Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Particle Size Analysis of Wheat Bran
2.3. Chemical Analyses
2.3.1. Digestibility
2.3.2. The pH of Gizzard, Jejunum, and Cecal Contents
2.3.3. Jejunum Histomorphology
2.3.4. Real-Time PCR Analysis
2.3.5. Cecal Short-Chain-Fatty-Acid Analysis
2.3.6. Oligosaccharide Analysis
2.4. Statistical Analysis
3. Results
3.1. Growth Performance of Broilers in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion
3.2. Digesta pH in Response to Dietary Supplementation of Stimbiotic or Wheat Bran Inclusion
3.3. Ileal Nutrient Digestibility in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion
3.4. Jejunum Histomorphology in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion
3.5. Jejunum mRNA Expression of Nutrient Transporters in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion
3.6. Profile of Cecal Short-Chain Fatty Acids in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion
3.7. The Oligosaccharide Profile in the Ileal Digesta of Broiler Chickens Receiving Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cho, H.M.; Gonzalez-Ortiz, G.; Melo-Duran, D.; Heo, J.M.; Cordero, G.; Bedford, M.R.; Kim, J.C. Stimbiotic supplementation improved performance and reduced inflammatory response via stimulating fiber fermenting microbiome in weaner pigs housed in a poor sanitary environment and fed an antibiotic-free low zinc oxide diet. PLoS ONE 2020, 15, e0240264. [Google Scholar] [CrossRef] [PubMed]
- Bautil, A.; Verspreet, J.; Buyse, J.; Goos, P.; Bedford, M.; Courtin, C. Arabinoxylan-oligosaccharides kick-start arabinoxylan digestion in the aging broiler. Poult. Sci. 2020, 99, 2555–2565. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, T.; Cardoso, V.; Ferreira, L.; Lordelo, M.; Coelho, E.; Moreira, A.; Domingues, M.; Coimbra, M.; Bedford, M.; Fontes, C. Xylo-oligosaccharides display a prebiotic activity when used to supplement wheat or corn-based diets for broilers. Poult. Sci. 2018, 97, 4330–4341. [Google Scholar] [CrossRef] [PubMed]
- Knudsen, K.E.B. Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets. Poult. Sci. 2014, 93, 2380–2393. [Google Scholar] [CrossRef] [PubMed]
- Shang, Q.; Wu, D.; Liu, H.; Mahfuz, S.; Piao, X. The Impact of Wheat Bran on the Morphology and Physiology of the Gastrointestinal Tract in Broiler Chickens. Animals 2020, 10, 1831. [Google Scholar] [CrossRef]
- Jiménez-Moreno, E.; González-Alvarado, J.; de Coca-Sinova, A.; Lázaro, R.; Cámara, L.; Mateos, G. Insoluble fiber sources in mash or pellets diets for young broilers. 2. Effects on gastrointestinal tract development and nutrient digestibility. Poult. Sci. 2019, 98, 2531–2547. [Google Scholar] [CrossRef]
- Saleh, A.A.; Zaki, A.; El-Awady, A.; Amber, K.; Badwi, N.; Eid, Y.; Ebeid, T.A. The effect of substituting wheat bran with cumin seed meal on laying performance, egg quality characteristics and fatty acid profile in laying hens. Vet. Arh. 2020, 90, 47–56. [Google Scholar] [CrossRef]
- Akhtar, M.; Tariq, A.F.; Awais, M.M.; Iqbal, Z.; Muhammad, F.; Shahid, M.; Hiszczynska-Sawicka, E. Studies on wheat bran Arabinoxylan for its immunostimulatory and protective effects against avian coccidiosis. Carbohydr. Polym. 2012, 90, 333–339. [Google Scholar] [CrossRef]
- Vermeulen, K.; Verspreet, J.; Courtin, C.M.; Haesebrouck, F.; Ducatelle, R.; Van Immerseel, F. Reduced particle size wheat bran is butyrogenic and lowers Salmonella colonization, when added to poultry feed. Vet. Microbiol. 2017, 198, 64–71. [Google Scholar] [CrossRef]
- Brewer, L.R.; Kubola, J.; Siriamornpun, S.; Herald, T.J.; Shi, Y.-C. Wheat bran particle size influence on phytochemical extractability and antioxidant properties. Food Chem. 2014, 152, 483–490. [Google Scholar] [CrossRef]
- Bautil, A.; Bedford, M.R.; Buyse, J.; Courtin, C.M. Reduced-particle size wheat bran and endoxylanase supplementation in broiler feed affect arabinoxylan hydrolysis and fermentation with broiler age differently. Anim. Nutr. 2023, 12, 308–320. [Google Scholar] [CrossRef] [PubMed]
- Rubio Molina, A.A. The Effects of Mixing and Pelleting Technological Applications on Feed Quality Parameters and Broiler Growth Performance. Master’s Thesis, North Carolina State University, Raleigh, NC, USA, 2022. [Google Scholar]
- ANSI/ASAE S319.5 AUG2023; Method of Determining and Expressing Fineness of Feed Materials by Sieving. American Society of Agricultural and Biological Engineers: St. Joseph, MI, USA, 2008.
