First Molecular Detection and Genetic Characterization of Tetratrichomonas buttreyi and Pentatrichomonas hominis in Donkeys in Shanxi Province, China
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling Collection
2.2. DNA Extraction and PCR Amplification
2.3. Sequencing and Phylogenetic Analysis
2.4. Statistical Analysis
3. Results
3.1. Prevalence of T. buttreyi and P. hominis in Donkeys
3.2. Sequence Analysis of T. buttreyi and P. hominis
3.3. Phylogenetic Analysis of T. buttreyi and P. hominis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gookin, J.L.; Hanrahan, K.; Levy, M.G. The conundrum of feline trichomonosis. J. Feline Med. Surg. 2017, 19, 261–274. [Google Scholar] [CrossRef] [PubMed]
- Mostegl, M.M.; Richter, B.; Nedorost, N.; Maderner, A.; Dinhopl, N.; Kulda, J.; Liebhart, D.; Hess, M.; Weissenböck, H. Design and validation of an oligonucleotide probe for the detection of protozoa from the order trichomonadida using chromogenic in situ hybridization. Vet. Parasitol. 2010, 171, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Bastos, B.F.; Brener, B.; de Figueiredo, M.A.; Leles, D.; Mendes-de-Almeida, F. Pentatrichomonas hominis infection in two domestic cats with chronic diarrhea. JFMS Open. Rep. 2018, 4, 2055116918774959. [Google Scholar] [PubMed]
- Castella, J.; Muńoz, E.; Ferrer, D.; Gutiérrez, J.F. Isolation of the trichomonad Tetratrichomonas buttreyi (Hibler et al., 1960) Honigberg, 1963 in bovine diarrhoeic faeces. Vet. Parasitol. 1997, 70, 41–45. [Google Scholar] [CrossRef] [PubMed]
- Rivera, W.L.; Lupisan, A.J.; Baking, J.M. Ultrastructural study of a tetratrichomonad isolated from pig fecal samples. Parasitol. Res. 2008, 103, 1311–1316. [Google Scholar] [CrossRef]
- Li, W.C.; Wang, K.; Li, Y.; Zhao, L.P.; Xiao, Y.; Gu, Y.F. Survey and molecular characterization of trichomonads in pigs in Anhui Province, East China, 2014. Iran. J. Parasitol. 2018, 13, 602–610. [Google Scholar]
- Mostegl, M.M.; Richter, B.; Nedorost, N.; Maderner, A.; Dinhopl, N.; Weissenböck, H. Investigations on the prevalence and potential pathogenicity of intestinal trichomonads in pigs using in situ hybridization. Vet. Parasitol. 2011, 178, 58–63. [Google Scholar] [CrossRef]
- Li, W.; Li, W.; Gong, P.; Zhang, C.; Yang, J.; Zhang, X.; Li, J. The prevalence of intestinal trichomonads in Chinese pigs. Vet. Parasitol. 2015, 211, 12–15. [Google Scholar] [CrossRef]
- Cobo, E.R.; Corbeil, L.B.; Agnew, D.W.; VanHoosear, K.; Friend, A.; Olesen, D.R.; BonDurant, R.H. Tetratrichomonas spp. and Pentatrichomonas hominis are not persistently detectable after intravaginal inoculation of estrous heifers. Vet. Parasitol. 2007, 150, 18–26. [Google Scholar] [CrossRef]
- Meloni, D.; Mantini, C.; Goustille, J.; Desoubeaux, G.; Maakaroun-Vermesse, Z.; Chandenier, J.; Gantois, N.; Duboucher, C.; Fiori, P.L.; Dei-Cas, E.; et al. Molecular identification of Pentatrichomonas hominis in two patients with gastrointestinal symptoms. J. Clin. Pathol. 2011, 64, 933–935. [Google Scholar] [CrossRef]
- Fukushima, T.; Mochizuki, K.; Yamazaki, H.; Watanabe, Y.; Yamada, S.; Aoyama, T.; Sakurai, Y.; Mori, H.; Nakazawa, M. Pentatrichomonas hominis from beagle dogs—Detection method, characteristics and route of infection. Exp. Anim. 1990, 39, 187–192. [Google Scholar] [CrossRef]
