Inhibition of Prolactin Affects Epididymal Morphology by Decreasing the Secretion of Estradiol in Cashmere Bucks
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals and Management
2.3. Experimental Design and Sample Collection
2.4. Hormone Analyses
2.5. Hematoxylin–Eosin Staining and Immunohistochemistry of Epididymal Tissue
2.6. Library Preparation, RNA Sequencing, and Bioinformatics Analyses
2.7. Quantitative Real-Time PCR
2.8. Statistical Analyses
3. Results
3.1. Effects of BCR Treatment on Serum Hormone Levels in Cashmere Bucks
3.2. Effects of BCR Treatment on Protein Expression of PRLR in Epididymal Tissue of Cashmere Bucks
3.3. Effects of BCR Treatment on the Histomorphology of the Epididymis in Cashmere Bucks
3.4. RNA Sequencing Data Statistics and Differentially Expressed Gene Analyses
3.5. Enrichment and Functional Annotation Analyses of DEGs
3.6. Validation of Differentially Expressed mRNAs by qPCR
4. Discussion
4.1. Effects of BCR Treatment on Serum Hormone Concentrations
4.2. Effects of BCR Treatment on the PRLR Protein Expression and Histomorphology in the Epididymis
4.3. Effects of BCR Treatment on Epididymal Reproductive Function-Related Genes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dacheux, J.L.; Dacheux, F. New insights into epididymal function in relation to sperm maturation. Reproduction 2014, 147, R27–R42. [Google Scholar] [CrossRef]
- Zhou, W.; De Iuliis, G.N.; Dun, M.D.; Nixon, B. Characteristics of the Epididymal Luminal Environment Responsible for Sperm Maturation and Storage. Front. Endocrinol. 2018, 9, 59. [Google Scholar] [CrossRef] [PubMed]
- Dube, E.; Cyr, D.G. The blood-epididymis barrier and human male fertility. Adv. Exp. Med. Biol. 2012, 763, 218–236. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.C.; Morgan, C.P.; Adrian, L.N.; Shetty, A.; Cisse, Y.M.; Nugent, B.M.; Morrison, K.E.; Jašarević, E.; Huang, W.; Kanyuch, N.; et al. Reproductive tract extracellular vesicles are sufficient to transmit intergenerational stress and program neurodevelopment. Nat. Commun. 2020, 11, 1499. [Google Scholar] [CrossRef] [PubMed]
- Sharma, U.; Conine, C.C.; Shea, J.M.; Boskovic, A.; Derr, A.G.; Bing, X.Y.; Belleannee, C.; Kucukural, A.; Serra, R.W.; Sun, F.; et al. Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals. Science 2016, 351, 391–396. [Google Scholar] [CrossRef] [PubMed]
- Eisenberg, M.L.; Esteves, S.C.; Lamb, D.J.; Hotaling, J.M.; Giwercman, A.; Hwang, K.; Cheng, Y.-S. Male infertility. Nat. Rev. Dis. Primers 2023, 9, 49. [Google Scholar] [CrossRef]
- Joffe, M. What has happened to human fertility? Hum. Reprod. 2010, 25, 295–307. [Google Scholar] [CrossRef] [PubMed]
- Winters, B.R.; Walsh, T.J. The epidemiology of male infertility. Urol. Clin. N. Am. 2014, 41, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Bole-Feysot, C.; Goffin, V.; Edery, M.; Binart, N.; Kelly, P.A. Prolactin (PRL) and its receptor: Actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr. Rev. 1998, 19, 225–268. [Google Scholar] [CrossRef]