- Short, F.; Gorton, P.; Wiseman, J.; Boorman, K. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef]
- Veluri, S.; Olukosi, O.A. Metabolizable Energy of Soybean Meal and Canola Meal as Influenced by the Reference Diet Used and Assay Method. Animals 2020, 10, 2132. [Google Scholar] [CrossRef] [PubMed]
- Olukosi, O.A.; Dono, N.D. Modification of digesta pH and intestinal morphology with the use of benzoic acid or phytobiotics and the effects on broiler chicken growth performance and energy and nutrient utilization. J. Anim. Sci. 2014, 92, 3945–3953. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lourenco, J.M.; Nunn, S.C.; Lee, E.J.; Dove, C.R.; Callaway, T.R.; Azain, M.J. Effect of supplemental protease on growth performance and excreta microbiome of broiler chicks. Microorganisms 2020, 8, 475. [Google Scholar] [CrossRef]
- Lin, Y.; Olukosi, O.A. Qualitative and quantitative profiles of jejunal oligosaccharides and cecal short-chain fatty acids in broiler chickens receiving different dietary levels of fiber, protein and exogenous enzymes. J. Sci. Food Agric. 2021, 101, 5190–5201. [Google Scholar] [CrossRef]
- Shang, Q.; Liu, S.; He, T.; Liu, H.; Mahfuz, S.; Ma, X.; Piao, X. Effects of wheat bran in comparison to antibiotics on growth performance, intestinal immunity, barrier function, and microbial composition in broiler chickens. Poult. Sci. 2020, 99, 4929–4938. [Google Scholar] [CrossRef]
- Veluri, S.; Gonzalez-Ortiz, G.; Bedford, M.R.; Olukosi, O.A. Interactive effects of a Stimbiotic supplementation and wheat bran inclusion in corn- or wheat-based diets on growth performance, ileal digestibility, and expression of nutrient transporters of broilers chickens. Poult. Sci. 2023, 103, 103178. [Google Scholar] [CrossRef]
- Rabie, M.; Dorra, T.; EI-Serwy, A.; El-Gogary, M. The Use of Rice Bran or Wheat Bran in Diets of Broiler Chicks. J. Anim. Poult. Prod. 2005, 30, 801–818. [Google Scholar] [CrossRef]
- Salami, S.A.; Agbonlahor, E.M.; Salako, A.O.; Sideeq, B.A.; Agboola, J.O.; Atteh, J.O. Nutritive values of wheat bran-based broiler diet supplemented with different classes of enzymes. Trop. Agric. 2018, 95, 12. [Google Scholar]
- Singh, A.K.; Mandal, R.K.; Bedford, M.R.; Jha, R. Xylanase improves growth performance, enhances cecal short-chain fatty acids production, and increases the relative abundance of fiber fermenting cecal microbiota in broilers. Anim. Feed Sci. Technol. 2021, 277, 114956. [Google Scholar] [CrossRef]
- Ketaren, P. Optimizing wheat bran utilization for poultry production through enzyme supplementation: 1. Broiler chicken. In Proceedings of the International Seminar on Tropical Animal Production (ISTAP), Yogyakarta, Indonesia, 8–9 November 2006; pp. 368–373. [Google Scholar]
- Li, B.; Schroyen, M.; Leblois, J.; Beckers, Y.; Bindelle, J.; Everaert, N. The use of inulin and wheat bran only during the starter period or during the entire rearing life of broilers: Effects on growth performance, small intestinal maturation, and cecal microbial colonization until slaughter age. Poult. Sci. 2019, 98, 4058–4065. [Google Scholar] [CrossRef] [PubMed]
- Jacobs, P.J.; Hemdane, S.; Dornez, E.; Delcour, J.A.; Courtin, C.M. Study of hydration properties of wheat bran as a function of particle size. Food Chem. 2015, 179, 296–304. [Google Scholar] [CrossRef] [PubMed]
- González-Ortiz, G.; Dos Santos, T.T.; Bedford, M.R. Evaluation of xylanase and a fermentable xylo-oligosaccharide on performance and ileal digestibility of broiler chickens fed energy and amino acid deficient diets. Anim. Nutr. 2021, 7, 488–495. [Google Scholar] [CrossRef] [PubMed]
- Šimić, A.; González-Ortiz, G.; Mansbridge, S.C.; Rose, S.P.; Bedford, M.R.; Yovchev, D.; Pirgozliev, V.R. Broiler chicken response to xylanase and fermentable xylooligosaccharide supplementation. Poult. Sci. 2023, 102, 103000. [Google Scholar] [CrossRef]
