Diagnostic Value of Conventional Polymerase Chain Reaction for Detecting BRAF V595E Mutation in Liquid and Tissue Specimens of Canine Urothelial and Prostate Carcinomas
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Tumor Tissues
2.3. Conventional PCR
2.4. Liquid Specimens from Dogs with Lower Urinary Tract or Prostate Masses
2.5. Patients to Be Followed Up Regarding the Clinical Outcome
3. Results
3.1. Detection of the BRAF V595E Mutation in the Tissues of Urothelial Carcinoma and Prostate Carcinoma
3.2. Using Conventional PCR to Detect the BRAF V595E Mutation in the Urine and Prostatic Wash of Dogs with Lower Urinary Tract or Prostate Masses
3.3. Long-Term Follow-Up of Patients with or without the BRAF V595E Mutation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fulkerson, C.M.; Knapp, D.W. Management of transitional cell carcinoma of the urinary bladder in dogs: A review. Vet. J. 2015, 205, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Knapp, D.W.; Ramos-Vara, J.A.; Moore, G.E.; Dhawan, D.; Bonney, P.L.; Young, K.E. Urinary Bladder Cancer in Dogs, a Naturally Occurring Model for Cancer Biology and Drug Development. ILAR J. 2014, 55, 100–118. [Google Scholar] [CrossRef] [PubMed]
- Knapp, D.W.; Glickman, N.W.; Denicola, D.B.; Bonney, P.L.; Lin, T.L.; Glickman, L.T. Naturally-occurring canine transitional cell carcinoma of the urinary bladder A relevant model of human invasive bladder cancer. Urol. Oncol. Semin. Orig. Investig. 2000, 5, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Norris, A.M.; Laing, E.J.; Valli, V.E.; Withrow, S.J.; Macy, D.W.; Ogilvie, G.K.; Tomlinson, J.; McCaw, D.; Pidgeon, G.; Jacobs, R.M. Canine bladder and urethral tumors: A retrospective study of 115 cases (1980–1985). J. Vet. Intern. Med. 1992, 6, 145–153. [Google Scholar] [CrossRef]
- Valli, V.E.; Norris, A.; Jacobs, R.M.; Laing, E.; Withrow, S.; Macy, D.; Tomlinson, J.; McCaw, D.; Ogilvie, G.K.; Pidgeon, G.; et al. Pathology of canine bladder and urethral cancer and correlation with tumour progression and survival. J. Comp. Pathol. 1995, 113, 113–130. [Google Scholar] [CrossRef]
- Mutsaers, A.J.; Widmer, W.R.; Knapp, D.W. Canine transitional cell carcinoma. J. Vet. Intern. Med. 2003, 17, 136–144. [Google Scholar] [CrossRef]
- Budreckis, D.M.; Byrne, B.A.; Pollard, R.E.; Rebhun, R.B.; Rodriguez, C.O.; Skorupski, K.A. Bacterial Urinary Tract Infections Associated with Transitional Cell Carcinoma in Dogs. J. Vet. Intern. Med. 2015, 29, 828–833. [Google Scholar] [CrossRef]
- Childress, M.O.; Adams, L.G.; Ramos-Vara, J.A.; Freeman, L.J.; He, S.; Constable, P.D.; Knapp, D.W. Results of biopsy via transurethral cystoscopy and cystotomy for diagnosis of transitional cell carcinoma of the urinary bladder and urethra in dogs: 92 cases (2003–2008). J. Am. Vet. Méd. Assoc. 2011, 239, 350–356. [Google Scholar] [CrossRef]
- Bryan, J.N.; Keeler, M.R.; Henry, C.J.; Bryan, M.E.; Hahn, A.W.; Caldwell, C.W. A population study of neutering status as a risk factor for canine prostate cancer. Prostate 2007, 67, 1174–1181. [Google Scholar] [CrossRef]