- Liu, Z.; Ma, A.; Zhang, J.; Yang, S.; Cui, W.; Xia, D.; Qu, J. Cloning and molecular characterization of PRL and PRLR from turbot (Scophthalmus maximus) and their expressions in response to short-term and long-term low salt stress. Fish Physiol. Biochem. 2020, 46, 501–517. [Google Scholar] [CrossRef]
- Freeman, M.E.; Kanyicska, B.; Lerant, A.; Nagy, G. Prolactin: Structure, function, and regulation of secretion. Physiol. Rev. 2000, 80, 1523–1631. [Google Scholar] [CrossRef] [PubMed]
- Aragona, C.; Friesen, H.G. Specific prolactin binding sites in the prostate and testis of rats. Endocrinology 1975, 97, 677–684. [Google Scholar] [CrossRef] [PubMed]
- Brumlow, W.B.; Adams, C.S. Immunocytochemical detection of prolactin or prolactin-like immunoreactivity in epididymis of mature male mouse. Histochemistry 1990, 93, 299–304. [Google Scholar] [CrossRef] [PubMed]
- Jabbour, H.N.; Clarke, L.A.; McNeilly, A.S.; Edery, M.; Kelly, P. Is prolactin a gonadotrophic hormone in red deer (Cervus elaphus)? Pattern of expression of the prolactin receptor gene in the testis and epididymis. J. Mol. Endocrinol. 1998, 20, 175–182. [Google Scholar] [CrossRef] [PubMed]
- Orgebin-Crist, M.C.; Djiane, J. Properties of a prolactin receptor from the rabbit epididymis. Biol. Reprod. 1979, 21, 135–139. [Google Scholar] [CrossRef] [PubMed]
- Pratt, S.L.; Calcatera, S.M.; Stowe, H.M.; Dimmick, M.; Schrick, F.; Duckett, S.; Andrae, J. Identification of bovine prolactin in seminal fluid, and expression and localization of the prolactin receptor and prolactin-inducible protein in the testis and epididymis of bulls exposed to ergot alkaloids. Theriogenology 2015, 83, 662–669. [Google Scholar] [CrossRef] [PubMed]
- Ufearo, C.S.; Orisakwe, O.E. Restoration of normal sperm characteristics in hypoprolactinemic infertile men treated with metoclopramide and exogenous human prolactin. Clin. Pharmacol. Ther. 1995, 58, 354–359. [Google Scholar] [CrossRef] [PubMed]
- Corona, G.; Mannucci, E.; Fisher, A.D.; Lotti, F.; Ricca, V.; Balercia, G.; Petrone, L.; Forti, G.; Maggi, M. Effect of hyperprolactinemia in male patients consulting for sexual dysfunction. J. Sex. Med. 2007, 4, 1485–1493. [Google Scholar] [CrossRef] [PubMed]
- Ormandy, C.J.; Camus, A.; Barra, J.; Damotte, D.; Lucas, B.; Buteau, H.; Edery, M.; Brousse, N.; Babinet, C.; Binart, N.; et al. Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Gene Dev. 1997, 11, 167–178. [Google Scholar] [CrossRef]
- Binart, N.; Melaine, N.; Pineau, C.; Kercret, H.; Touzalin, A.M.; Imbert-Bolloré, P.; Kelly, P.A.; Jégou, B. Male reproductive function is not affected in prolactin receptor-deficient mice. Endocrinology 2003, 144, 3779–3782. [Google Scholar] [CrossRef]
- Clarke, L.A.; Edery, M.; Loudon, A.S.; Randall, V.; Postel-Vinay, M.-C.; Kelly, P.; Jabbour, H.N. Expression of the prolactin receptor gene during the breeding and non-breeding seasons in red deer (Cervus elaphus): Evidence for the expression of two forms in the testis. J. Endocrinol. 1995, 146, 313–321. [Google Scholar] [CrossRef] [PubMed]