- Amerah, A.; Ravindran, V.; Lentle, R. Influence of insoluble fibre and whole wheat inclusion on the performance, digestive tract development and ileal microbiota profile of broiler chickens. Br. Poult. Sci. 2009, 50, 366–375. [Google Scholar] [CrossRef]
- Longe, O. Effects of increasing the fibre content of a layer diet. Br. Poult. Sci. 1984, 25, 187–193. [Google Scholar] [CrossRef]
- Jiménez-Moreno, E.; González-Alvarado, J.M.; González-Sánchez, D.; Lázaro, R.; Mateos, G.G. Effects of type and particle size of dietary fiber on growth performance and digestive traits of broilers from 1 to 21 days of age 1. Poult. Sci. 2010, 89, 2197–2212. [Google Scholar] [CrossRef]
- Novotný, J.; Horáková, L.; Řiháček, M.; Zálešáková, D.; Šťastník, O.; Mrkvicová, E.; Kumbár, V.; Pavlata, L. Effect of Different Feed Particle Size on Gastrointestinal Tract Morphology, Ileal Digesta Viscosity, and Blood Biochemical Parameters as Markers of Health Status in Broiler Chickens. Animals 2023, 13, 2532. [Google Scholar] [CrossRef]
- Stumpff, F. A look at the smelly side of physiology: Transport of short chain fatty acids. Pflügers Arch. Eur. J. Physiol. 2018, 470, 571–598. [Google Scholar] [CrossRef] [PubMed]
- Ruppin, H.; Bar-Meir, S.; Soergel, K.H.; Wood, C.M.; Schmitt Jr, M.G. Absorption of short-chain fatty acids by the colon. Gastroenterology 1980, 78, 1500–1507. [Google Scholar] [CrossRef] [PubMed]
- Elling-Staats, M.; Gilbert, M.; Smidt, H.; Kwakkel, R. Caecal protein fermentation in broilers: A review. World’s Poult. Sci. J. 2022, 78, 103–123. [Google Scholar] [CrossRef]
- Qaisrani, S.; Van Krimpen, M.; Kwakkel, R.; Verstegen, M.; Hendriks, W. Dietary factors affecting hindgut protein fermentation in broilers: A review. World’s Poult. Sci. J. 2015, 71, 139–160. [Google Scholar] [CrossRef]
- Gilbert, M.S.; Ijssennagger, N.; Kies, A.K.; van Mil, S.W. Protein fermentation in the gut; implications for intestinal dysfunction in humans, pigs, and poultry. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 315, G159–G170. [Google Scholar] [CrossRef]
- Nguyen, H.; Wu, S.-B.; Bedford, M.; Nguyen, X.; Morgan, N. Dietary soluble non-starch polysaccharide level and xylanase influence the gastrointestinal environment and nutrient utilisation in laying hens. Br. Poult. Sci. 2022, 63, 340–350. [Google Scholar] [CrossRef]
- Van Hoeck, V.; Papadopoulos, G.A.; Giannenas, I.; Lioliopoulou, S.; Tsiouris, V.; Mantzios, T.; Kiskinis, K.; Grivas, I.; Gonzalez Sanchez, A.L.; Vasanthakumari, B.L. New Intrinsically Thermostable Xylanase Improves Broilers’ Growth Performance, Organ Weights, and Affects Intestinal Viscosity and pH. Agriculture 2021, 11, 1235. [Google Scholar] [CrossRef]
| Items | Control | Control + Coarse WB | Control + Fine WB |
|---|---|---|---|
| Wheat bran (WB)—coarse | 50 | ||
| Wheat bran—fine | 50 | ||
| Corn | 617 | 560 | 560 |
| Soybean meal (48%) | 325 | 319 | 319 |
| Soya oil | 21.4 | 35 | 35 |
| NaCl | 3.6 | 3.6 | 3.6 |
| Limestone | 4.3 | 4.6 | 4.6 |
| Dicalcium phosphate | 12.3 | 11.8 | 11.8 |
| Lysine HCl | 2.3 | 2.4 | 2.4 |
| DL-Methionine | 2.9 | 2.9 | 2.9 |
| Threonine | 0.6 | 0.7 | 0.7 |
| Valine | 0.6 | 0.7 | 0.7 |
| Mineral premix 1 | 5.0 | 5.0 | 5.0 |
| Vitamin premix 2 | 5.0 | 5.0 | 5.0 |
| Quantum Blue 5G 3 | 0.1 | 0.1 | 0.1 |
| Total | 1000 | 1000 | 1000 |
| Calculated nutrient content, g/kg | |||
| Crude protein | 215 | 215 | 215 |
| ME kcal/kg | 3050 | 3050 | 3050 |
| Dry matter | 870 | 872 | 872 |
| Ca | 9.0 | 9.0 | 9.0 |
| Total P | 7.7 | 8.0 | 7.0 |
| Non-phytate P | 5.1 | 5.1 | 5.1 |
| Digestible amino acids, g/kg | |||
| Methionine | 6.0 | 6.1 | 6.1 |
| Cysteine | 3.7 | 3.7 | 3.7 |
| Lysine | 13.4 | 13.4 | 13.4 |
| Threonine | 8.7 | 8.7 | 8.7 |
| Tryptophan | 2.5 | 2.6 | 2.6 |
| Arginine | 14.1 | 14.2 | 14.2 |
| Valine | 10.4 | 10.4 | 10.4 |
| Isoleucine | 8.8 | 8.8 | 8.8 |
| Analyzed nutrient content | |||
| DM | 880 | 880 | 880 |
| Crude protein | 220 | 220 | 220 |
| Phytate P | 3.0 | 3.1 | 3.1 |
| Acid detergent fiber | 34.2 | 36.3 | 36.3 |
