CircERCC6 Positively Regulates the Induced Activation of SHF Stem Cells in Cashmere Goats via the miR-412-3p/BNC2 Axis in an m6A-Dependent Manner
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Skin Tissue, Preparation, and Extraction of Total RNA
2.2. Characteristic Analysis of Cashmere Goat circERCC6 Sequence
2.3. Analysis of Overexpression and Knockdown of circERCC6 in SHF-Stem Cells
2.4. Designing of RT-qPCR Primers and the Reaction Assay
2.5. Methylation Immunoprecipitation of circERCC6 (Me-RIP) Assay
2.6. Dual-Luciferase Reporter Assays
2.7. Data Statistical Analysis
3. Results and Discussion
3.1. Molecular Characterization Analysis of SHF circERCC6 in Cashmere Goats
3.2. Expression Patterns of circERCC6 in SHF Bulge of Cashmere Goats and Its Roles in Regulating the Induced Activation of SHF Stem Cells
3.3. The m6A Modifications of circERCC6 Are Significantly Involved in the Induced Activation of SHF-Stem Cells
3.4. CircERCC6 Sponges miR-412-3p and May Negatively Regulate Its Expression in SHF Stem Cells
3.5. CircERCC6 Promotes the BNC2 Expression in SHF-Stem Cells of Cashmere Goats through Sponging miR-412-3p
3.6. The m6A Modification Is Required for the circERCC6 Function Exertion via miR-412-3p/BNC2 Pathway
3.7. The miR-412-3p/BNC2 Pathway Restores the Induced Activation of SHF Stem Cells with circERCC6 Deficient
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, S.; Ge, W.; Luo, Z.; Guo, Y.; Jiao, B.; Qu, L.; Zhang, Z.; Wang, X. Integrated analysis of coding genes and non-coding RNAs during hair follicle cycle of cashmere goat (Capra hircus). BMC Genom. 2017, 18, 767. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Wang, Y.; Zhao, J.; Shen, J.; Wang, Z.; Bai, M.; Fan, Y.; Yin, R.; Mao, Y.; Bai, W. CircRNA-1967 participates in the differentiation of goat SHF-SCs into hair follicle lineage by sponging miR-93-3p to enhance LEF1 expression. Anim. Biotechnol. 2023, 34, 482–494. [Google Scholar] [CrossRef] [PubMed]
- Ji, X.Y.; Wang, J.X.; Liu, B.; Zheng, Z.Q.; Fu, S.Y.; Tarekegn, G.M.; Bai, X.; Bai, Y.S.; Li, H.; Zhang, W.G. Comparative Transcriptome Analysis Reveals that a Ubiquitin-Mediated Proteolysis Pathway Is Important for Primary and Secondary Hair Follicle Development in Cashmere Goats. PLoS ONE 2016, 11, e0156124. [Google Scholar] [CrossRef] [PubMed]
- Avigad Laron, E.; Aamar, E.; Enshell-Seijffers, D. The Mesenchymal Niche of the Hair Follicle Induces Regeneration by Releasing Primed Progenitors from Inhibitory Effects of Quiescent Stem Cells. Cell Rep. 2018, 24, 909–921.e3. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Gao, Y.; Ding, Q.; Liu, J.; Li, Y.; Jin, M.; Xu, H.; Ma, S.; Wang, X.; Zeng, W.; et al. Exosomal Micro RNAs Derived from Dermal Papilla Cells Mediate Hair Follicle Stem Cell Proliferation and Differentiation. Int. J. Biol. Sci. 2019, 15, 1368–1382. [Google Scholar] [CrossRef] [PubMed]
- Yin, R.; Yin, R.; Bai, M.; Fan, Y.; Wang, Z.; Zhu, Y.; Zhang, Q.; Hui, T.; Shen, J.; Feng, S.; et al. N6-Methyladenosine modification (m6A) of circRNA-ZNF638 contributes to the induced activation of SHF stem cells through miR-361-5p/Wnt5a axis in cashmere goats. Anim. Biosci. 2023, 36, 555–569. [Google Scholar] [CrossRef] [PubMed]