- Palmieri, C.; Lean, F.Z.; Akter, S.H.; Romussi, S.; Grieco, V. A retrospective analysis of 111 canine prostatic samples: Histopathological findings and classification. Res. Vet. Sci. 2014, 97, 568–573. [Google Scholar] [CrossRef]
- Powe, J.R.; Canfield, P.J.; Martin, P.A. Evaluation of the cytologic diagnosis of canine prostatic disorders. Vet. Clin. Pathol. 2004, 33, 150–154. [Google Scholar] [CrossRef] [PubMed]
- Fulkerson, C.M.; Knapp, D.W. Tumors of the Urinary System. In Withrow and MacEwen’s Small Animal Clinical Oncology, 6th ed.; Vail, D.M., Thamm, D.H., Liptak, J.M., Eds.; W.B. Saunders: St. Louis, MO, USA, 2019; pp. 645–656. [Google Scholar]
- Decker, B.; Parker, H.G.; Dhawan, D.; Kwon, E.M.; Karlins, E.; Davis, B.W.; Ramos-Vara, J.A.; Bonney, P.L.; McNiel, E.A.; Knapp, D.W.; et al. Homologous Mutation to Human BRAF V600E Is Common in Naturally Occurring Canine Bladder Cancer—Evidence for a Relevant Model System and Urine-Based Diagnostic Test. Mol. Cancer Res. 2015, 13, 993–1002. [Google Scholar] [CrossRef]
- Mochizuki, H.; Kennedy, K.; Shapiro, S.G.; Breen, M. BRAF Mutations in Canine Cancers. PLoS ONE 2015, 10, e0129534. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, H.; Shapiro, S.G.; Breen, M. Detection of BRAF Mutation in Urine DNA as a Molecular Diagnostic for Canine Urothelial and Prostatic Carcinoma. PLoS ONE 2015, 10, e0144170. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, H.; Breen, M. Sequence analysis of RAS and RAF mutation hot spots in canine carcinoma. Vet. Comp. Oncol. 2017, 15, 1598–1605. [Google Scholar] [CrossRef] [PubMed]
- Davies, H.; Bignell, G.R.; Cox, C.; Stephens, P.; Edkins, S.; Clegg, S.; Teague, J.; Woffendin, H.; Garnett, M.J.; Bottomley, W.; et al. Mutations of the BRAF gene in human cancer. Nature 2002, 417, 949–954. [Google Scholar] [CrossRef]
- Dhillon, A.S.; Hagan, S.; Rath, O.; Kolch, W. MAP kinase signalling pathways in cancer. Oncogene 2007, 26, 3279–3290. [Google Scholar] [CrossRef]
- Roskoski, R., Jr. RAF protein-serine/threonine kinases: Structure and regulation. Biochem. Biophys. Res. Commun. 2010, 399, 313–317. [Google Scholar] [CrossRef]
- Tagawa, M.; Tambo, N.; Maezawa, M.; Tomihari, M.; Watanabe, K.I.; Inokuma, H.; Miyahara, K. Quantitative analysis of the BRAF V595E mutation in plasma cell-free DNA from dogs with urothelial carcinoma. PLoS ONE 2020, 15, e0232365. [Google Scholar] [CrossRef]
- Dhawan, D.; Ramos-Vara, J.A.; Utturkar, S.M.; Ruple, A.; Tersey, S.A.; Nelson, J.B.; Cooper, B.R.; Heng, H.G.; Ostrander, E.A.; Parker, H.G.; et al. Identification of a naturally-occurring canine model for early detection and intervention research in high grade urothelial carcinoma. Front. Oncol. 2022, 12, 1011969. [Google Scholar] [CrossRef]