| Neutral detergent fiber | 73.8 | 89.6 | 89.6 |
| Items | Control | Control + Coarse WB | Control + Fine WB |
|---|---|---|---|
| Wheat bran (WB)—coarse | 50 | ||
| Wheat bran—fine | 50 | ||
| Corn | 683 | 626 | 626 |
| Soybean meal (48%) | 261 | 255 | 255 |
| Soya oil | 20 | 33 | 33 |
| NaCl | 3.7 | 3.7 | 3.7 |
| Limestone | 4.1 | 4.4 | 4.4 |
| Dicalcium Phosphate | 10.9 | 10.4 | 10.4 |
| Lysine HCl | 2.9 | 2.9 | 2.9 |
| DL-Methionine | 2.5 | 2.6 | 2.6 |
| Threonine | 0.7 | 0.7 | 0.7 |
| Valine | 0.8 | 0.8 | 0.8 |
| Mineral premix 1 | 5.0 | 5.0 | 5.0 |
| Vitamin premix 2 | 5.0 | 5.0 | 5.0 |
| Quantum Blue 5G 3 | 0.1 | 0.1 | 0.1 |
| Total | 1000 | 1000 | 1000 |
| Calculated nutrient content, g/kg | |||
| Crude protein | 190 | 190 | 190 |
| ME, kcal/kg | 3100 | 3100 | 3100 |
| Dry matter | 869 | 870 | 870 |
| Ca | 8.4 | 8.4 | 8.4 |
| Total P | 7.1 | 7.4 | 7.4 |
| Non-phytate P | 4.7 | 4.6 | 4.6 |
| Digestible amino acids, g/kg | |||
| Methionine | 5.4 | 5.4 | 5.4 |
| Cysteine | 3.4 | 3.4 | 3.4 |
| Lysine | 12.0 | 12.1 | 12.1 |
| Threonine | 7.8 | 7.8 | 7.8 |
| Tryptophan | 2.2 | 2.2 | 2.2 |
| Arginine | 12.0 | 12.1 | 12.1 |
| Valine | 9.4 | 9.4 | 9.4 |
| Isoleucine | 7.6 | 7.6 | 7.6 |
| Analyzed nutrient content, g/kg | |||
| Dry matter | 890 | 890 | 890 |
| Crude protein | 170 | 160 | 160 |
| Phytate P | 2.6 | 2.7 | 2.7 |
| Acid detergent fiber | 37.0 | 36.5 | 36.5 |
| Neutral detergent fiber | 78.2 | 85.9 | 85.9 |
| Items | Control | Control + Coarse WB | Control + Fine WB |
|---|---|---|---|
| Wheat bran (WB)—coarse | 50 | ||
| Wheat bran—fine | 50 | ||
| Corn | 704 | 647 | 647 |
| Soybean meal (48%) | 241 | 234 | 234 |
| Soya oil | 25 | 38 | 38 |
| NaCl | 3.7 | 3.7 | 3.7 |
| Limestone | 3.7 | 4.0 | 4.0 |
| Dicalcium phosphate | 8.5 | 8.0 | 8.0 |
| Lysine HCl | 2.0 | 2.1 | 2.1 |
| DL-Methionine | 2.1 | 2.2 | 2.2 |
| Threonine | 0.5 | 0.5 | 0.5 |
| Valine | 0.1 | 0.2 | 0.2 |
| Mineral premix 1 | 5.0 | 5.0 | 5.0 |
| Vitamin premix 2 | 5.0 | 5.0 | 5.0 |
| Quantum Blue 5G 3 | 0.1 | 0.1 | 0.1 |
| Total | 1000 | 1000 | 1000 |
| Calculated nutrient content, g/kg | |||
| Crude protein | 180 | 180 | 180 |
| ME, kcal/kg | 3150 | 3150 | 3150 |
| Dry matter | 869 | 871 | 871 |
| Calcium | 7.6 | 7.6 | 7.6 |
| Total P | 6.6 | 6.9 | 6.9 |
| Non-phytate P | 4.2 | 4.1 | 4.1 |
| Phytate | 2.4 | 2.8 | 2.8 |
| Digestible amino acids, g/kg | |||
| Methionine | 4.9 | 4.9 | 4.9 |
| Cysteine | 3.3 | 3.3 | 3.3 |
| Lysine | 10.8 | 10.8 | 10.8 |
| Threonine | 7.3 | 7.3 | 7.3 |
| Tryptophan | 2.0 | 2.1 | 2.1 |
| Arginine | 11.4 | 11.5 | 11.5 |
| Valine | 8.3 | 8.4 | 8.4 |
| Isoleucine | 7.2 | 7.2 | 7.2 |
| Analyzed nutrient content, g/kg | |||
| Dry matter | 880 | 880 | 880 |
| Crude protein | 160 | 160 | 160 |
| Phytate P | 2.7 | 2.8 | 2.8 |
| Acid detergent fiber | 36.0 | 37.5 | 37.5 |
| Neutral detergent fiber | 75.9 | 83.8 | 83.8 |
| Diet Phase | Diet | Xylanase (BXU 1/kg) | Phytase (FTU 2/kg) |
|---|---|---|---|
| Starter | Basal | <2000 | 964 |
| Basal + Coarse WB | <2000 | 875 | |
| Basal + Fine WB | <2000 | 1050 | |
| Basal + STB | 19,800 | 870 | |
| Basal + Coarse WB+ STB | 22,200 | 1100 | |
| Basal + Fine WB+ STB | 22,700 | 1040 | |
| Grower | Basal | <2000 | 950 |
| Basal + Coarse WB | <2000 | 888 | |
| Basal + Fine WB | <2000 | 1150 | |
| Basal + STB | 15,600 | 843 | |
| Basal + Coarse WB+ STB | 16,000 | 928 | |
| Basal + Fine WB+ STB | 16,300 | 1040 | |
| Finisher | Basal | <2000 | 849 |
| Basal + Coarse WB | <2000 | 1290 | |
| Basal + Fine WB | <2000 | 1220 | |
| Basal + STB | 12,500 | 960 | |
| Basal + Coarse WB+ STB | 14,300 | 991 | |
| Basal + Fine WB+ STB | 16,400 | 1010 |
| Gene | Full Name | Function | Forward Primer | Reverse Primer |
|---|---|---|---|---|
| -actin | Beta-actin | Housekeeping gene | CAACACAGTGCTGTCTGGTGGTA | ATCGTACTCCTGCTTGCTGATCC |
| b0+AT | Solute carrier family 7-member 9 | Na+-independent neutral/cysteine, cationic amino acid exchanger | CAGTAGTGAATTCTCTGAGTGTGAAGCT | GCAATGATTGCCACAACTACCA |