- Ibraheem, M.; Galbraith, H.; Scaife, J.; Ewen, S. Growth of secondary hair follicles of the Cashmere goat in vitro and their response to prolactin and melatonin. J. Anat. 1994, 185 Pt 1, 135–142. [Google Scholar] [PubMed]
- Dicks, P.; Russel, A.J.; Lincoln, G.A. The role of prolactin in the reactivation of hair follicles in relation to moulting in cashmere goats. J. Endocrinol. 1994, 143, 441–448. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Duan, C.; Guo, Y.; Zhang, Y.; Liu, Y. Inhibition of prolactin promotes secondary skin follicle activation in cashmere goats. J. Anim. Sci. 2021, 99, skab079. [Google Scholar] [CrossRef] [PubMed]
- Nakata, H.; Iseki, S. Three-dimensional structure of efferent and epididymal ducts in mice. J. Anat. 2019, 235, 271–280. [Google Scholar] [CrossRef] [PubMed]
- Pilutin, A.; Misiakiewicz-Has, K.; Rzeszotek, S.; Wiszniewska, B. Morphological and morphometric changes and epithelial apoptosis are induced in the rat epididymis by long-term letrozole treatment. Eur. J. Histochem. 2021, 65, 3259. [Google Scholar] [CrossRef] [PubMed]
- Ben-Jonathan, N. Dopamine: A prolactin-inhibiting hormone. Endocr. Rev. 1985, 6, 564–589. [Google Scholar] [CrossRef]
- Curlewis, J.D.; Loudon, A.S.I.; Milne, J.A.; McNeilly, A.S. Effects of chronic long-acting bromocriptine treatment on liveweight, voluntary food intake, coat growth and breeding season in non-pregnant red deer hinds. J. Endocrinol. 1988, 119, 413–420. [Google Scholar] [CrossRef]
- Curlewis, J.D.; Sibbald, A.M.; Milne, J.A.; McNeilly, A. Chronic treatment with long-acting bromocriptine does not affect duration of the breeding season, voluntary food intake, body weight, or wool growth in the Scottish blackface ewe. Reprod. Fertil. Develop. 1991, 3, 25–33. [Google Scholar] [CrossRef]
- Blask, D.E.; Orstead, K.M. Dopamine inhibition of prolactin release but not synthesis in the male Syrian hamster: In vitro studies. Life Sci. 1986, 38, 1915–1921. [Google Scholar] [CrossRef]
- Franks, S. Regulation of prolactin secretion by oestrogens: Physiological and pathological significance. Clin. Sci. 1983, 65, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Wilson, J.D.; Williams, R.H.; Foster, D.W. Williams’ Textbook of Endocrinology, 8th ed.; Wilson, J.D., Foster, D.W., Eds.; W.B. Saunders Co., Ltd.: Philadelphia, PA, USA, 1992; p. 1712. ISBN 90008913. [Google Scholar]
- Cooke, P.S.; Nanjappa, M.K.; Ko, C.; Prins, G.S.; Hess, R.A.; Winn, N.C.; Jurrissen, T.J.; Grunewald, Z.I.; Cunningham, R.P.; Woodford, M.L.; et al. Estrogens in Male Physiology. Physiol. Rev. 2017, 97, 995–1043. [Google Scholar] [CrossRef] [PubMed]
- Carpino, A.; Romeo, F.; Rago, V. Aromatase immunolocalization in human ductuli efferentes and proximal ductus epididymis. J. Anat. 2004, 204, 217–220. [Google Scholar] [CrossRef] [PubMed]
- Herrera-Luna, C.V.; Scarlet, D.; Walter, I.; Aurich, C. Effect of stallion age on the expression of LH and FSH receptors and aromatase P450 in equine male reproductive tissues. Reprod. Fertil. Dev. 2016, 28, 2016–2026. [Google Scholar] [CrossRef]
