The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Animals, and Diets
2.2. Growth Performance Measurement
2.3. Sampling Procedure
2.4. Determination of Digestive Enzyme Activities
2.5. Intestinal Morphology
2.6. Gene Expression Analysis by qPCR
2.7. Bacterial DNA Extraction and 16S rRNA Gene Sequencing
2.8. Data Analysis and Statistics
3. Results
3.1. Growth Performance
3.2. Immune Indicators
3.3. Gene Expression of Cytokines in the Jejunum Mucosa
3.4. Gene Expression of Tight Junction Protein in the Jejunum Mucosa
3.5. Digestive Enzyme Activity
3.6. Jejunum Histomorphology
3.7. Cecal Microbiota
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Qin, X.; Fang, Z.; Zhang, J.; Zhao, W.; Zheng, N.; Wang, X. Regulatory effect of Ganoderma lucidum and its active components on gut flora in diseases. Front. Microbiol. 2024, 15, 1362479. [Google Scholar] [CrossRef]
- Cör Andrejč, D.; Knez, Ž.; Knez Marevci, M. Antioxidant, antibacterial, antitumor, antifungal, antiviral, anti-inflammatory, and nevro-protective activity of Ganoderma lucidum: An overview. Front. Pharmacol. 2022, 13, 934982. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.L.; Lo, H.C.; Lu, M.K.; Lin, T.Y. Significance of culture period on the physiochemistry and anti-cancer potentials of polysaccharides from mycelia of Ganoderma lucidum. Int. J. Biol. Macromol. 2023, 242, 125181. [Google Scholar] [CrossRef]
- Jin, M.L.; Zhu, Y.M.; Shao, D.Y.; Zhao, K.; Xu, C.L.; Li, Q.; Yang, H.; Huang, Q.S.; Shi, J.L. Effects of polysaccharide from mycelia of Ganoderma lucidum on intestinal barrier functions of rats. Int. J. Biol. Macromol. 2017, 94, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.L.; Zhang, H.; Wang, J.J.; Shao, D.Y.; Yang, H.; Huang, Q.S.; Shi, J.L.; Xu, C.L.; Zhao, K. Response of intestinal metabolome to polysaccharides from mycelia of Ganoderma lucidum. Int. J. Biol. Macromol. 2019, 122, 723–731. [Google Scholar] [CrossRef]
- Liu, Y.L.; Zhao, C.; Lin, D.M.; Lin, H.; Lin, Z.X. Effect of water extract from spent mushroom substrate after Ganoderma balabacense cultivation by using JUNCAO technique on production performance and hematology parameters of dairy cows. J. Anim. Sci. 2015, 86, 855–862. [Google Scholar] [CrossRef]
- Liu, Y.L.; Zhao, C.; Lin, D.M.; Lan, H.J.; Lin, Z.X. Effects of Ganoderma lucidum Spent Mushroom Substrate Extract on Milk and Serum Immunoglobulin Levels and Serum Antioxidant Capacity of Dairy Cows. Trop. J. Pharm. Res. 2015, 14, 1049–1055. [Google Scholar] [CrossRef]
- Gao, Y.Y.; Zhou, Y.H.; Liu, X.P.; Di, B.; He, J.Y.; Wang, Y.T.; Guo, P.T.; Zhang, J.; Wang, C.K.; Jin, L. Ganoderma lucidum polysaccharide promotes broiler health by regulating lipid metabolism, antioxidants, and intestinal microflora. Int. J. Biol. Macromol. 2024, 280, 135918. [Google Scholar] [CrossRef]
- Lu, J.H.; He, R.J.; Sun, P.L.; Zhang, F.M.; Linhardt, R.J.; Zhang, A.Q. Molecular mechanisms of bioactive polysaccharides from Ganoderma lucidum (Lingzhi), a review. Int. J. Biol. Macromol. 2020, 150, 765–774. [Google Scholar] [CrossRef]