| GLUT-1 | Glucose Transporter 1 | Glucose transporter | CTTTGTCAACCGCTTTGG | CAGAATACAGGCCG ATGAT |
| GLUT-2 | Glucose transporter 2 | Glucose transporter | TTCATTGTAGCTGAGCTGTT | CGAAGACAACGAACACATAC |
| GLUT-5 | Glucose transporter 5 | Glucose transporter | TTGCTGGCTTTGGGTTGTG | GGAGGTTGAGGGCCAAAGTC |
| rBAT | Solute carrier family 3 member 1 | Dimerize with bo,+AT | CCCGCCGTTCAACAAGAG | AATTAAATCCATCGACTCCTTTGC |
| pepT-1 | Peptide transporter 1 | Peptide transporter | CCCCTGAGGAGGATCACTGTT | CAAAAGAGCAGCAGCAACGA |
| SGLT-1 | Sodium glucose transporter 1 | Glucose transporter | GCCGTGGCCAGGGCTTA | CAATAACCTGATCTGTGACCAGT |
| SGLT-4 | Sodium glucose transporter 4 | Glucose transporter | ATACCCAAGGTAATAGTCCCAAAC | TGGGTCCCTGAACAAATGAAA |
| y+ LAT1 | y+ L amino acid transporter 1 | Na+-dependent neutral/cationic amino acid exchanger | CAGAAAACCTCAGAGCTCCCTTT | TGAGTACAGAGCCAGCGCAAT |
| CAT2 | Cationic amino acid transporter 2 | Amino acid transporter | TGGATCAGGTTTAGCATCTG | CGGAACAAGAATCTCCATCT |
| WB, g/kg | STB | Day 0–10 | Day 0–28 | Day 0–42 | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| FI, g | Gain, g | FCR | FI, g | Gain, g | FCR | FI, g | Gain, g | FCR | ||
| Means for main effect of wheat bran | ||||||||||
| 0 | 249 b | 186 | 1.34 b | 2167 | 1514 | 1.43 b | 5074 | 2935 | 1.74 | |
| 50 g/kg Coarse | 278 a | 187 | 1.50 a | 2149 | 1471 | 1.46 a | 4901 | 2887 | 1.70 | |
| 50 g/kg Fine | 289 a | 195 | 1.48 a | 2229 | 1558 | 1.43 b | 5103 | 2922 | 1.76 | |
| Pooled SEM | 4.67 | 3.46 | 0.04 | 29 | 26 | 0.01 | 65 | 62 | 0.04 | |
| p-Value | <0.001 | 0.120 | 0.013 | 0.144 | 0.084 | 0.047 | 0.086 | 0.789 | 0.486 | |
| Means for main effect of STB | ||||||||||
| − | 264 | 190 | 1.40 | 2191 | 1516 | 1.45 | 5041 | 2944 | 1.72 | |
| + | 280 | 189 | 1.49 | 2173 | 1513 | 1.44 | 5010 | 2886 | 1.74 | |
| Pooled SEM | 3.81 | 2.82 | 0.03 | 23 | 21 | 0.01 | 53 | 51 | 0.03 | |
| p-Value | STB | 0.005 | 0.792 | 0.046 | 0.606 | 0.918 | 0.491 | 0.689 | 0.328 | 0.590 |
| Means for interaction effects | ||||||||||
| 0 | − | 244 | 184 a | 1.33 | 2155 ab | 1485 | 1.45 | 5078 | 3014 a | 1.69 |
| 50 g/kg Coarse | − | 272 | 193 a | 1.41 | 2221 ab | 1521 | 1.46 | 5018 | 2986 ab | 1.69 |
| 50 g/kg Fine | − | 276 | 191 a | 1.45 | 2195 ab | 1541 | 1.43 | 5028 | 2832 ab | 1.79 |
| 0 | + | 255 | 188 a | 1.36 | 2180 ab | 1544 | 1.41 | 5070 | 2856 ab | 1.79 |
| 50 g/kg Coarse | + | 284 | 179 b | 1.60 | 2077 b | 1420 | 1.46 | 4783 | 2789 b | 1.72 |
| 50 g/kg Fine | + | 302 | 199 a | 1.52 | 2262 a | 1574 | 1.44 | 5177 | 3012 a | 1.73 |
| Pooled SEM | 6.60 | 4.89 | 0.06 | 40 | 37 | 0.01 | 92 | 88 | 0.05 | |
| p-Value | 0.423 | 0.053 | 0.378 | 0.036 | 0.089 | 0.146 | 0.142 | 0.023 | 0.257 | |
| WB, g/kg | STB | Day 18 | Day 42 | ||||
|---|---|---|---|---|---|---|---|
| Jejunum | Gizzard | Cecum | Jejunum | Gizzard | Cecum | ||
| Means for main effect of wheat bran | |||||||
| 0 | 6.34 | 3.48 | 6.30 | 6.56 | 3.53 | 7.52 | |
| 50 g/kg Coarse | 6.33 | 3.40 | 6.26 | 6.50 | 3.50 | 7.44 | |
| 50 g/kg Fine | 6.41 | 3.26 | 6.29 | 6.53 | 3.46 | 7.47 | |
| Pooled SEM | 0.038 | 0.146 | 0.105 | 0.037 | 0.077 | 0.080 | |
| p-Value | 0.294 | 0.585 | 0.883 | 0.579 | 0.817 | 0.742 | |
| Means for main effect of STB | |||||||
| − | 6.37 | 3.39 | 6.38 | 6.61 | 3.64 | 7.55 | |
| + | 6.35 | 3.37 | 6.18 | 6.45 | 3.35 | 7.40 | |
| Pooled SEM | 0.031 | 0.120 | 0.086 | 0.031 | 0.063 | 0.066 | |
| p-Value | 0.666 | 0.938 | 0.067 | 0.001 | 0.002 | 0.108 | |
| Means for interaction effects | |||||||
| 0 | − | 6.34 | 3.57 | 6.40 | 6.56 a | 3.73 | 7.62 |
| 50 g/kg Coarse | − | 6.33 | 3.41 | 6.35 | 6.62 a | 3.67 | 7.44 |
| 50 g/kg Fine | − | 6.44 | 3.18 | 6.38 | 6.66 a | 3.53 | 7.60 |
| 0 | + | 6.33 | 3.39 | 6.19 | 6.56 ab | 3.33 | 7.43 |
| 50 g/kg Coarse | + | 6.34 | 3.39 | 6.15 | 6.39 c | 3.33 | 7.43 |
| 50 g/kg Fine | + | 6.38 | 3.34 | 6.21 | 6.41 bc | 3.40 | 7.34 |