- Gentilini, F.; Palgrave, C.J.; Neta, M.; Tornago, R.; Furlanello, T.; McKay, J.S.; Sacchini, F.; Turba, M.E. Validation of a Liquid Biopsy Protocol for Canine BRAFV595E Variant Detection in Dog Urine and Its Evaluation as a Diagnostic Test Complementary to Cytology. Front. Vet. Sci. 2022, 9, 909934. [Google Scholar] [CrossRef] [PubMed]
- Tsiatis, A.C.; Norris-Kirby, A.; Rich, R.G.; Hafez, M.J.; Gocke, C.D.; Eshleman, J.R.; Murphy, K.M. Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: Diagnostic and clinical implications. J. Mol. Diagn. 2010, 12, 425–432. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, H.; Shapiro, S.G.; Breen, M. Detection of Copy Number Imbalance in Canine Urothelial Carcinoma with Droplet Digital Polymerase Chain Reaction. Vet. Pathol. 2016, 53, 764–772. [Google Scholar] [CrossRef]
- Vinall, R.L.; Kent, M.S.; White, R.W.d. Expression of microRNAs in urinary bladder samples obtained from dogs with grossly normal bladders, inflammatory bladder disease, or transitional cell carcinoma. Am. J. Vet. Res. 2012, 73, 1626–1633. [Google Scholar] [CrossRef] [PubMed]
- Kent, M.S.; Zwingenberger, A.; Westropp, J.L.; Barrett, L.E.; Durbin-Johnson, B.P.; Ghosh, P.; Vinall, R.L. MicroRNA profiling of dogs with transitional cell carcinoma of the bladder using blood and urine samples. BMC Vet. Res. 2017, 13, 339. [Google Scholar] [CrossRef] [PubMed]
- Varvil, M.S.; Clark, S.L.; Bailey, T.W.; Ramos-Vara, J.A.; dos Santos, A.P. Canine urothelial carcinoma: A pilot study of microRNA detection in formalin-fixed, paraffin-embedded tissue samples and in normal urine. J. Vet. Diagn. Investig. 2024, 36, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Bracha, S.; McNamara, M.; Hilgart, I.; Milovancev, M.; Medlock, J.; Goodall, C.; Wickramasekara, S.; Maier, C.S. A multiplex biomarker approach for the diagnosis of transitional cell carcinoma from canine urine. Anal. Biochem. 2014, 455, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Chambers, J.K.; Takahashi, N.; Kato, S.; Hashimoto, Y.; Goto-Koshino, Y.; Uchida, K. Diagnostic challenge in veterinary pathology: Detection of BRAF(V595E) mutation in a dog with follicular cystitis and flat urothelial lesion with atypia. Vet. Pathol. 2023, 61, 335–338. [Google Scholar] [CrossRef]
- Aeschlimann, L.; Kehl, A.; Guscetti, F.; Posthaus, C.; Aupperle-Lellbach, H.; Rottenberg, S.; de Brot, S. Effective detection of BRAFV595E mutation in canine urothelial and prostate carcinomas using immunohistochemistry. Vet. Comp. Oncol. 2024, 22, 295–302. [Google Scholar] [CrossRef]
- Grassinger, J.M.; Merz, S.; Aupperle-Lellbach, H.; Erhard, H.; Klopfleisch, R. Correlation of BRAF Variant V595E, Breed, Histological Grade and Cyclooxygenase-2 Expression in Canine Transitional Cell Carcinomas. Vet. Sci. 2019, 6, 31. [Google Scholar] [CrossRef]
- Gedon, J.; Kehl, A.; Aupperle-Lellbach, H.; von Bomhard, W.; Schmidt, J.M. BRAF mutation status and its prognostic significance in 79 canine urothelial carcinomas: A retrospective study (2006–2019). Vet. Comp. Oncol. 2022, 20, 449–457. [Google Scholar] [CrossRef] [PubMed]
PCR | Primer Pair | Sequences (5′–3′) | Size |