- Gookin, J.L.; Stauffer, S.H.; Levy, M.G. Identification of Pentatrichomonas hominis in feline fecal samples by polymerase chain reaction assay. Vet. Parasitol. 2007, 145, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Abdo, S.M.; Ghallab, M.M.I.; Elhawary, N.M.; Elhadad, H. Pentatrichomonas hominis and other intestinal parasites in school-aged children: Coproscopic survey. J. Parasit. Dis. 2022, 46, 896–900. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Yu, Y.; Li, J.; Gong, P.; Wang, X.; Li, X.; Cheng, Y.; Yu, X.; Zhang, N.; Zhang, X. Changes of gut microbiota in colorectal cancer patients with Pentatrichomonas hominis infection. Front. Cell. Infect. Microbiol. 2022, 12, 961974. [Google Scholar] [CrossRef] [PubMed]
- Song, P.; Guo, Y.; Zuo, S.; Li, L.; Liu, F.; Zhang, T.; Dai, H.; Dong, H. Prevalence of Pentatrichomonas hominis in foxes and raccoon dogs and changes in the gut microbiota of infected female foxes in the Hebei and Henan Provinces in China. Parasitol. Res. 2023, 123, 74. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Zhang, H.; Yu, Y.; Gong, P.; Li, J.; Li, Z.; Li, T.; Cong, Z.; Tian, C.; Liu, X.; et al. High prevalence of Pentatrichomonas hominis infection in gastrointestinal cancer patients. Parasit. Vectors 2019, 12, 423. [Google Scholar] [CrossRef]
- Phuanukoonnon, S.; Michael, A.; Kirarock, W.S.; Pomat, W.S.; van den Biggelaar, A.H. Intestinal parasitic infections and anaemia among pregnant women in the highlands of Papua New Guinea. Papua New Guin. Med. J. 2013, 56, 119–125. [Google Scholar]
- Maritz, J.M.; Land, K.M.; Carlton, J.M.; Hirt, R.P. What is the importance of zoonotic trichomonads for human health? Trends Parasitol. 2014, 30, 333–341. [Google Scholar] [CrossRef]
- Dong, N.; Jin, X.; Huang, J.; Chen, K.; Li, Y.; Chen, C.; Hu, D.; Xie, Y. Tetratrichomonas in pyopneumothorax. Am. J. Emerg. Med. 2019, 37, 1215.e1–1215.e4. [Google Scholar] [CrossRef]
- Cobo, E.R.; Campero, C.M.; Mariante, R.M.; Benchimol, M. Ultrastructural study of a tetratrichomonad species isolated from prepucial smegma of virgin bulls. Vet. Parasitol. 2003, 117, 195–211. [Google Scholar] [CrossRef]
- Baltrušis, P.; Höglund, J. Digital PCR: Modern solution to parasite diagnostics and population trait genetics. Parasit. Vectors 2023, 16, 143. [Google Scholar] [CrossRef]
- Maurer, J.J. Rapid detection and limitations of molecular techniques. Annu. Rev. Food. Sci. Technol. 2011, 2, 259–279. [Google Scholar] [CrossRef]
- Gookin, J.L.; Copple, C.N.; Papich, M.G.; Poore, M.F.; Stauffer, S.H.; Birkenheuer, A.J.; Twedt, D.C.; Levy, M.G. Efficacy of ronidazole for treatment of feline Tritrichomonas foetus infection. J. Vet. Intern. Med. 2006, 20, 536–543. [Google Scholar] [CrossRef]
- Davis, E. Donkey and mule welfare. Vet. Clin. N. Am. Equine. Pract. 2019, 35, 481–491. [Google Scholar] [CrossRef] [PubMed]
- Seyiti, S.; Kelimu, A. Donkey industry in China: Current aspects, suggestions and future challenges. J. Equine Vet. Sci. 2021, 102, 103642. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, T.; Liang, H.; Wang, L.; Akhtar, F.; Shi, X.; Ren, W.; Huang, B.; Kou, X.; Chen, Y.; et al. A novel SNP in NKX1-2 gene is associated with carcass traits in Dezhou donkey. BMC Genom. Data 2023, 24, 41. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.; Zhang, X.; Yan, J.; Guo, J.; Zhang, F.; Zhu, K.; Liu, S.; Sun, Y.; Shen, W.; Wang, J. Transcriptional specificity analysis of testis and epididymis tissues in Donkey. Genes 2022, 13, 2339. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhang, N.; Gong, P.; Cheng, S.; Wang, X.; Li, X.; Hou, Z.; Liu, C.; Bi, T.; Wang, B.; et al. Prevalence and molecular characterization of Pentatrichomonas hominis in Siberian tigers (Panthera tigris altaica) in northeast China. Integr. Zool. 2022, 17, 543–549. [Google Scholar] [CrossRef]