- Pereyra-Martinez, A.C.; Roselli, C.E.; Stadelman, H.L.; Resko, J.A. Cytochrome P450 aromatase in testis and epididymis of male rhesus monkeys. Endocrine 2001, 16, 15–19. [Google Scholar] [CrossRef]
- Shayu, D.; Rao, A.J. Expression of functional aromatase in the epididymis: Role of androgens and LH in modulation of expression and activity. Mol. Cell Endocrinol. 2006, 249, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Pakarinen, P.; Niemimaa, T.; Huhtaniemi, I.T.; Warren, D. Transcriptional and translational regulation of LH, prolactin and their testicular receptors by hCG and bromocriptine treatments in adult and neonatal rats. Mol. Cell Endocrinol. 1994, 101, 37–47. [Google Scholar] [CrossRef] [PubMed]
- Sanford, L.M.; Baker, S.J. Prolactin regulation of testosterone secretion and testes growth in DLS rams at the onset of seasonal testicular recrudescence. Reproduction 2010, 139, 197–207. [Google Scholar] [CrossRef] [PubMed]
- Ravault, J.P. Prolactin in the ram: Seasonal variations in the concentration of blood plasma from birth until three years old. Acta Endocrinol. 1976, 83, 720–725. [Google Scholar] [CrossRef]
- Browne, J.A.; Yang, R.; Song, L.; Crawford, G.E.; Leir, S.-H.; Harris, A. Open chromatin mapping identifies transcriptional networks regulating human epididymis epithelial function. Mol. Hum. Reprod. 2014, 20, 1198–1207. [Google Scholar] [CrossRef]
- Thimon, V.; Koukoui, O.; Calvo, E.; Sullivan, R. Region-specific gene expression profiling along the human epididymis. Mol. Hum. Reprod. 2007, 13, 691–704. [Google Scholar] [CrossRef] [PubMed]
- Schimming, B.C.; Baumam, C.; Pinheiro, P.; de Matteis, R.; Domeniconi, R. Aquaporin 9 is expressed in the epididymis of immature and mature pigs. Reprod. Domest. Anim. 2017, 52, 617–624. [Google Scholar] [CrossRef] [PubMed]
- Menad, R.; Fernini, M.; Smaï, S.; Bonnet, X.; Gernigon-Spychalowicz, T.; Moudilou, E.; Khammar, F.; Exbrayat, J.-M. GPER1 in sand rat epididymis: Effects of seasonal variations, castration and efferent ducts ligation. Anim. Reprod. Sci. 2017, 183, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Lan, H.-C.; Li, H.-J.; Lin, G.; Lai, P.-Y.; Chung, B.-C. Cyclic AMP stimulates SF-1-dependent CYP11A1 expression through homeodomain-interacting protein kinase 3-mediated Jun N-terminal kinase and c-Jun phosphorylation. Mol. Cell Biol. 2007, 27, 2027–2036. [Google Scholar] [CrossRef] [PubMed]
- Da, S.N.; Smith, T.B. Exploring the role of mononuclear phagocytes in the epididymis. Asian J. Androl. 2015, 17, 591–596. [Google Scholar] [CrossRef] [PubMed]
- Xue, Y.; Cheng, X.; Xiong, Y.; Li, K. Gene mutations associated with fertilization failure after in vitro fertilization/intracytoplasmic sperm injection. Front. Endocrinol. 2022, 13, 1086883. [Google Scholar] [CrossRef] [PubMed]