- Ma, Y.Z.; Han, J.B.; Wang, K.F.; Han, H.; Hu, Y.B.; Li, H.; Wu, S.X.; Zhang, L.J. Research progress of Ganoderma lucidum polysaccharide in prevention and treatment of Atherosclerosis. Heliyon 2024, 10, e33307. [Google Scholar] [CrossRef]
- Ren, L.; Zhang, J.; Zhang, T. Immunomodulatory activities of polysaccharides from Ganoderma on immune effector cells. Food Chem. 2021, 340, 127933. [Google Scholar] [CrossRef]
- Wang, X.; Lin, Z. Immunomodulating Effect of Ganoderma (Lingzhi) and Possible Mechanism. Adv. Exp. Med. Biol. 2019, 1182, 1–37. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xing, J.; Zheng, S.; Bo, R.; Luo, L.; Huang, Y.; Niu, Y.; Li, Z.; Wang, D.; Hu, Y.; et al. Ganoderma lucidum polysaccharides encapsulated in liposome as an adjuvant to promote Th1-bias immune response. Carbohydr. Polym. 2016, 142, 141–148. [Google Scholar] [CrossRef]
- Song, M.; Li, Z.H.; Gu, H.S.; Tang, R.Y.; Zhang, R.; Zhu, Y.L.; Liu, J.L.; Zhang, J.J.; Wang, L.Y. Ganoderma lucidum Spore Polysaccharide Inhibits the Growth of Hepatocellular Carcinoma Cells by Altering Macrophage Polarity and Induction of Apoptosis. J. Immunol. Res. 2021, 2021, 6696606. [Google Scholar] [CrossRef]
- Chen, M.; Xiao, D.; Liu, W.; Song, Y.; Zou, B.; Li, L.; Li, P.; Cai, Y.; Liu, D.; Liao, Q.; et al. Intake of Ganoderma lucidum polysaccharides reverses the disturbed gut microbiota and metabolism in type 2 diabetic rats. Int. J. Biol. Macromol. 2020, 155, 890–902. [Google Scholar] [CrossRef]
- Khan, I.; Huang, G.X.; Li, X.A.; Leong, W.; Xia, W.R.; Hsiao, W.L.W. Mushroom polysaccharides from Ganoderma lucidum and Poria cocos reveal prebiotic functions. J. Funct. Foods 2018, 41, 191–201. [Google Scholar] [CrossRef]
- Yadav, S.; Jha, R. Strategies to modulate the intestinal microbiota and their effects on nutrient utilization, performance, and health of poultry. J. Anim. Sci. Biotechnol 2019, 10, 2. [Google Scholar] [CrossRef]
- Zhu, Q.D.; Sun, P.; Zhang, B.K.; Kong, L.L.; Xiao, C.P.; Song, Z.G. Progress on Gut Health Maintenance and Antibiotic Alternatives in Broiler Chicken Production. Front. Nutr. 2021, 8, 692839. [Google Scholar] [CrossRef]
- Roberts, T.; Wilson, J.; Guthrie, A.; Cookson, K.; Vancraeynest, D.; Schaeffer, J.; Moody, R.; Clark, S. New issues and science in broiler chicken intestinal health: Emerging technology and alternative interventions. J. Appl. Poult. Res. 2015, 24, 257–266. [Google Scholar] [CrossRef]
- Seweryn, E.; Ziała, A.; Gamian, A. Health-Promoting of Polysaccharides Extracted from Ganoderma lucidum. Nutrients 2021, 13, 2725. [Google Scholar] [CrossRef]
- Nataraj, A.; Govindan, S.; Rajendran, A.; Ramani, P.; Subbaiah, K.A.; Munekata, P.E.S.; Pateiro, M.; Lorenzo, J.M. Effects of Carboxymethyl Modification on the Acidic Polysaccharides from Calocybe indica: Physicochemical Properties, Antioxidant, Antitumor and Anticoagulant Activities. Antioxidants 2023, 12, 105. [Google Scholar] [CrossRef]
- NY/T33-2004; Nutritional Requirements of Broiler. Ministry of Agriculture of the People’s Republic of China: Beijing, China, 2004.