- Bailey, N.P.; Velo-Rego, E.; Hirt, R.P. Sporadic isolation of tetratrichomonas species from the cattle urogenital tract. Parasitology 2021, 148, 1339–1344. [Google Scholar] [CrossRef]
- Mahittikorn, A.; Udonsom, R.; Koompapong, K.; Chiabchalard, R.; Sutthikornchai, C.; Sreepian, P.M.; Mori, H.; Popruk, S. Molecular identification of Pentatrichomonas hominis in animals in central and western Thailand. BMC Vet. Res. 2021, 17, 203. [Google Scholar] [CrossRef]
- Li, W.C.; Huang, J.M.; Fang, Z.; Ren, Q.; Tang, L.; Kan, Z.Z.; Liu, X.C.; Gu, Y.F. Prevalence of Tetratrichomonas buttreyi and Pentatrichomonas hominis in yellow cattle, dairy cattle, and water buffalo in China. Parasitol. Res. 2020, 119, 637–647. [Google Scholar] [CrossRef] [PubMed]
- Dimasuay, K.G.; Rivera, W.L. Molecular characterization of trichomonads isolated from animal hosts in the Philippines. Vet. Parasitol. 2013, 196, 289–295. [Google Scholar] [CrossRef]
- Wang, Z.R.; Fan, Q.X.; Wang, J.L.; Zhang, S.; Wang, Y.X.; Zhang, Z.D.; Gao, W.W.; Zhu, X.Q.; Liu, Q. Molecular identi-fication and survey of Trichomonad species in pigs in Shanxi Province, North China. Vet. Sci. 2024, 11, 203. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.W.; Zhang, S.; Zhang, T.H.; Xiao, H.D.; Su, N.; Tao, M.F.; Wu, Z.X.; Zhang, Z.D.; Zhu, X.Q.; Xie, S.C. Prevalence and multilocus genotyping of Giardia duodenalis in donkeys in Shanxi Province, North China. Animals 2023, 13, 3771. [Google Scholar] [CrossRef] [PubMed]
- Ma, P.P.; Zou, Y.; Mu, W.J.; Zhang, Y.Y.; Li, Y.Q.; Liu, Z.L.; Zhang, L.; Chen, L.X.; Liu, G.H.; Wang, S. Prevalence of in-testinal trichomonads in captive non-human primates in China. Parasite 2024, 31, 19. [Google Scholar] [CrossRef] [PubMed]
- Li, W.C.; Ying, M.; Gong, P.T.; Li, J.H.; Yang, J.; Li, H.; Zhang, X.C. Pentatrichomonas hominis: Prevalence and molecular characterization in humans, dogs, and monkeys in Northern China. Parasitol. Res. 2016, 115, 569–574. [Google Scholar] [CrossRef] [PubMed]
- Peachey, L.E.; Castro, C.; Molena, R.A.; Jenkins, T.P.; Griffin, J.L.; Cantacessi, C. Dysbiosis associated with acute helminth infections in herbivorous youngstock - observations and implications. Sci. Rep. 2019, 9, 11121. [Google Scholar] [CrossRef]
- Thursby, E.; Juge, N. Introduction to the human gut microbiota. Biochem. J. 2017, 474, 1823–1836. [Google Scholar] [CrossRef]
- Dheilly, N.M.; Ewald, P.W.; Brindley, P.J.; Fichorova, R.N.; Thomas, F. Parasite-microbe-host interactions and cancer risk. PLoS Pathog. 2019, 15, e1007912. [Google Scholar] [CrossRef]
- Li, W.C.; Wang, K.; Gu, Y. Occurrence of Blastocystis sp. and Pentatrichomonas hominis in sheep and goats in China. Parasit. Vectors 2018, 11, 93. [Google Scholar] [CrossRef]
- Li, W.C.; Gong, P.T.; Ying, M.; Li, J.H.; Yang, J.; Li, H.; Yang, Z.T.; Zhang, G.C.; Zhang, X.C. Pentatrichomonas hominis: First isolation from the feces of a dog with diarrhea in China. Parasitol. Res. 2014, 113, 1795–1801. [Google Scholar] [CrossRef] [PubMed]