| Pooled SEM | 0.05 | 0.21 | 0.15 | 0.05 | 0.11 | 0.11 | |
| p-Value | 0.779 | 0.719 | 0.987 | 0.042 | 0.441 | 0.540 | |
| WB, g/kg | STB | Day 18 | Day 42 | ||||
|---|---|---|---|---|---|---|---|
| DMD% | ND% | IDE, MJ/kg | DMD% | ND% | IDE, MJ/kg | ||
| Means for main effect of wheat bran | |||||||
| 0 | 70.5 | 76.2 b | 13.36 b | 73.3 | 80.2 | 12.21 | |
| 50 g/kg Coarse | 70.0 | 77.3 b | 13.59 b | 73.6 | 81.2 | 12.10 | |
| 50 g/kg Fine | 71.7 | 79.2 a | 14.39 a | 74.6 | 82.5 | 12.48 | |
| Pooled SEM | 0.89 | 0.66 | 0.159 | 0.84 | 0.86 | 0.120 | |
| p-Value | 0.441 | 0.010 | < 0.01 | 0.614 | 0.188 | 0.177 | |
| Means for main effect of STB | |||||||
| − | 70.1 | 77.0 | 13.74 | 73.4 | 80.9 | 12.04 | |
| + | 71.4 | 78.1 | 13.82 | 74.2 | 81.7 | 12.47 | |
| Pooled SEM | 0.73 | 0.54 | 0.130 | 0.68 | 0.70 | 0.098 | |
| p-Value | STB | 0.176 | 0.133 | 0.684 | 0.399 | 0.491 | 0.011 |
| Means for interaction effects | |||||||
| 0 | − | 68.7 | 74.4 | 13.09 | 72.5 | 79.6 | 11.96 |
| 50 g/kg Coarse | − | 70.0 | 77.6 | 13.68 | 73.3 | 80.9 | 11.95 |
| 50 g/kg Fine | − | 71.6 | 79.0 | 14.46 | 74.5 | 82.1 | 12.25 |
| 0 | + | 72.4 | 78.0 | 13.64 | 74.1 | 80.7 | 12.43 |
| Coarse | + | 70.0 | 77.0 | 13.50 | 73.9 | 81.5 | 12.28 |
| Fine | + | 71.9 | 79.4 | 14.32 | 74.7 | 82.8 | 12.64 |
| Pooled SEM | 1.26 | 0.93 | 0.225 | 1.19 | 1.21 | 0.169 | |
| p-Value | 0.252 | 0.088 | 0.202 | 0.762 | 0.973 | 0.923 | |
| WB, g/kg | STB | Day 18 | Day 42 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| VH, μm | CD, μm | VW, μm | VH/CD | VH, μm | CD, μm | VW, μm | VH/CD | ||
| Means for main effect of wheat bran | |||||||||
| 0 | 1230 b | 145 | 157 | 8.70 | 1596 | 180 | 140 | 10.95 | |
| 50 g/kg Coarse | 1248 b | 153 | 154 | 8.53 | 1590 | 146 | 138 | 11.09 | |
| 50 g/kg Fine | 1346 a | 147 | 156 | 9.18 | 1629 | 155 | 153 | 10.94 | |
| Pooled SEM | 34.3 | 7.23 | 5.07 | 0.37 | 59.3 | 20.9 | 4.64 | 0.66 | |
| p-Value | 0.051 | 0.546 | 0.912 | 0.457 | 0.881 | 0.499 | 0.076 | 0.984 | |
| Means for main effect of STB | |||||||||
| − | 1235 | 146 | 156 | 8.67 | 1603 | 175 | 145 | 10.69 | |
| + | 1314 | 151 | 155 | 8.93 | 1607 | 146 | 142 | 11.29 | |
| Pooled SEM | 28.0 | 5.91 | 4.14 | 0.31 | 48.5 | 17.1 | 3.79 | 0.54 | |
| p-Value | 0.048 | 0.749 | 0.899 | 0.553 | 0.955 | 0.236 | 0.647 | 0.430 | |
| Means for interaction effects | |||||||||
| 0 | − | 1212 | 141 | 155 | 8.85 | 1557 | 225 | 145 | 9.53 |
| 50 g/kg Coarse | − | 1233 | 154 | 162 | 8.35 | 1563 | 142 | 139 | 11.11 |
| 50 g/kg Fine | − | 1260 | 143 | 150 | 8.82 | 1689 | 156 | 151 | 11.43 |
| 0 | + | 1249 | 149 | 158 | 8.56 | 1634 | 134 | 136 | 12.36 |
| 50 g/kg Coarse | + | 1263 | 152 | 145 | 8.70 | 1617 | 149 | 137 | 11.07 |
| 50 g/kg Fine | + | 1431 | 152 | 162 | 9.53 | 1570 | 154 | 154 | 10.45 |
| Pooled SEM | 55.0 | 11.8 | 8.28 | 0.61 | 96.9 | 34.2 | 7.57 | 1.08 | |
| p-Value | 0.292 | 0.825 | 0.128 | 0.640 | 0.451 | 0.200 | 0.687 | 0.116 | |
| WB, g/kg | STB | b0+AT | GLUT-1 | GLUT-2 | GLUT-5 | rBAT | pepT-1 | SGLT-1 | SGLT-4 | y+ LAT1 | CAT2 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Means for main effect of wheat bran | |||||||||||
| 0 | 1.18 | 1.21 | 1.33 | 2.34 | 0.55 | 1.01 | 1.95 | 2.42 | 1.79 | 1.22 | |
| 50 g/kg Coarse | 0.99 | 0.84 | 0.84 | 0.88 | 0.01 | 0.94 | 0.93 | 0.71 | 0.90 | 1.02 | |
| 50 g/kg Fine | 0.96 | 0.73 | 0.94 | 1.07 | 0.03 | 0.99 | 0.92 | 0.89 | 0.90 | 1.84 | |
| Pooled SEM | 0.133 | 0.209 | 0.194 | 0.678 | 0.244 | 0.104 | 0.489 | 0.879 | 0.483 | 0.579 | |
| p-Value | 0.522 | 0.295 | 0.244 | 0.401 | 0.398 | 0.891 | 0.312 | 0.403 | 0.395 | 0.630 | |
| Means for main effect of STB | |||||||||||
| − | 0.93 | 0.85 | 0.83 | 0.98 | 0.32 | 0.91 | 0.94 | 0.84 | 0.94 | 0.99 | |
| + | 1.15 | 1.02 | 1.25 | 1.80 | 0.01 | 1.05 | 1.61 | 1.81 | 1.44 | 1.73 | |
| Pooled SEM | 0.109 | 0.171 | 0.159 | 0.553 | 0.199 | 0.085 | 0.399 | 0.718 | 0.394 | 0.473 | |
| p-Value | STB | 0.224 | 0.598 | 0.102 | 0.343 | 0.298 | 0.332 | 0.311 | 0.387 | 0.407 | 0.315 |
