RNA-Seq Analysis Revealed circRNAs and Genes Associated with Abdominal Fat Deposition in Ducks
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Test Animals and Tissue Samples
2.3. RNA Isolation, Library Construction, Sequencing, and Data Quality Control
2.4. Identification and Differential Expression Analysis of circRNAs
2.5. Target Gene Prediction and Functional Enrichment Analysis of Differential circRNAs
2.6. qRT-PCR Validation of Candidate circRNAs
2.7. Statistical Analysis
3. Results
3.1. Abdominal Fat Ratio and Meat Quality Differences between HF and LF Groups
3.2. Identification and Characterization of circRNA Library in Duck Fat Tissue
3.3. Analysis and Validation of Differentially Expressed circRNAs between Abdominal Fat of HF and LF Ducks
3.4. Functional Enrichment Analysis of DE circRNAs Source Genes
3.5. Functional Enrichment of DE circRNA Target Genes Related to Fat Deposition
3.6. Establishment of a Lipid-Deposition-Related Competing Endogenous RNA Network
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hou, S.; Liu, L. Current status, future development trend and suggestions of waterfowl industry in 2022. Chin. J. Anim. Sci. 2023, 59, 274–280. [Google Scholar]
- Wang, J.; Hua, L.; Chen, J.; Zhang, J.; Bai, X.; Gao, B.; Li, C.; Shi, Z.; Sheng, W.; Gao, Y.; et al. Identification and characterization of long non-coding RNAs in subcutaneous adipose tissue from castrated and intact full-sib pair Huainan male pigs. BMC Genom. 2017, 18, 542. [Google Scholar] [CrossRef]
- Yang, C.; Wang, Z.; Song, Q.; Dong, B.; Bi, Y.; Bai, H.; Jiang, Y.; Chang, G.; Chen, G. Transcriptome Sequencing to Identify Important Genes and lncRNAs Regulating Abdominal Fat Deposition in Ducks. Animals 2022, 12, 1256. [Google Scholar] [CrossRef] [PubMed]
- Bacakova, L.; Zarubova, J.; Travnickova, M.; Musilkova, J.; Pajorova, J.; Slepicka, P.; Kasalkova, N.S.; Svorcik, V.; Kolska, Z.; Motarjemi, H.; et al. Stem cells: Their source, potency and use in regenerative therapies with focus on adipose-derived stem cells—A review. Biotechnol. Adv. 2018, 36, 1111–1126. [Google Scholar] [CrossRef]
- Han, F.; Li, J.; Zhao, R.; Liu, L.; Li, L.; Li, Q.; He, J.; Liu, N. Identification and co-expression analysis of long noncoding RNAs and mRNAs involved in the deposition of intramuscular fat in Aohan fine-wool sheep. BMC Genom. 2021, 22, 98. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Chang, X.; Kang, Y.; Zhao, X.; Tang, X.; Ma, C.; Fu, S. circRNA: A novel potential strategy to treat thyroid cancer (Review). Int. J. Mol. Med. 2021, 48, 201. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Cai, Z.; Mu, T.; Yu, B.; Wang, Y.; Ma, R.; Liu, J.; Wang, C.; Zhang, J.; Gu, Y. circRNA screening and ceRNA network construction for milk fat metabolism in dairy cows. Front. Vet. Sci. 2022, 9, 995629. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Liu, X.; Deng, Y.; Li, Z.; Tang, A. circRNA-mediated regulation of brown adipose tissue adipogenesis. Front. Nutr. 2022, 9, 926024. [Google Scholar] [CrossRef]