- Liu, X.; Lyu, W.; Liu, L.; Lv, K.; Zheng, F.; Wang, Y.; Chen, J.; Dai, B.; Yang, H.; Xiao, Y. Comparison of Digestive Enzyme Activities and Expression of Small Intestinal Transporter Genes in Jinhua and Landrace Pigs. Front. Physiol. 2021, 12, 669238. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef]
- Chen, H.W.; Yu, Y.H. Effect of Ganoderma lucidum extract on growth performance, fecal microbiota, and bursal transcriptome of broilers. Anim. Feed. Sci. Technol. 2020, 267, 114551. [Google Scholar] [CrossRef]
- Jia, D.S.; Tang, Y.J.; Qin, F.x.; Liu, B.; Hu, T.J.; Chen, W. Ganoderma lucidum polysaccharide alleviates Cd toxicity in common carp (Cyprinus carpio): Neuropeptide, growth performance and lipid accumulation. Comp. Biochem. Phys. C 2023, 271, 109663. [Google Scholar] [CrossRef]
- Liu, T.; Zhou, J.C.; Li, W.X.; Rong, X.P.; Gao, Y.; Zhao, L.H.; Fan, Y.; Zhang, J.Y.; Ji, C.; Ma, Q.G. Effects of sporoderm-broken spores of Ganoderma lucidum on growth performance, antioxidant function and immune response of broilers. Anim. Nutr. 2020, 6, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Mohan, K.; Muralisankar, T.; Uthayakumar, V.; Chandirasekar, R.; Karthick Rajan, D. Dietary Ganoderma lucidum polysaccharides to enhance the growth, immune response and disease resistance of freshwater prawn Macrobrachium rosenbergii. Aquac. Rep. 2019, 14, 100203. [Google Scholar] [CrossRef]
- Martonik, D.; Parfieniuk-Kowerda, A.; Rogalska, M.; Flisiak, R. The Role of Th17 Response in COVID-19. Cells 2021, 10, 1550. [Google Scholar] [CrossRef]
- Yang, C.; Wang, M.; Tang, X.; Yang, H.; Li, F.; Wang, Y.; Li, J.; Yin, Y. Effect of Dietary Amylose/Amylopectin Ratio on Intestinal Health and Cecal Microbes’ Profiles of Weaned Pigs Undergoing Feed Transition or Challenged with Escherichia coli Lipopolysaccharide. Front. Microbiol. 2021, 12, 693839. [Google Scholar] [CrossRef]
- Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-gamma: An overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163–189. [Google Scholar] [CrossRef]
- Chen, L.; Sun, M.; Wu, W.; Yang, W.; Huang, X.; Xiao, Y.; Ma, C.; Xu, L.; Yao, S.; Liu, Z.; et al. Microbiota Metabolite Butyrate Differentially Regulates Th1 and Th17 Cells’ Differentiation and Function in Induction of Colitis. Inflamm. Bowel Dis. 2019, 25, 1450–1461. [Google Scholar] [CrossRef]
- Pan, K.; Jiang, Q.; Liu, G.; Miao, X.; Zhong, D. Optimization extraction of Ganoderma lucidum polysaccharides and its immunity and antioxidant activities. Int. J. Biol. Macromol. 2013, 55, 301–306. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.J.; Nie, S.P. The structure of mushroom polysaccharides and their beneficial role in health. Food. Funct. 2015, 6, 3205–3217. [Google Scholar] [CrossRef]