- Ghafar, A.; Abbas, G.; Beasley, A.; Bauquier, J.; Wilkes, E.J.A.; Jacobson, C.; McConnell, E.; El-Hage, C.; Carrigan, P.; Cudmore, L.; et al. Molecular diagnostics for gastrointestinal helminths in equids: Past, present and future. Vet. Parasitol. 2023, 313, 109851. [Google Scholar] [CrossRef] [PubMed]
- Akhoundi, M.; Downing, T.; Votýpka, J.; Kuhls, K.; Lukeš, J.; Cannet, A.; Ravel, C.; Marty, P.; Delaunay, P.; Kasbari, M.; et al. Leishmania infections: Molecular targets and diagnosis. Mol. Aspects Med. 2017, 57, 1–29. [Google Scholar] [CrossRef] [PubMed]
Species | Gene | Primer ID | Primer Sequences (5′-3′) | Annealing Temperatures (°C) | Fragment Length (bp) |
---|---|---|---|---|---|
T. buttreyi | SSU rRNA | FF | GCGCCTGAGAGATAGCGACTA | 59 | |
RR | GGACCTGTTATTGCTACCCTCTTC | ||||
bF | GTTTTTTCTCAGGCAGCAATG | 61 | 623 | ||
bR | GCAACCTAGAAACCTAGGCG | ||||
P. hominis | SSU rRNA | F1 | ATGGCGAGTGGTGGAATA | 60 | |
R1 | CCCAACTACGCTAAGGATT | ||||
F2 | TGTAAACGATGCCGACAGAG | 60 | 339 | ||
R2 | CAACACTGAAGCCAATGCGAGC |
Species | Factor | Category | No. Positive/No. Tested | Prevalence % (95% CI) | OR (95% CI) | p-Value |
---|---|---|---|---|---|---|
T. buttreyi | Region | Jinzhong | 16/81 | 19.8 (11.1–28.4) | Ref. | <0.001 |
Linfen | 115/363 | 31.7 (26.9–36.5) | 1.9 (1.0–3.4) | |||
Datong | 76/371 | 20.5 (16.4–24.6) | 1.1 (0.6–1.9) | |||
Age | ≥3 years | 160/601 | 26.6 (23.1–30.2) | 1.3 (0.9–1.9) | 0.179 | |
<3 years | 47/214 | 22.0 (16.4–27.5) | Ref. | |||
Sex | Male | 15/120 | 12.5 (6.6–18.4) | Ref. | <0.001 | |
Female | 192/695 | 27.6 (24.3–31.0) | 2.7 (1.5–4.7) | |||
Sub-total | 207/815 | 25.4 (22.4–28.4) | ||||
P. hominis | Region | Jinzhong | 0/81 | 0 | 0.428 | |
Linfen | 2/363 | 0.6 (0.0–1.3) | Ref. | |||
Datong | 4/371 | 1.1 (0.0–2.1) | 2.0 (0.4–10.8) | |||
Age | ≥3 years | 2/601 | 0.3 (0.0–0.8) | Ref. | 0.024 | |
<3 years | 4/214 | 1.9 (0.1–3.7) | 5.7 (1.0–31.4) | |||
Sex | Male | 2/120 | 1.7 (0.0–4.0) | 2.9 (0.5–16.2) | 0.197 | |
Female | 4/695 | 0.6 (0.0–1.1) | Ref. | |||
Sub-total | 6/815 | 0.7 (0.2–1.3) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, H.-D.; Zhang, S.; Lv, Y.-H.; Zhang, Z.-D.; Su, N.; Li, L.-L.; Zhu, X.-Q.; Xie, S.-C.; Gao, W.-W. First Molecular Detection and Genetic Characterization of Tetratrichomonas buttreyi and Pentatrichomonas hominis in Donkeys in Shanxi Province, China. Animals 2024, 14, 2651. https://doi.org/10.3390/ani14182651
Xiao H-D, Zhang S, Lv Y-H, Zhang Z-D, Su N, Li L-L, Zhu X-Q, Xie S-C, Gao W-W. First Molecular Detection and Genetic Characterization of Tetratrichomonas buttreyi and Pentatrichomonas hominis in Donkeys in Shanxi Province, China. Animals. 2024; 14(18):2651. https://doi.org/10.3390/ani14182651
Chicago/Turabian StyleXiao, Han-Dan, Shuo Zhang, Yi-Han Lv, Ze-Dong Zhang, Nan Su, Liang-Liang Li, Xing-Quan Zhu, Shi-Chen Xie, and Wen-Wei Gao. 2024. "First Molecular Detection and Genetic Characterization of Tetratrichomonas buttreyi and Pentatrichomonas hominis in Donkeys in Shanxi Province, China" Animals 14, no. 18: 2651. https://doi.org/10.3390/ani14182651
APA StyleXiao, H.-D., Zhang, S., Lv, Y.-H., Zhang, Z.-D., Su, N., Li, L.-L., Zhu, X.-Q., Xie, S.-C., & Gao, W.-W. (2024). First Molecular Detection and Genetic Characterization of Tetratrichomonas buttreyi and Pentatrichomonas hominis in Donkeys in Shanxi Province, China. Animals, 14(18), 2651. https://doi.org/10.3390/ani14182651