Ca (%) | 0.94 | 0.85 | 0.79 |
AP (%) | 0.43 | 0.41 | 0.35 |
Lysine (%) | 1.46 | 1.34 | 1.25 |
Methionine (%) | 0.54 | 0.51 | 0.49 |
Methionine + cysteine (%) | 0.92 | 0.87 | 0.84 |
Gene | Primer Sequence (5′–3′) | Product Length (bp) | Gene Bank Number |
---|---|---|---|
GAPDH | F: ACTTTGGCATTGTGGAGGGT R: GGACGCTGGGATGATGTTCT | 188 | NM_204305.1 |
α4 nAChR | F: CGTCGCCAACATTTCGGATG R: GCTCTGAGGGGATTCGGATG | 131 | NM_001397350.1 |
M3 mAChR | F: GGAGACTGAGAAACGCACCA R: CTGCCGTTGCAGTTCATAGC | 103 | NM_001396514.1 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Weeks 0–2 | |||||
ADG/g | 42.74 b | 50.10 a | 50.90 a | 0.93 | <0.001 |
ADFI/g | 45.07 c | 53.21 b | 65.10 a | 2.02 | <0.001 |
FE | 0.95 a | 0.94 a | 0.78 b | 0.02 | <0.001 |
Weeks 2–4 | |||||
ADG/g | 91.17 b | 101.01 a | 101.53 a | 1.32 | <0.001 |
ADFI/g | 113.55 c | 137.27 b | 152.10 a | 3.94 | <0.001 |
FE | 0.80 a | 0.74 b | 0.67 c | 0.01 | <0.001 |
Weeks 0–4 | |||||
ADG/g | 68.21 b | 76.76 a | 77.47 a | 1.06 | <0.001 |
ADFI/g | 78.15 c | 93.69 b | 101.50 a | 2.40 | <0.001 |
FE | 0.87 a | 0.82 b | 0.76 c | 0.01 | <0.001 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Week 2 | |||||
Serum GLU/mmol/L | 13.86 c | 15.27 b | 16.95 a | 0.47 | 0.002 |
Serum TG/mmol/L | 2.78 b | 3.28 ab | 3.79 a | 0.17 | 0.015 |
Serum INS/mU/L | 14.68 b | 17.60 b | 23.54 a | 1.39 | 0.002 |
HOMA-IR | 9.04 c | 11.93 b | 17.75 a | 1.34 | 0.001 |
Week 4 | |||||
Serum GLU/mmol/L | 13.27 c | 14.55 b | 15.90 a | 0.42 | <0.05 |
Serum TG/mmol/L | 3.10 b | 3.59 a | 3.77 a | 0.11 | 0.008 |
Serum INS/mU/L | 15.37 c | 21.24 b | 24.72 a | 1.44 | 0.001 |
HOMA-IR | 9.07 c | 13.73 b | 17.46 a | 1.25 | 0.007 |
Item | 12L:12D | 18L:6D | 24L:0D | SEM | p Value |
---|---|---|---|---|---|
Week 2 | |||||
Hypothalamus/μg/mg | 1.16 c | 1.66 b | 2.16 a | 0.16 | 0.008 |
Medulla oblongata/μg/mg | 1.36 c | 1.83 b | 2.30 a | 0.15 | 0.008 |
Week 4 | |||||
Hypothalamus/μg/mg | 1.09 c | 0.96 b | 1.45 a | 0.11 | 0.012 |
Medulla oblongata/μg/mg | 0.76 c | 1.04 b | 1.38 a | 0.10 | 0.005 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, M.; Xu, M.; Wang, G.; Feng, J.; Zhang, M. Effects of Different Photoperiods on Growth Performance, Glucose Metabolism, Acetylcholine, and Its Relative Acetylcholine Receptor Modulation in Broiler Chickens. Animals 2024, 14, 3003. https://doi.org/10.3390/ani14203003
Yu M, Xu M, Wang G, Feng J, Zhang M. Effects of Different Photoperiods on Growth Performance, Glucose Metabolism, Acetylcholine, and Its Relative Acetylcholine Receptor Modulation in Broiler Chickens. Animals. 2024; 14(20):3003. https://doi.org/10.3390/ani14203003
Chicago/Turabian StyleYu, Miao, Mengjie Xu, Guangju Wang, Jinghai Feng, and Minhong Zhang. 2024. "Effects of Different Photoperiods on Growth Performance, Glucose Metabolism, Acetylcholine, and Its Relative Acetylcholine Receptor Modulation in Broiler Chickens" Animals 14, no. 20: 3003. https://doi.org/10.3390/ani14203003
APA StyleYu, M., Xu, M., Wang, G., Feng, J., & Zhang, M. (2024). Effects of Different Photoperiods on Growth Performance, Glucose Metabolism, Acetylcholine, and Its Relative Acetylcholine Receptor Modulation in Broiler Chickens. Animals, 14(20), 3003. https://doi.org/10.3390/ani14203003