| Means for interaction effects | |||||||||||
| 0 | − | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| 50 g/kg Coarse | − | 1.00 | 0.88 | 0.71 | 0.81 | 0.01 | 0.75 | 0.84 | 0.47 | 0.82 | 0.82 |
| 50 g/kg Fine | − | 0.80 | 0.69 | 0.79 | 1.14 | 0.06 | 1.00 | 0.98 | 1.11 | 1.00 | 1.13 |
| 0 | + | 1.36 | 1.40 | 1.62 | 3.34 | 0.02 | 1.02 | 2.78 | 3.65 | 2.48 | 1.41 |
| 50 g/kg Coarse | + | 0.97 | 0.79 | 0.96 | 0.96 | 0.01 | 1.12 | 1.02 | 0.99 | 0.99 | 1.21 |
| 50 g/kg Fine | + | 1.10 | 0.78 | 1.11 | 0.99 | 0.01 | 0.99 | 0.85 | 0.69 | 0.79 | 2.55 |
| Pooled SEM | 0.188 | 0.296 | 0.275 | 0.958 | 0.345 | 0.147 | 0.692 | 1.243 | 0.682 | 0.818 | |
| p-Value | 0.627 | 0.739 | 0.795 | 0.414 | 0.415 | 0.428 | 0.373 | 0.479 | 0.455 | 0.801 | |
| WB, g/kg | STB | b0+AT | GLUT-1 | GLUT-2 | GLUT-5 | rBAT | pepT-1 | SGLT-1 | SGLT-4 | y+LAT1 | CAT2 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Means for main effect of wheat bran | |||||||||||
| 0 | 0.99 | 1.04 | 0.98 | 0.86 | 1.02 | 1.02 | 1.05 | 1.04 | 1.09 | 0.92 | |
| 50 g/kg Coarse | 0.89 | 1.00 | 0.86 | 0.83 | 1.09 | 1.42 | 1.12 | 1.06 | 1.12 | 0.82 | |
| 50 g/kg Fine | 0.95 | 0.94 | 0.94 | 0.74 | 0.97 | 1.38 | 1.01 | 1.17 | 1.12 | 0.83 | |
| Pooled SEM | 0.093 | 0.103 | 0.069 | 0.066 | 0.069 | 0.133 | 0.078 | 0.094 | 0.079 | 0.114 | |
| p-Value | 0.779 | 0.798 | 0.496 | 0.571 | 0.592 | 0.125 | 0.742 | 0.649 | 0.990 | 0.755 | |
| Means for main effect of STB | |||||||||||
| − | 0.99 | 0.97 | 0.93 | 0.85 | 1.01 | 1.20 | 0.99 | 1.07 | 1.09 | 0.83 | |
| + | 0.90 | 1.01 | 0.92 | 0.77 | 1.03 | 1.34 | 1.12 | 1.11 | 1.12 | 0.89 | |
| Pooled SEM | 0.076 | 0.084 | 0.056 | 0.054 | 0.057 | 0.108 | 0.063 | 0.076 | 0.065 | 0.093 | |
| p-Value | STB | 0.454 | 0.746 | 0.964 | 0.418 | 0.808 | 0.421 | 0.151 | 0.785 | 0.838 | 0.677 |
| Means for interaction effects | |||||||||||
| 0 | − | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| 50 g/kg Coarse | − | 0.89 | 0.99 | 0.81 | 0.71 | 1.02 | 1.27 | 0.93 | 1.07 | 1.08 | 0.59 |
| 50 g/kg Fine | − | 1.07 | 0.92 | 0.97 | 0.79 | 1.02 | 1.33 | 1.03 | 1.16 | 1.21 | 0.87 |
| 0 | + | 0.98 | 1.08 | 0.96 | 0.69 | 1.04 | 1.04 | 1.11 | 1.09 | 1.20 | 0.84 |
| 50 g/kg Coarse | + | 0.89 | 1.00 | 0.90 | 0.91 | 1.14 | 1.54 | 1.28 | 1.05 | 1.14 | 1.00 |
| 50 g/kg Fine | + | 0.84 | 0.96 | 0.91 | 0.69 | 0.92 | 1.41 | 1.00 | 1.18 | 1.02 | 0.80 |
| Pooled SEM | 0.132 | 0.145 | 0.098 | 0.094 | 0.098 | 0.188 | 0.110 | 0.132 | 0.112 | 0.161 | |
| p-Value | 0.675 | 0.972 | 0.751 | 0.057 | 0.613 | 0.837 | 0.282 | 0.934 | 0.256 | 0.222 | |
| WB, g/kg | STB | Acetate | Propionate | Isobutyrate | Butyrate | Isovalerate | Valerate | Total SCFAs | Total BCFAs |
|---|---|---|---|---|---|---|---|---|---|
| Means for main effect of wheat bran | |||||||||
| 0 | 60.5 | 4.98 | 1.00 a | 11.57 | 0.85 | 1.03 | 80.6 | 1.89 a | |
| 50 g/kg Coarse | 58.1 | 4.71 | 0.79 b | 11.63 | 0.73 | 1.06 | 78.6 | 1.52 b | |
| 50 g/kg Fine | 57.5 | 4.88 | 0.84 b | 12.03 | 0.78 | 0.90 | 76.2 | 1.67 b | |
| Pooled SEM | 3.245 | 0.348 | 0.049 | 0.987 | 0.044 | 0.055 | 4.4 | 0.093 | |
| p-Value | 0.813 | 0.874 | 0.015 | 0.970 | 0.208 | 0.162 | 0.789 | 0.046 | |
| Means for main effect of STB | |||||||||
| − | 58.8 | 5.21 | 0.93 | 10.96 | 0.84 | 1.05 | 79.0 | 1.76 | |
| + | 58.8 | 4.52 | 0.83 | 12.43 | 0.73 | 0.94 | 78.1 | 1.62 | |
| Pooled SEM | 2.650 | 0.284 | 0.040 | 0.806 | 0.036 | 0.045 | 3.572 | 0.076 | |
| p-Value | 0.942 | 0.085 | 0.086 | 0.220 | 0.081 | 0.130 | 0.908 | 0.238 | |
| Means for interaction effects | |||||||||
| 0 | − | 60.4 | 5.49 | 0.98 | 10.70 | 0.82 | 1.10 | 80.6 ab | 1.78 |
| 50 g/kg Coarse | − | 64.2 | 5.41 | 0.89 | 12.59 | 0.83 | 1.19 | 88.1 a | 1.72 |
| 50 g/kg Fine | − | 51.5 | 4.77 | 0.91 | 9.58 | 0.87 | 0.85 | 68.2 b | 1.78 |
| 0 | + | 60.7 | 4.47 | 1.01 | 12.33 | 0.88 | 0.95 | 80.5 ab | 1.97 |
| 50 g/kg Coarse | + | 52.7 | 4.02 | 0.69 | 10.78 | 0.63 | 0.92 | 70.4 ab | 1.32 |