---|---|---|---|
Wild type (Wt) | cBRAF-F | GTAATGCTTGCTTTGCTAGGAA | 138 bp |
cBRAF-Rw | CCCACTCCATCGAGATTTCA | ||
Mutant (Mu) | cBRAF-F | GTAATGCTTGCTTTGCTAGGAA | 138 bp |
cBRAF-Rm | CCCACTCCATCGAGATTTCT | ||
GAPDH | GAPDH-F | ACCACAGTCCATGCCATCA | 452 bp |
GAPDH-R | TCCACCACCCTGTTGCTGT |
Specimens | Category | Number of Cases | Cases Passing the Internal Control | Cases with the BRAF Mutation | Mutation Rate |
---|---|---|---|---|---|
FFPE tissues | 34 | 31 | 16 | 51.6% (16/31) | |
UC | 32 | 29 | 15 | 51.7% (15/29) | |
PC | 2 | 2 | 1 | 50% (1/2) | |
Liquid specimens of dogs with urinary tract or prostate masses | 125 | 117 | 63 | 53.2% (63/117) | |
Urine | 116 | 109 | 59 | 54.1% (59/109) | |
Prostatic wash | 9 | 8 | 4 | 50% (4/8) |
Follow-Up of 41 Dogs | One Year Follow-Up of the Mass or Lesion | n | BRAF V595E Mutation (n = 24) | No BRAF V595E Mutation (n = 17) |
---|---|---|---|---|
With pathological diagnosis | 16 | |||
UC or PC; progression within 1 year | 16 | 12 | 4 | |
Without pathological diagnosis | 25 | |||
Progression within 1 year | 14 | 12 | 2 | |
Complete remission or stable within 1 year, without antineoplastic treatment | 11 | 0 | 11 |
Diagnostic Method | Diagnosis | n | BRAF V595E Mutation (n = 12) | No BRAF V595E Mutation (n = 4) |
---|---|---|---|---|
Cytology | 16 | |||
Carcinoma in the urinary bladder | 6 | 6 | 0 | |
Carcinoma in the prostatic gland | 5 | 4 | 1 | |
Carcinoma in the urinary bladder and prostate | 3 | 2 | 1 | |
No atypical epithelial cells * | 2 | 0 | 2 | |
Histopathology | 4 | |||
Urothelial carcinoma | 4 | 2 | 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuo, C.-C.; Yang, S.-Y.; Liu, R.-M.; Lin, Y.-H.; Liu, C.-C.; Huang, W.-H.; Lee, J.-J.; Liao, A.T. Diagnostic Value of Conventional Polymerase Chain Reaction for Detecting BRAF V595E Mutation in Liquid and Tissue Specimens of Canine Urothelial and Prostate Carcinomas. Animals 2024, 14, 2535. https://doi.org/10.3390/ani14172535
Kuo C-C, Yang S-Y, Liu R-M, Lin Y-H, Liu C-C, Huang W-H, Lee J-J, Liao AT. Diagnostic Value of Conventional Polymerase Chain Reaction for Detecting BRAF V595E Mutation in Liquid and Tissue Specimens of Canine Urothelial and Prostate Carcinomas. Animals. 2024; 14(17):2535. https://doi.org/10.3390/ani14172535
Chicago/Turabian StyleKuo, Chien-Chun, Su-Ya Yang, Ru-Min Liu, Yung-Hsuan Lin, Chih-Chun Liu, Wei-Hsiang Huang, Jih-Jong Lee, and Albert Taiching Liao. 2024. "Diagnostic Value of Conventional Polymerase Chain Reaction for Detecting BRAF V595E Mutation in Liquid and Tissue Specimens of Canine Urothelial and Prostate Carcinomas" Animals 14, no. 17: 2535. https://doi.org/10.3390/ani14172535
APA StyleKuo, C.-C., Yang, S.-Y., Liu, R.-M., Lin, Y.-H., Liu, C.-C., Huang, W.-H., Lee, J.-J., & Liao, A. T. (2024). Diagnostic Value of Conventional Polymerase Chain Reaction for Detecting BRAF V595E Mutation in Liquid and Tissue Specimens of Canine Urothelial and Prostate Carcinomas. Animals, 14(17), 2535. https://doi.org/10.3390/ani14172535