- Xin, A.-J.; Sun, X.-X.; Yang, T.-Y.; Chen, Y.; Chen, G.-W.; Sun, Y.-S.; Li, Z.-C.; Shen, X.-R.; Zhang, Y.-N.; He, W.; et al. Sperm-specific protein ACTL7A as a biomarker for fertilization outcomes of assisted reproductive technology. Asian J. Androl. 2022, 24, 260–265. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Tang, J.; Wang, X.; Sun, Y.; Yang, T.; Shen, X.; Yang, X.; Shi, H.; Sun, X.; Xin, A. Loss of ACTL7A causes small head sperm by defective acrosome-acroplaxome-manchette complex. Reprod. Biol. Endocrin. 2023, 21, 82. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Liu, Z.; Jia, W.; Hou, M.; Zhang, X. Actl7a deficiency in mice leads to male infertility and fertilization failure. Biochem. Bioph. Res. Commun. 2022, 623, 154–161. [Google Scholar] [CrossRef]
- Fujihara, Y.; Murakami, M.; Inoue, N.; Satouh, Y.; Kaseda, K.; Ikawa, M.; Okabe, M. Sperm equatorial segment protein 1, SPESP1, is required for fully fertile sperm in mouse. J. Cell Sci. 2010, 123, 1531–1536. [Google Scholar] [CrossRef]
- Hara, Y.; Yamagata, K.; Oguchi, K.; Baba, T. Nuclear localization of profilin III–ArpM1 complex in mouse spermiogenesis. Febs. Lett. 2008, 582, 2998–3004. [Google Scholar] [CrossRef] [PubMed]
- Görögh, T.; Bèress, L.; Quabius, E.S.; Ambrosch, P.; Hoffmann, M. Head and neck cancer cells and xenografts are very sensitive to palytoxin: Decrease of c-jun n-terminale kinase-3 expression enhances palytoxin toxicity. Mol. Cancer 2013, 12, 12. [Google Scholar] [CrossRef] [PubMed]
- Gervasi, M.G.; Visconti, P.E. Molecular changes and signaling events occurring in spermatozoa during epididymal maturation. Andrology 2017, 5, 204–218. [Google Scholar] [CrossRef] [PubMed]
- Turner, T.T.; Bang, H.J.; Attipoe, S.A.; Johnston, D.S.; Tomsig, J.L. Sonic hedgehog pathway inhibition alters epididymal function as assessed by the development of sperm motility. J. Androl. 2006, 27, 225–232. [Google Scholar] [CrossRef]
- Ratovondrahona, D.; Fahmi, M.; Fournier, B.; Odessa, M.; Skryma, R.; Prevarskaya, N.; Djiane, J.; Dufy, B. Prolactin induces an inward current through voltage-independent Ca2+ channels in Chinese hamster ovary cells stably expressing prolactin receptor. J. Mol. Endocrinol. 1998, 21, 85–95. [Google Scholar] [CrossRef]
- Sorin, B.; Goupille, O.; Vacher, A.M.; Paly, J.; Djiane, J.; Vacher, P. Distinct cytoplasmic regions of the prolactin receptor are required for prolactin-induced calcium entry. J. Biol. Chem. 1998, 273, 28461–28469. [Google Scholar] [CrossRef]
- Cheng, J.B.; Motola, D.L.; Mangelsdorf, D.J.; Russell, D.W. De-orphanization of cytochrome P450 2R1: A microsomal vitamin D 25-hydroxilase. J. Biol. Chem. 2003, 278, 38084–38093. [Google Scholar] [CrossRef]
- Strushkevich, N.; Usanov, S.A.; Plotnikov, A.N.; Jones, G.; Park, H.-W. Structural analysis of CYP2R1 in complex with vitamin D3. J. Mol. Biol. 2008, 380, 95–106. [Google Scholar] [CrossRef] [PubMed]
- Agúndez, J.; García-Martín, E.; Alonso-Navarro, H.; Rodríguez, C.; Díez-Fairén, M.; Álvarez, I.; Pastor, P.; Benito-León, J.; López-Alburquerque, T.; Jiménez-Jiménez, F.J. Vitamin D Receptor and Binding Protein Gene Variants in Patients with Essential Tremor. Mol. Neurobiol. 2022, 59, 3458–3466. [Google Scholar] [CrossRef]