- Ducatelle, R.; Goossens, E.; Eeckhaut, V.; Van Immerseel, F. Poultry gut health and beyond. Anim. Nutr. 2023, 13, 240–248. [Google Scholar] [CrossRef] [PubMed]
- Sang, T.; Guo, C.; Guo, D.; Wu, J.; Wang, Y.; Wang, Y.; Chen, J.; Chen, C.; Wu, K.; Na, K.; et al. Suppression of obesity and inflammation by polysaccharide from sporoderm-broken spore of Ganoderma lucidum via gut microbiota regulation. Carbohydr. Polym. 2021, 256, 117594. [Google Scholar] [CrossRef]
- Ding, Q.A.; Nie, S.P.; Hu, J.L.; Zong, X.Y.; Li, Q.Q.; Xie, M.Y. In vitro and in vivo gastrointestinal digestion and fermentation of the polysaccharide from Ganoderma atrum. Food. Hydrocoll. 2017, 63, 646–655. [Google Scholar] [CrossRef]
- Bhat, A.A.; Najeeb, S.; Lubna, T.; Sabah, N.; Sheema, H.; Muzafar, A.M.; Santosh, K.Y.; Roopesh, K.; Shanmugakonar, M.; Hamda, A.; et al. Claudin-1, A Double-Edged Sword in Cancer. Int. J. Mol. Sci. 2020, 21, 569. [Google Scholar] [CrossRef]
- Ren, F.; Meng, C.; Chen, W.J.; Chen, H.M.; Chen, W.X. Ganoderma amboinense polysaccharide prevents obesity by regulating gut microbiota in high-fat-diet mice. Food Biosci. 2021, 42, 101107. [Google Scholar] [CrossRef]
- Guo, C.; Guo, D.; Fang, L.; Sang, T.; Wu, J.; Guo, C.; Wang, Y.; Wang, Y.; Chen, C.; Chen, J.; et al. Ganoderma lucidum polysaccharide modulates gut microbiota and immune cell function to inhibit inflammation and tumorigenesis in colon. Carbohydr. Polym. 2021, 267, 118–231. [Google Scholar] [CrossRef]
- Liu, X.; Mao, B.; Gu, J.; Wu, J.; Cui, S.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Blautia-a new functional genus with potential probiotic properties? Gut Microbes 2021, 13, 1875796. [Google Scholar] [CrossRef]
- Liang, Y.N.; Yu, J.G.; Zhang, D.B.; Zhang, Z.; Ren, L.L.; Li, L.H.; Wang, Z.; Tang, Z.S. Indigo Naturalis Ameliorates Dextran Sulfate Sodium-Induced Colitis in Mice by Modulating the Intestinal Microbiota Community. Molecules 2019, 24, 4086. [Google Scholar] [CrossRef]



| Items | Groups | |||
|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | |
| Ingredients, % | ||||
| Corn | 58.03 | 57.70 | 57.38 | 56.71 |
| Soybean meal, 46% CP | 32.64 | 32.57 | 32.48 | 32.35 |
| Expanded soybean | 4.00 | 4.00 | 4.00 | 4.00 |
| Soybean oil | 1.16 | 1.30 | 1.45 | 1.75 |
| Limestone powder | 1.12 | 1.12 | 1.12 | 1.12 |
| Dicalcium phosphate | 1.57 | 1.57 | 1.57 | 1.58 |
| DL-Methionine, 98% | 0.18 | 0.18 | 0.19 | 0.19 |
| HWE-JGLR | 0.00 | 0.25 | 0.50 | 1.00 |