- Li, B.; He, Y.; Wu, W.; Tan, X.; Wang, Z.; Irwin, D.M.; Wang, Z.; Zhang, S. Circular RNA profiling identifies novel circPPARA that promotes intramuscular fat deposition in pigs. J. Agric. Food Chem. 2022, 70, 4123–4137. [Google Scholar] [CrossRef]
- Li, X.; Zhang, H.; Wang, Y.; Li, Y.; Wang, Y.; Zhu, J.; Lin, Y. Chi-Circ_0006511 positively regulates the differentiation of goat intramuscular adipocytes via novel-miR-87/CD36 axis. Int. J. Mol. Sci. 2022, 23, 12295. [Google Scholar] [CrossRef]
- Feng, X.; Zhao, J.; Li, F.; Aloufi, B.H.; Alshammari, A.M.; Ma, Y. Weighted gene co-expression network analysis revealed that circMARK3 is a potential circRNA affects fat deposition in buffalo. Front. Vet. Sci. 2022, 9, 946447. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Liang, W.; Wang, S.; Wang, Z.; Bai, H.; Jiang, Y.; Bi, Y.; Chen, G.; Chang, G. Circular RNA expression profiling reveals that circ-PLXNA1 functions in duck adipocyte differentiation. PLoS ONE 2020, 15, e0236069. [Google Scholar] [CrossRef]
- Xiao, C.; Sun, T.; Yang, Z.; Zou, L.; Deng, J.; Yang, X. Whole-transcriptome RNA sequencing reveals the global molecular responses and circRNA/lncRNA-miRNA-mRNA ceRNA regulatory network in chicken fat deposition. Poult. Sci. 2022, 101, 102121. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Yang, B.; Dong, Z.; Geng, D.; Wang, C.; Guo, Q.; Jiang, Y.; Chen, G.; Chang, G.; Bai, H. Growth performance, carcass traits, meat quality, and blood variables of small-sized meat ducks with different feed efficiency phenotypes. Poult. Sci. 2023, 102, 102818. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [PubMed]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef] [PubMed]
- Glažar, P.; Papavasileiou, P.; Rajewsky, N. circBase: A database for circular RNAs. RNA 2014, 20, 1666–1670. [Google Scholar] [CrossRef]
- Agudelo, L.Z.; Ferreira, D.M.S.; Cervenka, I.; Bryzgalova, G.; Dadvar, S.; Jannig, P.R.; Pettersson-Klein, A.T.; Lakshmikanth, T.; Sustarsic, E.G.; Porsmyr-Palmertz, M.; et al. Kynurenic acid and Gpr35 regulate adipose tissue energy homeostasis and inflammation. Cell Metab. 2018, 27, 378–392.e5. [Google Scholar] [CrossRef]
- Emmerson, D.A. Commercial approaches to genetic selection for growth and feed conversion in domestic poultry. Poult. Sci. 1997, 76, 1121–1125. [Google Scholar] [CrossRef]
- Huo, W.; Weng, K.; Gu, T.; Zhang, Y.; Zhang, Y.; Chen, G.; Xu, Q. Difference in developmental dynamics between subcutaneous and abdominal adipose tissues in goose (Anser cygnoides). Poult. Sci. 2021, 100, 101185. [Google Scholar] [CrossRef] [PubMed]
- Hocquette, J.F.; Gondret, F.; Baéza, E.; Médale, F.; Jurie, C.; Pethick, D.W. Intramuscular fat content in meat-producing animals: Development, genetic and nutritional control, and identification of putative markers. Animal 2010, 4, 303–319. [Google Scholar] [CrossRef] [PubMed]