- Du, K.T.; Deng, J.Q.; He, X.G.; Liu, Z.P.; Peng, C.; Zhang, M.S. MiR-214 Regulates the Human Hair Follicle Stem Cell Proliferation and Differentiation by Targeting EZH2 and Wnt/β-Catenin Signaling Way In Vitro. Tissue Eng. Regen. Med. 2018, 15, 341–350. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Wu, Y.; Xie, F.; Zhang, F.; Zhang, S.; Zhou, J.; Chen, D.; Liu, A. miR-339-5p negatively regulates loureirin A-induced hair follicle stem cell differentiation by targeting DLX5. Mol. Med. Rep. 2018, 18, 1279–1286. [Google Scholar] [CrossRef]
- Yin, R.H.; Zhao, S.J.; Jiao, Q.; Wang, Z.Y.; Bai, M.; Fan, Y.X.; Zhu, Y.B.; Bai, W.L. CircRNA-1926 Promotes the Differentiation of Goat SHF Stem Cells into Hair Follicle Lineage by miR-148a/b-3p/CDK19 Axis. Animals 2020, 10, 1552. [Google Scholar] [CrossRef]
- Shen, J.; Wang, Y.; Bai, M.; Fan, Y.; Wang, Z.; Bai, W. Novel circRNAs from cashmere goats: Discovery, integrated regulatory network, and their putative roles in the regeneration and growth of secondary hair follicles. Czech. J. Anim. Sci. 2022, 67, 237–251. [Google Scholar] [CrossRef]
- Zhao, J.; Shen, J.; Wang, Z.; Bai, M.; Fan, Y.; Zhu, Y.; Bai, W. CircRNA-0100 positively regulates the differentiation of cashmere goat SHF-SCs into hair follicle lineage via sequestering miR-153-3p to heighten the KLF5 expression. Arch. Anim. Breed. 2022, 65, 55–67. [Google Scholar] [CrossRef]
- Yang, Y.; Fan, X.; Mao, M.; Song, X.; Wu, P.; Zhang, Y.; Jin, Y.; Yang, Y.; Chen, L.L.; Wang, Y.; et al. Extensive translation of circular RNAs driven by N6-methyladenosine. Cell Res. 2017, 27, 626–641. [Google Scholar] [CrossRef] [PubMed]
- Su, H.; Wang, G.; Wu, L.; Ma, X.; Ying, K.; Zhang, R. Transcriptome-wide map of m6A circRNAs identified in a rat model of hypoxia mediated pulmonary hypertension. BMC Genom. 2020, 21, 39. [Google Scholar] [CrossRef] [PubMed]
- Rao, X.; Lai, L.; Li, X.; Wang, L.; Li, A.; Yang, Q. N6 -methyladenosine modification of circular RNA circ-ARL3 facilitates Hepatitis B virus-associated hepatocellular carcinoma via sponging miR-1305. IUBMB Life 2021, 73, 408–417. [Google Scholar] [CrossRef] [PubMed]
- Tang, C.; Xie, Y.; Yu, T.; Liu, N.; Wang, Z.; Woolsey, R.J.; Tang, Y.; Zhang, X.; Qin, W.; Zhang, Y.; et al. m6A-dependent biogenesis of circular RNAs in male germ cells. Cell Res. 2020, 30, 211–228. [Google Scholar] [CrossRef] [PubMed]
- Hui, T.; Zhu, Y.; Shen, J.; Bai, M.; Fan, Y.; Feng, S.; Wang, Z.; Zhao, J.; Zhang, Q.; Liu, X.; et al. Identification and Molecular Analysis of m6A-circRNAs from Cashmere Goat Reveal Their Integrated Regulatory Network and Putative Functions in Secondary Hair Follicle during Anagen Stage. Animals 2022, 12, 694. [Google Scholar] [CrossRef] [PubMed]
- Ohyama, M.; Kobayashi, T. Isolation and characterization of stem cell-enriched human and canine hair follicle keratinocytes. Methods Mol Biol. 2012, 879, 389–401. [Google Scholar] [CrossRef] [PubMed]
- Han, W.; Yang, F.; Wu, Z.; Guo, F.; Zhang, J.; Hai, E.; Shang, F.; Su, R.; Wang, R.; Wang, Z.; et al. Inner Mongolian Cashmere Goat Secondary Follicle Development Regulation Research Based on mRNA-miRNA Co-analysis. Sci. Rep. 2020, 10, 4519. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chen, Z.; Ling, K.; Zhu, Y.; Deng, L.; Li, Y.; Liang, Z. circ0000069 promotes cervical cancer cell proliferation and migration by inhibiting miR-4426. Biochem. Biophys. Res. Commun. 2021, 551, 114–120. [Google Scholar] [CrossRef]