| Premix 1 | 1.00 | 1.00 | 1.00 | 1.00 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | ||||
| Metabolizable energy, MJ/kg | 12.12 | 12.12 | 12.12 | 12.12 |
| Crude protein, % | 21.00 | 21.00 | 21.00 | 21.00 |
| Calcium, % | 1.00 | 1.00 | 1.00 | 1.00 |
| Non-phytate phosphorus, % | 0.45 | 0.45 | 0.45 | 0.45 |
| Lysine, % | 1.10 | 1.10 | 1.10 | 1.09 |
| Methionine + Cystine, % | 0.85 | 0.85 | 0.85 | 0.85 |
| Items | Groups | |||
|---|---|---|---|---|
| Con | HJ-1 | HJ-2 | HJ-3 | |
| Ingredients, % | ||||
| Corn | 62.89 | 62.56 | 62.23 | 61.57 |
| Soybean meal, 46% CP | 26.45 | 26.38 | 26.31 | 26.17 |
| Expanded soybean | 5.00 | 5.00 | 5.00 | 5.00 |
| Soybean oil | 1.83 | 1.97 | 2.12 | 2.42 |
| Limestone powder | 1.04 | 1.04 | 1.04 | 1.04 |
| Dicalcium phosphate | 1.38 | 1.38 | 1.38 | 1.39 |
| DL-Methionine, 98% | 0.11 | 0.11 | 0.11 | 0.11 |
| HWE-JGLR | 0.00 | 0.25 | 0.50 | 1.00 |
| Premix 1 | 1.00 | 1.00 | 1.00 | 1.00 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | ||||
| Metabolizable energy, MJ/kg | 12.54 | 12.54 | 12.54 | 12.54 |
| Crude protein, % | 19.00 | 19.00 | 19.00 | 19.00 |
| Calcium, % | 0.90 | 0.90 | 0.90 | 0.90 |
| Non-phytate phosphorus, % | 0.40 | 0.40 | 0.40 | 0.40 |
| Lysine, % | 0.97 | 0.97 | 0.97 | 0.96 |
| Methionine + Cystine, % | 0.73 | 0.73 | 0.72 | 0.72 |
| Items | Groups | |||
|---|---|---|---|---|
| Con | HJ-1 | HJ-2 | HJ-3 | |
| Ingredients, % | ||||
| Corn | 71.22 | 70.97 | 70.60 | 69.92 |
| Soybean meal, 46% CP | 18.57 | 18.47 | 18.42 | 17.45 |
| Expanded soybean | 4.00 | 4.00 | 4.00 | 5.00 |
| Soybean oil | 2.48 | 2.58 | 2.74 | 2.86 |
| Limestone powder | 1.00 | 1.00 | 1.00 | 1.00 |
| Dicalcium phosphate | 1.20 | 1.20 | 1.21 | 1.23 |
| DL-Methionine, 98% | 0.11 | 0.11 | 0.11 | 0.11 |
| HWE-JGLR | 0.00 | 0.25 | 0.50 | 1.00 |
| Premix 1 | 0.30 | 0.30 | 0.30 | 0.30 |
| NaCl | 0.12 | 0.12 | 0.12 | 0.13 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | ||||
| Metabolizable energy, MJ/kg | 12.96 | 12.96 | 12.96 | 12.96 |
| Crude protein, % | 16.00 | 16.00 | 16.00 | 16.00 |
| Calcium, % | 0.80 | 0.80 | 0.81 | 0.81 |
| Non-phytate phosphorus, % | 0.35 | 0.34 | 0.35 | 0.35 |
| Lysine, % | 0.85 | 0.85 | 0.85 | 0.85 |
| Methionine + Cystine, % | 0.65 | 0.65 | 0.65 | 0.65 |
| Gene | Primer Sequence 5′→3′ | GenBank No. | Product Length/bp |
|---|---|---|---|
| β-Actin | F: GAGAAATTGTGCGTGACATCA R: CCTGAACCTCTCATTGCCA | NM_205518 | 152 |
| IFN-γ | F: CTTCCTGATGGCGTGAAGA R: GAGGATCCACCAGCTTCTGT | NM_205149.2 | 127 |
| IL-1β | F: GGAGCAGGGACTTTGCTGAC R: AAGGACTGTGAGCGGGTGTA | NM_204524.2 | 130 |
| IL-10 | F: GCTGTCACCGCTTCTTCAC R: TCACTTCCTCCTCCTCATCAG | NM_001004414.2 | 164 |