- Albiñana, C.; Zhu, Z.; Borbye-Lorenzen, N.; Boelt, S.G.; Cohen, A.S.; Skogstrand, K.; Wray, N.R.; Revez, J.A.; Privé, F.; Petersen, L.V.; et al. Genetic correlates of vitamin D-binding protein and 25-hydroxyvitamin D in neonatal dried blood spots. Nat. Commun. 2023, 14, 852. [Google Scholar] [CrossRef]
- Nagasawa, H.; Uto, Y.; Sasaki, H.; Okamura, N.; Murakami, A.; Kubo, S.; Kirk, K.L.; Hori, H. Gc protein (vitamin D-binding protein): Gc genotyping and GcMAF precursor activity. Anticancer Res. 2005, 25, 3689–3695. [Google Scholar] [PubMed]
- Choi, M.S.; Graves, M.J.; Matoo, S.; Storad, Z.A.; Idris, R.A.E.S.; Weck, M.L.; Smith, Z.B.; Tyska, M.J.; Crawley, S.W. The small EF-hand protein CALML4 functions as a critical myosin light chain within the intermicrovillar adhesion complex. J. Biol. Chem. 2020, 295, 9281–9296. [Google Scholar] [CrossRef] [PubMed]
- Aitken, R.J.; Drevet, J.R. The Importance of Oxidative Stress in Determining the Functionality of Mammalian Spermatozoa: A Two-Edged Sword. Antioxidants 2020, 9, 111. [Google Scholar] [CrossRef] [PubMed]
- Barati, E.; Nikzad, H.; Karimian, M. Oxidative stress and male infertility: Current knowledge of pathophysiology and role of antioxidant therapy in disease management. Cell Mol. Life Sci. 2020, 77, 93–113. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Alves, M.; Belleannee, C. Contribution of epididymal epithelial cell functions to sperm epigenetic changes and the health of progeny. Hum. Reprod. Update 2021, 28, 51–66. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Yan, M.; Cao, Z.; Li, X.; Zhang, Y.; Shi, J.; Feng, G.-H.; Peng, H.; Zhang, X.; Zhang, Y.; et al. Sperm tsRNAs contribute to intergenerational inheritance of an acquired metabolic disorder. Science 2016, 351, 397–400. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, X.; Shi, J.; Tuorto, F.; Li, X.; Liu, Y.; Liebers, R.; Zhang, L.; Qu, Y.; Qian, J.; et al. Dnmt2 mediates intergenerational transmission of paternally acquired metabolic disorders through sperm small non-coding RNAs. Nat. Cell Biol. 2018, 20, 535–540. [Google Scholar] [CrossRef] [PubMed]
- Gibney, E.R.; Nolan, C.M. Epigenetics and gene expression. Heredity 2010, 105, 4–13. [Google Scholar] [CrossRef] [PubMed]
- Candler, T.; Kühnen, P.; Prentice, A.M.; Silver, M. Epigenetic regulation of POMC; implications for nutritional programming, obesity and metabolic disease. Front. Neuroendocrinol. 2019, 54, 100773. [Google Scholar] [CrossRef]
- Drouin, J. 60 YEARS OF POMC: Transcriptional and epigenetic regulation of POMC gene expression. J. Mol. Endocrinol. 2016, 56, T99–T112. [Google Scholar] [CrossRef]






| Gene Name | Primer 5′ to 3′ | Gene ID | |
|---|---|---|---|
| β-actin | F | GCGGCATTCACGAAACTACC | 102179831 |
| R | GCCAGGGCAGTGATCTCTTT | ||
| ACRV1 | F | CAGTTGAACACGCAAGTGGG | 102185536 |
| R | GTTGTTCACCGGAAGTGTGC | ||
| ACTL7A | F | GTGTCCTGCCTCAACAAGTG | 102184342 |
| R | GACACATGCTGCTCAGTTCC | ||
| ACTRT3 | F | TGTGATGGCCCAGTCTTGAT | 102181538 |
| R | AAAGCCAGTTGTGAAGCCAG | ||