- Yu, C.; Li, L.; Xie, F.; Guo, S.; Liu, F.; Dong, N.; Wang, Y. LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification. Cardiovasc. Res. 2018, 114, 168–179. [Google Scholar] [CrossRef] [PubMed]
- Kristensen, L.S.; Andersen, M.S.; Stagsted, L.V.W.; Ebbesen, K.K.; Hansen, T.B.; Kjems, J. The biogenesis, biology and characterization of circular RNAs. Nat. Rev. Genet. 2019, 20, 675–691. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Chai, P.; Jia, R.; Jia, R. Novel insights on m6A RNA methylation in tumorigenesis: A double-edged sword. Mol. Cancer 2018, 17, 101. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Qiao, J.; Wang, G.; Lan, Y.; Li, G.; Guo, X.; Xi, J.; Ye, D.; Zhu, S.; Chen, W.; et al. N6-Methyladenosine modification of lincRNA 1281 is critically required for mESC differentiation potential. Nucleic Acids Res. 2018, 46, 3906–3920. [Google Scholar] [CrossRef] [PubMed]
- Hansen, T.B.; Jensen, T.I.; Clausen, B.H.; Bramsen, J.B.; Finsen, B.; Damgaard, C.K.; Kjems, J. Natural RNA circles function as efficient microRNA sponges. Nature 2013, 495, 384–388. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.U.; Agarwal, V.; Guo, H.; Bartel, D.P. Expanded identification and characterization of mammalian circular RNAs. Genome Biol. 2014, 15, 409. [Google Scholar] [CrossRef] [PubMed]
- Han, K.; Wang, F.W.; Cao, C.H.; Ling, H.; Chen, J.W.; Chen, R.X.; Feng, Z.H.; Luo, J.; Jin, X.H.; Duan, J.L.; et al. CircLONP2 enhances colorectal carcinoma invasion and metastasis through modulating the maturation and exosomal dissemination of microRNA-17. Mol. Cancer. 2020, 19, 60. [Google Scholar] [CrossRef]
- Chang, Z.; Zhang, W.; Su, R.; Wang, R.; Liang, Y.; Chai, J.; Li, J. Construction of signal transduction gene network of regulating hair follicle development. In Proceedings of the 2006 Annual Meeting of the Chinese Society of Animal Husbandry and Veterinary Medicine, Beijing, China, 29–31 October 2006; Volume 1, pp. 180–184. [Google Scholar]
- Geng, Y.; Jiang, J.; Wu, C. Function and clinical significance of circRNAs in solid tumors. J. Hematol. Oncol. 2018, 11, 98. [Google Scholar] [CrossRef]
- Haussmann, I.U.; Bodi, Z.; Sanchez-Moran, E.; Mongan, N.P.; Archer, N.; Fray, R.G.; Soller, M. m6A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. Nature 2016, 540, 301–304. [Google Scholar] [CrossRef]
- Alarcón, C.R.; Lee, H.; Goodarzi, H.; Halberg, N.; Tavazoie, S.F. N6-methyladenosine marks primary microRNAs for processing. Nature 2015, 519, 482–485. [Google Scholar] [CrossRef]
- Meyer, K.D.; Saletore, Y.; Zumbo, P.; Elemento, O.; Mason, C.E.; Jaffrey, S.R. Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell 2012, 149, 1635–1646. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Dai, Q.; Zheng, G.; He, C.; Parisien, M.; Pan, T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature 2015, 518, 560–564. [Google Scholar] [CrossRef] [PubMed]
- Vanhoutteghem, A.; Delhomme, B.; Hervé, F.; Nondier, I.; Petit, J.M.; Araki, M.; Araki, K.; Djian, P. The importance of basonuclin 2 in adult mice and its relation to basonuclin 1. Mech. Dev. 2016, 140, 53–73. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; He, X.C.; Tong, W.G.; Johnson, T.; Wiedemann, L.M.; Mishina, Y.; Feng, J.Q.; Li, L. Bone morphogenetic protein signaling inhibits hair follicle anagen induction by restricting epithelial stem/progenitor cell activation and expansion. Stem Cells 2006, 24, 2826–2839. [Google Scholar] [CrossRef]