- Bonny, S.P.; Gardner, G.E.; Pethick, D.W.; Legrand, I.; Polkinghorne, R.J.; Hocquette, J.F. Biochemical measurements of beef are a good predictor of untrained consumer sensory scores across muscles. Animal 2015, 9, 179–190. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Wang, L.; Xing, K.; Yang, Y.; Abiola Adetula, A.; Liu, Y.; Yi, G.; Zhang, H.; Sweeney, T.; Tang, Z. Identification of circRNAs associated with adipogenesis based on RNA-seq data in pigs. Genes 2022, 13, 2062. [Google Scholar] [CrossRef] [PubMed]
- Yuan, P.; Zhao, Y.; Li, H.; Li, S.; Fan, S.; Zhai, B.; Li, Y.; Han, R.; Liu, X.; Tian, Y.; et al. circRNAs related to breast muscle development and their interaction regulatory network in Gushi chicken. Genes 2022, 13, 1974. [Google Scholar] [CrossRef] [PubMed]
- Lien, E.C.; Westermark, A.M.; Zhang, Y.; Yuan, C.; Li, Z.; Lau, A.N.; Sapp, K.M.; Wolpin, B.M. Low glycaemic diets alter lipid metabolism to influence tumour growth. Nature 2021, 599, 302–307. [Google Scholar] [CrossRef] [PubMed]
- Hao, Z.; Luo, Y.; Wang, J.; Hickford, J.G.H.; Zhou, H.; Hu, J.; Liu, X.; Li, S.; Shen, J.; Ke, N.; et al. MicroRNA-432 inhibits milk fat synthesis by targeting SCD and LPL in ovine mammary epithelial cells. Food Funct. 2021, 12, 9432–9442. [Google Scholar] [CrossRef]
- Bhatt-Wessel, B.; Jordan, T.W.; Miller, J.H.; Peng, L. Role of DGAT enzymes in triacylglycerol metabolism. Arch. Biochem. Biophys. 2018, 655, 1–11. [Google Scholar] [CrossRef]
- Zammit, V.A. Hepatic triacylglycerol synthesis and secretion: DGAT2 as the link between glycaemia and triglyceridaemia. Biochem. J. 2013, 451, 1–12. [Google Scholar] [CrossRef]
- Patop, I.L.; Wüst, S.; Kadener, S. Past, present, and future of circRNAs. EMBO J. 2019, 38, e100836. [Google Scholar] [CrossRef]
- Chen, L.; Wang, C.; Sun, H.; Wang, J.; Liang, Y.; Wang, Y.; Wong, G. The bioinformatics toolbox for circRNA discovery and analysis. Brief. Bioinform. 2021, 22, 1706–1728. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Lu, Q.; Liang, Y.; Cui, X.; Wang, X.; Mao, Y.; Yang, Z. Circ11103 interacts with miR-128/PPARGC1A to regulate milk fat metabolism in dairy cows. J. Agric. Food Chem. 2021, 69, 4490–4500. [Google Scholar] [CrossRef] [PubMed]
- Cocquerelle, C.; Mascrez, B.; Hétuin, D.; Bailleul, B. Mis-splicing yields circular RNA molecules. FASEB J. 1993, 7, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Tian, W.; Liu, Y.; Zhang, W.; Nie, R.; Ling, Y.; Zhang, B.; Zhang, H.; Wu, C. CircDOCK7 facilitates the proliferation and adipogenic differentiation of chicken abdominal preadipocytes through the gga-miR-301b-3p/ACSL1 axis. J. Anim. Sci. Biotechnol. 2023, 14, 91. [Google Scholar] [CrossRef]
- Bougarne, N.; Weyers, B.; Desmet, S.J.; Deckers, J.; Ray, D.W.; Staels, B.; De Bosscher, K. Molecular actions of PPARα in lipid metabolism and inflammation. Endocr. Rev. 2018, 39, 760–802. [Google Scholar] [CrossRef]
- Homan, E.P.; Brandão, B.B.; Softic, S.; El Ouaamari, A.; O’Neill, B.T.; Kulkarni, R.N.; Kim, J.K.; Kahn, C.R. Differential roles of FOXO transcription factors on insulin action in brown and white adipose tissue. J. Clin. Investig. 2021, 131, e143328. [Google Scholar] [CrossRef]
circRNAs | Source Gene | Primer Sequences (5′→3′) | Product Size/bp |
---|---|---|---|
Reference gene | GAPDH | F:GGTTGTCTCCTGCGACTTCA R:TCCTTGGATGCCATGTGGAC | 116 |