| ADCY10 | F | CTTCAACCTGCCCCTGAAAC | 102173054 |
| R | GATTCCGGAGCAATGACCAC | ||
| CALML4 | F | TCCCTGTATGACAAGCAGCA | 102171428 |
| R | GTCTATCCTGTGAGTCCGCA | ||
| CYP2R1 | F | TAATGTGCTACGGTGGGCAAT | 102190621 |
| R | CCTCATGTAAAACTGCTTCGG | ||
| ENPP3 | F | TGCTCCATTGCCCACAGATA | 102169872 |
| R | GAGACAGGGCTCCTTGTTCT | ||
| ESR2 | F | AGTGCAAAAATGTGGTGCCC | 100860823 |
| R | GCCCTCTTTGCTCTCACTGT | ||
| FAM170B | F | AGAACACCTACTTCTCGGGC | 102190381 |
| R | GCAAGACTGGTACTGGGAGT | ||
| GC | F | GCCCAAGGAGCTTCCTGAAT | 102176214 |
| R | CTTTGTTCGTGGGCAACTGG | ||
| GPER1 | F | CTTCTCCAACAGCTGCCTCA | 106503626 |
| R | CCGGTTTTCTGCTCCAGGTA | ||
| JUN | F | CGTCCACTGCCAATATGCTC | 102185423 |
| R | GTTAGCATGAGTTGGCACCC | ||
| MAPK10 | F | ATGTGGAGAATCGGCCCAAG | 102182774 |
| R | TCGCTGGGTCAATCACTAGC | ||
| PLA2G4E | F | AACCTATCCCACACCTCGGA | 102187595 |
| R | ATTTCAGGCAGGAGTGGCTC | ||
| POMC | F | GCTGAGCTGGAGTATGGTCT | 102182514 |
| R | GCTCTTCTCCGAGGTCATGA | ||
| SPESP1 | F | CCAGAGCCAATTGAACCTCG | 102171881 |
| R | GGAACATCTTCTTCCGTGGC | ||
| STPG4 | F | TTTCCAACAGGCTGCTTCAC | 102180769 |
| R | GCAGGCAAGAATCGAGGTAC | ||
| ENSCHIG00000016126 | F | CAGGTTTGACCAGGTGACGA | 102185549 |
| R | GAACTGCCATCCCGGAAAGA | ||
| ENSCHIG00000024353 | F | CCAGGTTGTGTGGAACCAGT | 106503207 |
| R | GTCCGAGTCCTGGAAGTTGG | ||
| ENSCHIG00000026189 | F | TACGCCTTCTCCCAGTTTCG | 102178625 |
| R | AGAAGGCATACCAGACGTG | ||
| Sample Name | Raw Reads | Clean Reads | Clean Reads (%) | Q20 (%) | Q30 (%) |
|---|---|---|---|---|---|
| CON1 | 162,455,762 | 139,289,932 | 85.74 | 97.98 | 94.46 |
| CON2 | 147,909,398 | 134,685,882 | 91.05 | 97.74 | 93.77 |
| CON3 | 146,488,370 | 133,759,152 | 91.30 | 97.67 | 93.6 |
| BCR1 | 156,925,208 | 142,022,078 | 90.5 | 97.99 | 94.17 |
| BCR2 | 159,208,604 | 144,256,712 | 90.6 | 97.89 | 93.96 |
| BCR3 | 154,521,362 | 141,450,084 | 91.54 | 97.76 | 93.79 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Duan, C.; Yin, X.; Zhang, L.; Chen, M.; Zhao, W.; Li, X.; Liu, Y.; Zhang, Y. Inhibition of Prolactin Affects Epididymal Morphology by Decreasing the Secretion of Estradiol in Cashmere Bucks. Animals 2024, 14, 1778. https://doi.org/10.3390/ani14121778
Liu X, Duan C, Yin X, Zhang L, Chen M, Zhao W, Li X, Liu Y, Zhang Y. Inhibition of Prolactin Affects Epididymal Morphology by Decreasing the Secretion of Estradiol in Cashmere Bucks. Animals. 2024; 14(12):1778. https://doi.org/10.3390/ani14121778
Chicago/Turabian StyleLiu, Xiaona, Chunhui Duan, Xuejiao Yin, Lechao Zhang, Meijing Chen, Wen Zhao, Xianglong Li, Yueqin Liu, and Yingjie Zhang. 2024. "Inhibition of Prolactin Affects Epididymal Morphology by Decreasing the Secretion of Estradiol in Cashmere Bucks" Animals 14, no. 12: 1778. https://doi.org/10.3390/ani14121778
APA StyleLiu, X., Duan, C., Yin, X., Zhang, L., Chen, M., Zhao, W., Li, X., Liu, Y., & Zhang, Y. (2024). Inhibition of Prolactin Affects Epididymal Morphology by Decreasing the Secretion of Estradiol in Cashmere Bucks. Animals, 14(12), 1778. https://doi.org/10.3390/ani14121778