| IL-6 | F: CCTCCTCGCCAATCTGAAGT R: GCACTGAAACTCCTGGTCTTT | NM_204628.1 | 138 |
| IL-4 | F: TCTTCCTCAACATGCGTCAG R: TGGTGGAAGAAGGTACGTAGG | NM_001007079.1 | 127 |
| Claudin-1 | F: ATGGTATGGCAACAGAGTG R: CAGGAGCAGCAGAGGAAT | NM_001013611 | 144 |
| Occludin | F: GATGTCCAGCGGTTACTACTAC R: GAAGAAGCAGATGAGGCAGAG | XM_025144248 | 172 |
| ZO-1 | F: TGCTTCCAGTGCCAACAGA R: CTTGCCAACCGTAGACCATAC | XM_015278981 | 183 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| IBW, g | 34.32 ± 0.17 | 34.31 ± 0.15 | 34.25 ± 0.06 | 34.34 ± 0.12 | 0.072 |
| FBW, g | 2297.50 ± 1.87 a | 2303.50 ± 1.87 b | 2309.50 ± 1.87 c | 2315.50 ± 1.87 d | <0.001 |
| ADFI, g | 80.29 ± 2.61 b | 82.13 ± 2.11 ab | 81.51 ± 0.86 b | 84.71 ± 3.61 a | 0.033 |
| ADG, g | 34.37 ± 1.73 b | 35.79 ± 0.56 ab | 36.02 ± 0.96 a | 36.32 ± 1.16 a | 0.045 |
| F/G | 2.34 ± 0.06 | 2.31 ± 0.03 | 2.28 ± 0.03 | 2.33 ± 0.08 | 0.256 |
| Mortality, % | 5.56 | 1.39 | 2.78 | 2.99 | 0.549 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| Spleen index | 1.19 ± 0.33 | 1.10 ± 0.23 | 1.04 ± 0.25 | 1.07 ± 0.20 | 0.223 |
| Thymus index | 2.42 ± 1.49 | 1.56 ± 1.01 | 2.57 ± 1.10 | 2.33 ± 1.34 | 0.074 |
| Bursa of Fabricius index | 1.70 ± 0.40 | 1.54 ± 0.58 | 1.55 ± 0.63 | 1.56 ± 0.62 | 0.549 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| Lipase, U/gprot | 197.83 ± 34.77 | 190.93 ± 56.83 | 200.84 ± 25.77 | 206.10 ± 88.24 | 0.983 |
| Trypsin, U/mgprot | 14,923 ± 2567 | 15,091 ± 1914 | 17,215 ± 2477 | 14,945 ± 2987 | 0.365 |
| Chymotrypsin, U/mgprot | 29.37 ± 10.08 | 30.10 ± 5.48 | 32.87 ± 9.92 | 28.77 ± 6.79 | 0.840 |
| α-amylase, U/gprot | 0.25 ± 0.14 | 0.16 ± 0.05 | 0.23 ± 0.15 | 0.17 ± 0.12 | 0.611 |
| Items | Groups | p-Value | ||||
|---|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | |||
| Duodenum | VH (μm) | 990.50 ± 50.24 | 1049 ± 190.62 | 1022 ± 197.42 | 1125 ± 148.78 | 0.512 |
| CD (μm) | 82.30 ± 18.54 | 81.66 ± 9.20 | 77.18 ± 4.23 | 83.02 ± 6.83 | 0.798 | |
| V/C | 12.77 ± 2.68 | 13.46 ± 4.19 | 13.46 ± 2.42 | 13.79 ± 1.73 | 0.940 | |
| Jejunum | VH (μm) | 1026 ± 41.24 | 997.30 ± 89.18 | 1054 ± 54.52 | 1141 ± 137.59 | 0.058 |
| CD (μm) | 93.52 ± 7.22 | 95.21 ± 9.30 | 89.75 ± 13.55 | 94.71 ± 9.53 | 0.787 | |
| V/C | 11.16 ± 1.21 | 10.57 ± 1.09 | 12.12 ± 2.25 | 12.18 ± 1.26 | 0.229 | |
| Ileum | VH (μm) | 865.30 ± 111.47 | 966.30 ± 87.30 | 833 ± 167.37 | 875.10 ± 129.29 | 0.331 |
| CD (μm) | 86.01 ± 9.34 | 79.60 ± 10.59 | 77.95 ± 8.19 | 73.09 ± 11.09 | 0.188 | |
| V/C | 10.18 ± 0.96 | 12.50 ± 2.43 | 11.04 ± 2.82 | 12.63 ± 2.93 | 0.264 | |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| ACE | 188.80 ± 70.09 b | 235.80 ± 36.38 ab | 268.50 ± 27.34 a | 284.40 ± 19.81 a | 0.014 |