| 50 g/kg Fine | + | 63.6 | 5.00 | 0.78 | 14.17 | 0.71 | 0.96 | 84.2 ab | 1.57 |
| Pooled SEM | 4.590 | 0.491 | 0.069 | 1.396 | 0.062 | 0.078 | 6.187 | 0.132 | |
| p-Value | 0.062 | 0.251 | 0.256 | 0.099 | 0.112 | 0.065 | 0.045 | 0.096 | |
| WB, g/kg | STB | Acetate | Propionate | Isobutyrate | Butyrate | Isovalerate | Valerate | Total SCFAs | Total BCFAs |
|---|---|---|---|---|---|---|---|---|---|
| Means for main effect of wheat bran | |||||||||
| 0 | 89.5 | 4.58 | 0.43 | 21.5 | 0.33 | 1.05 | 114 | 0.76 | |
| 50 g/kg Coarse | 84.1 | 4.15 | 0.42 | 19.7 | 0.33 | 1.04 | 110 | 0.71 | |
| 50 g/kg Fine | 84.5 | 4.08 | 0.38 | 19.5 | 0.32 | 0.86 | 110 | 0.67 | |
| Pooled SEM | 4.2 | 0.383 | 0.058 | 1.371 | 0.047 | 0.075 | 4.939 | 0.107 | |
| p-Value | 0.611 | 0.624 | 0.763 | 0.482 | 0.958 | 0.192 | 0.837 | 0.807 | |
| Means for main effect of STB | |||||||||
| − | 86.14 | 4.52 | 0.48 | 21.24 | 0.36 | 1.05 | 114 | 0.80 | |
| + | 86.05 | 4.02 | 0.35 | 19.21 | 0.29 | 0.91 | 109 | 0.63 | |
| Pooled SEM | 3.463 | 0.313 | 0.047 | 1.120 | 0.038 | 0.061 | 4.033 | 0.087 | |
| p-Value | 0.963 | 0.272 | 0.086 | 0.189 | 0.235 | 0.099 | 0.395 | 0.193 | |
| Means for interaction effects | |||||||||
| 0 | − | 92.82 | 4.77 | 0.53 | 23.38 | 0.37 | 1.17 | 123 | 0.90 |
| 50 g/kg Coarse | − | 79.35 | 4.75 | 0.48 | 19.33 | 0.39 | 1.13 | 105 | 0.77 |
| 50 g/kg Fine | − | 86.26 | 4.04 | 0.42 | 21.02 | 0.33 | 0.88 | 112 | 0.75 |
| 0 | + | 86.19 | 4.38 | 0.36 | 19.68 | 0.29 | 0.91 | 104 | 0.65 |
| 50 g/kg Coarse | + | 88.75 | 3.55 | 0.37 | 20.03 | 0.28 | 0.95 | 114 | 0.65 |
| 50 g/kg Fine | + | 82.80 | 4.13 | 0.33 | 17.50 | 0.31 | 0.84 | 108 | 0.60 |
| Pooled SEM | 5.999 | 0.542 | 0.082 | 1.939 | 0.066 | 0.106 | 6.985 | 0.151 | |
| p-Value | 0.380 | 0.497 | 0.906 | 0.455 | 0.800 | 0.645 | 0.153 | 0.915 | |
| WB, g/kg | STB | (Hex)3 | (Hex)4 | (Hex)5 | (Hex)6 | (Pent)3 | (Pent)4 | (Pent)5 |
|---|---|---|---|---|---|---|---|---|
| Means for main effects of wheat bran | ||||||||
| 0 | 409 | 1233 | 218 | 25 b | 58 | 20 | 28 | |
| 50 g/kg Coarse | 662 | 1303 | 251 | 74 ab | 66 | 34 | 45 | |
| 50 g/kg Fine | 483 | 1240 | 244 | 112 a | 119 | 23 | 30 | |
| Pooled SEM | 106 | 268 | 48.0 | 16.2 | 18.8 | 6.12 | 7.57 | |
| p-Value | 0.254 | 0.969 | 0.874 | 0.007 | 0.109 | 0.317 | 0.272 | |
| Means for main effect of STB | ||||||||
| − | 544 | 1210 | 248 | 70 | 56 | 20 | 40 | |
| + | 493 | 1294 | 228 | 77 | 101 | 30 | 28 | |
| Pooled SEM | 86.2 | 219 | 39.2 | 13.3 | 15.4 | 5.00 | 6.18 | |
| p-Value | 0.715 | 0.832 | 0.713 | 0.978 | 0.097 | 0.241 | 0.209 | |
| Means for interaction effects | ||||||||
| 0 | − | 266 | 1296 | 158 | 28.7 | 26.7 | 15.5 | 32.6 |
| 50 g/kg Coarse | − | 806 | 1364 | 334 | 88.4 | 79.6 | 32.6 | 54.8 |
| 50 g/kg Fine | − | 557 | 981 | 251 | 93.2 | 66.8 | 32.5 | 34.7 |
| 0 | + | 532 | 1169 | 270 | 21.8 | 80.9 | 33.6 | 36.9 |
| 50 g/kg Coarse | + | 539 | 1259 | 167 | 61.2 | 55.5 | 34.5 | 36.3 |
| 50 g/kg Fine | + | 410 | 1433 | 237 | 129 | 163 | 29.7 | 38.2 |
| Pooled SEM | 149 | 379 | 67.9 | 23.0 | 26.6 | 8.65 | 10.7 | |
| p-Value | 0.255 | 0.733 | 0.209 | 0.457 | 0.162 | 0.761 | 0.903 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Veluri, S.; Bedford, M.R.; Gonzalez-Ortiz, G.; Olukosi, O.A. Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers. Animals 2024, 14, 2685. https://doi.org/10.3390/ani14182685
Veluri S, Bedford MR, Gonzalez-Ortiz G, Olukosi OA. Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers. Animals. 2024; 14(18):2685. https://doi.org/10.3390/ani14182685
Chicago/Turabian StyleVeluri, Shravani, Mike R. Bedford, Gemma Gonzalez-Ortiz, and Oluyinka Abiona Olukosi. 2024. "Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers" Animals 14, no. 18: 2685. https://doi.org/10.3390/ani14182685
APA StyleVeluri, S., Bedford, M. R., Gonzalez-Ortiz, G., & Olukosi, O. A. (2024). Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers. Animals, 14(18), 2685. https://doi.org/10.3390/ani14182685