novel_circ_000972 | DOCK4 | F: AATGCAGGTCTGGCAGTTTCT R: TCTGGACATTTTGGCAAACCAT | 184 |
novel_circ_001389 | VIM | F: CATCTACGCCACCATGAGCA R: TGCTGCTCACCACGTAGC | 104 |
novel_circ_001719 | TRIO | F: CCAGCGCCAACTGGAAAAC R:ACATACACATTCTGTTGAACATCCT | 102 |
novel_circ_001752 | COBL | F: GCTGGTCAATGGCTACATGG R: AGCGAAACACTTCGACTTGG | 136 |
novel_circ_003245 | MAEA | F: CAAAGTGGTATTGAGGTGCCAT R: TCTGCCACCACCATCGTAAC | 104 |
Items | HF | LF | SEM | p Value |
---|---|---|---|---|
42 d BW (g) | 2415.40 | 2166.20 | 140.53 | 0.09 |
Breast muscle ratio (%) | 8.22 | 8.70 | 0.52 | 0.36 |
Abdominal fat ratio (%) | 1.68 | 0.49 | 0.03 | <0.001 |
Intramuscular fat ratio (%) | 1.54 | 1.25 | 0.11 | 0.01 |
Moisture ratio (%) | 76.80 | 77.35 | 0.33 | 0.11 |
Protein ratio (%) | 22.19 | 22.10 | 0.36 | 0.80 |
Collagen ratio(%) | 1.64 | 1.63 | 0.12 | 0.94 |
Sample | All Reads Number | Unmapped Ratio | Mapping Ratio |
---|---|---|---|
HF-1 | 87,142,012 | 89.92% | 10.08% |
HF-2 | 67,035,628 | 75.00% | 25.00% |
HF-3 | 79,462,332 | 85.29% | 14.71% |
HF-4 | 87,183,872 | 76.30% | 23.70% |
LF-1 | 64,023,818 | 71.00% | 29.00% |
LF-2 | 97,749,872 | 96.48% | 3.52% |
LF-3 | 84,850,608 | 84.99% | 15.01% |
LF-4 | 89,618,340 | 91.50% | 8.50% |
Sample | Total Reads | Mapping Ratio | Unmapped Ratio | Anchors Number | Mapped Anchors | Mapping Ratio |
---|---|---|---|---|---|---|
HF-1 | 78,360,250 | 83.08% | 16.92% | 26,513,884 | 16,595,685 | 62.59% |
HF-2 | 50,275,220 | 80.52% | 19.48% | 19,586,420 | 10,861,523 | 55.45% |
HF-3 | 67,770,884 | 83.08% | 16.92% | 22,933,808 | 13,822,768 | 60.27% |
HF-4 | 66,524,018 | 83.13% | 16.87% | 22,450,874 | 13,451,724 | 59.92% |
LF-1 | 45,459,676 | 79.80% | 20.20% | 18,362,120 | 9,580,656 | 52.18% |
LF-2 | 94,305,132 | 83.36% | 16.64% | 31,391,256 | 20,007,383 | 63.74% |
LF-3 | 72,114,628 | 84.30% | 15.70% | 22,648,508 | 14,544,476 | 64.22% |
LF-4 | 82,004,742 | 85.06% | 14.94% | 24,508,692 | 16,125,034 | 65.79% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Yang, C.; Zhuang, Z.; Mao, J.; Chen, A.; Zhou, T.; Bai, H.; Jiang, Y.; Chang, G.; Wang, Z. RNA-Seq Analysis Revealed circRNAs and Genes Associated with Abdominal Fat Deposition in Ducks. Animals 2024, 14, 260. https://doi.org/10.3390/ani14020260
Yang Y, Yang C, Zhuang Z, Mao J, Chen A, Zhou T, Bai H, Jiang Y, Chang G, Wang Z. RNA-Seq Analysis Revealed circRNAs and Genes Associated with Abdominal Fat Deposition in Ducks. Animals. 2024; 14(2):260. https://doi.org/10.3390/ani14020260
Chicago/Turabian StyleYang, Yunfeng, Chunyan Yang, Zhong Zhuang, Jiaming Mao, Anqi Chen, Tingting Zhou, Hao Bai, Yong Jiang, Guobin Chang, and Zhixiu Wang. 2024. "RNA-Seq Analysis Revealed circRNAs and Genes Associated with Abdominal Fat Deposition in Ducks" Animals 14, no. 2: 260. https://doi.org/10.3390/ani14020260
APA StyleYang, Y., Yang, C., Zhuang, Z., Mao, J., Chen, A., Zhou, T., Bai, H., Jiang, Y., Chang, G., & Wang, Z. (2024). RNA-Seq Analysis Revealed circRNAs and Genes Associated with Abdominal Fat Deposition in Ducks. Animals, 14(2), 260. https://doi.org/10.3390/ani14020260