| Shannon | 2.73 ± 1.09 b | 3.71 ± 0.75 ab | 4.44 ± 0.31 a | 4.57 ± 0.07 a | 0.004 |
| Shannoneven | 0.52 ± 0.17 b | 0.68 ± 0.12 ab | 0.80 ± 0.04 a | 0.81 ± 0.01 a | 0.002 |
| Items (%) | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| Phylum level | |||||
| Firmicutes | 99.05 ± 1.35 | 98.39 ± 1.03 | 97.64 ± 1.00 | 98.13 ± 0.89 | 0.117 |
| Bacteroidota | 0.69 ± 0.99 | 0.99 ± 0.93 | 0.63 ± 0.44 | 0.58 ± 0.72 | 0.759 |
| Desulfobacterota | 0.05 ± 0.09 c | 0.20 ± 0.33 b | 1.10 ± 0.76 a | 0.71 ± 0.43 a | 0.002 |
| Actinobacteriota | 0.06 ± 0.10 | 0.25 ± 0.24 | 0.29 ± 0.18 | 0.45 ± 0.43 | 0.149 |
| Proteobateria | 0.13 ± 0.22 | 0.11 ± 0.12 | 0.26 ± 0.47 | 0.06 ± 0.08 | 0.816 |
| Genus level | |||||
| Romboutsia | 49.96 ± 19.41 a | 31.65 ± 22.58 ab | 9.51 ± 5.96 b | 9.56 ± 5.22 b | 0.006 |
| unclassified Lachnospiraceae | 4.04 ± 4.73 b | 4.69 ± 2.85 b | 15.96 ± 5.10 a | 15.54 ± 6.06 a | 0.001 |
| Turicibacter | 17.82 ± 17.55 a | 6.85 ± 6.29 ab | 1.46 ± 1.40 b | 2.80 ± 2.35 ab | 0.030 |
| norank Clostridia vadinBB60 group | 2.70 ± 2.54 b | 6.14 ± 4.81 a | 9.94 ± 2.18 a | 8.52 ± 4.91 a | 0.026 |
| norank Clostridia UCG-014 | 3.49 ± 2.85 | 8.94 ± 2.69 | 6.11 ± 2.04 | 6.40 ± 1.77 | 0.293 |
| Faecalibacterium | 3.99 ± 3.50 | 6.15 ± 2.70 | 7.54 ± 4.95 | 6.22 ± 3.42 | 0.449 |
| Blautia | 1.18 ± 0.92 b | 3.74 ± 3.45 ab | 8.26 ± 4.73 a | 8.25 ± 3.89 a | 0.002 |
| Ruminococcus torques group | 0.79 ± 0.76 b | 1.89 ± 1.51 b | 3.06 ± 1.49 ab | 5.65 ± 3.23 a | 0.002 |
| Lactobacillus | 0.54 ± 0.76 | 2.92 ± 3.77 | 4.78 ± 9.63 | 1.37 ± 1.06 | 0.460 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, Y.-Y.; Liu, X.-P.; Zhou, Y.-H.; He, J.-Y.; Di, B.; Zheng, X.-Y.; Guo, P.-T.; Zhang, J.; Wang, C.-K.; Jin, L. The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers. Animals 2024, 14, 2926. https://doi.org/10.3390/ani14202926
Gao Y-Y, Liu X-P, Zhou Y-H, He J-Y, Di B, Zheng X-Y, Guo P-T, Zhang J, Wang C-K, Jin L. The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers. Animals. 2024; 14(20):2926. https://doi.org/10.3390/ani14202926
Chicago/Turabian StyleGao, Yu-Yun, Xiao-Ping Liu, Ying-Huan Zhou, Jia-Yi He, Bin Di, Xian-Yue Zheng, Ping-Ting Guo, Jing Zhang, Chang-Kang Wang, and Ling Jin. 2024. "The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers" Animals 14, no. 20: 2926. https://doi.org/10.3390/ani14202926
APA StyleGao, Y.-Y., Liu, X.-P., Zhou, Y.-H., He, J.-Y., Di, B., Zheng, X.-Y., Guo, P.-T., Zhang, J., Wang, C.-K., & Jin, L. (2024). The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers. Animals, 14(20), 2926. https://doi.org/10.3390/ani14202926