- Plikus, M.V.; Mayer, J.A.; de la Cruz, D.; Baker, R.E.; Maini, P.K.; Maxson, R.; Chuong, C.M. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration. Nature 2008, 451, 340–344. [Google Scholar] [CrossRef]
- Gat, U.; DasGupta, R.; Degenstein, L.; Fuchs, E. De Novo hair follicle morphogenesis and hair tumors in mice expressing a truncated beta-catenin in skin. Cell 1998, 95, 605–614. [Google Scholar] [CrossRef]
Gene Name | Reference | Sequence (5′-3′) | Primer Length (nt) | Amplicon Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|---|
CircERCC6 (Divergent primers) | Shen et al., 2022 [10] | F: CAGAGACGCCAAGTTTGAGG, R: TGTACACCGTCACCTGCTTT | 20 | 194 | 55 |
20 | |||||
CK6 | Yin et al., 2022 [6] | F: AGTTTGCCTCCTTCATCG, R: GGTTCTGCTTCACGGTCTT | 18 | 111 | 53 |
19 | |||||
Ki67 | Yin et al., 2022 [6] | F: AGGAAGTAGCCAGACTGAGGG, R: GCATCGTGGTTTGCTGTGAA | 21 | 143 | 56 |
20 | |||||
Sox9 | Yin et al., 2022 [6] | F: GGTGCTCAAGGGCTACGACTGG, R: GCGTTGTGCAGGTGCGGGTA | 22 | 162 | 60 |
20 | |||||
CD34 | Yin et al., 2022 [6] | F: GAAGATGTCAGCAGCCACCAG, R: GGCGGTTCATCAGGAAATAGCAC | 21 | 112 | 56 |
23 | |||||
CD200 | Yin et al., 2022 [6] | F: TTGGAAGATGAGGCGTGTTA, R: AGCATTGGCAGAGCAAGTGA | 20 | 156 | 54 |
20 | |||||
GAPDH | Yin et al., 2022 [6] | F: TGAACCACGAGAAGTATAACAACA, R: GGTCATAAGTCCCTCCACGAT | 24 | 125 | 53 |
21 | |||||
CircERCC6 (Me-RIP-qPCR) | This study | F: GGAACTGGTTCAGATGTTCAGAC, R: CTGTCCCCGTTTTCGTGA | 23 | 316 | 56 |
18 | |||||
miR-412-3p | MIMAT0036218 in miRNAsong | F: GCACTTCACCTGGTCCACTAGCT | 23 | Not available | 59 |
U6 | Han et al., 2020 [18] | F: CGCTTCGGCAGCACATATAC, R:AAATATGGAACGCTTCACGA | 20 | Not available | 55 |
20 | |||||
BNC2 | XM_018051926.1 | F: CCTCCCGACCAGTCCTATCA, R: CTTCCTGGGCTTCTTCTTGG | 20 | 142 | 57 |
20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Q.; Fan, Y.; Bai, M.; Zhu, Y.; Wang, Z.; Shen, J.; Xu, R.; Zheng, W.; Bai, W. CircERCC6 Positively Regulates the Induced Activation of SHF Stem Cells in Cashmere Goats via the miR-412-3p/BNC2 Axis in an m6A-Dependent Manner. Animals 2024, 14, 187. https://doi.org/10.3390/ani14020187
Zhang Q, Fan Y, Bai M, Zhu Y, Wang Z, Shen J, Xu R, Zheng W, Bai W. CircERCC6 Positively Regulates the Induced Activation of SHF Stem Cells in Cashmere Goats via the miR-412-3p/BNC2 Axis in an m6A-Dependent Manner. Animals. 2024; 14(2):187. https://doi.org/10.3390/ani14020187
Chicago/Turabian StyleZhang, Qi, Yixing Fan, Man Bai, Yubo Zhu, Zeying Wang, Jincheng Shen, Ruqing Xu, Wenxin Zheng, and Wenlin Bai. 2024. "CircERCC6 Positively Regulates the Induced Activation of SHF Stem Cells in Cashmere Goats via the miR-412-3p/BNC2 Axis in an m6A-Dependent Manner" Animals 14, no. 2: 187. https://doi.org/10.3390/ani14020187
APA StyleZhang, Q., Fan, Y., Bai, M., Zhu, Y., Wang, Z., Shen, J., Xu, R., Zheng, W., & Bai, W. (2024). CircERCC6 Positively Regulates the Induced Activation of SHF Stem Cells in Cashmere Goats via the miR-412-3p/BNC2 Axis in an m6A-Dependent Manner. Animals, 14(2), 187. https://doi.org/10.3390/ani14020187