Screening and Identification of the Biomarkers Applied for the Evaluation of Acute and Chronic Thermal Tolerance Ability in Largemouth Bass (Micropterus salmoides)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials and Experimental Design
2.2. Sample Collection
2.3. Determination of Cortisol, Blood Glucose, Lactate, and Activities of Enzymes
2.4. Expression Analysis of Hepatic hsp Genes
2.5. Data Analysis
3. Results
3.1. Effects of Acute and Chronic Thermal Stress on the Plasma Cortisol, Blood Glucose, and Lactate Levels
3.2. Effects of Acute and Chronic Thermal Stress on the Activities of Antioxidant Enzymes in Liver Tissues
3.3. Effects of Acute and Chronic Thermal Stress on the Activities of Glucose Metabolism-Related Enzymes in Liver Tissues
3.4. Effects of Acute and Chronic Thermal Stress on the Expressions of hsp70 and hsp90 in Liver Tissues
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Leticia, E.F.; Matthew, A.S.; Michele, J.; Luke, A.R.; Rebecca, L.; Anita, M.K. Growth parameters in northern largemouth bass Micropterus salmoides salmoides raised near their upper thermal tolerance for 28 days. Aquacult. Rep. 2021, 21, 100845. [Google Scholar] [CrossRef]
- Gavin, L.A.; Josh, S.; Allen, N.; Matthew, K.L.; Hana, N.H.; Timothy, J.B.; Helen, R.M.; Anita, M.K.; Luke, A.R.; Moisés, A.B.; et al. Effects of temperature and subspecies during critical early life history stages of largemouth bass (Micropterus salmoides). Aquaculture 2023, 570, 739350. [Google Scholar] [CrossRef]
- Zheng, J.L.; Zhang, H.T.; Gao, L.; Chen, X.; Zhu, Q.L.; Han, T. Combined effects of crowding stress and low salinity on GH/IGF axis, antioxidant response, and HPI axis in largemouth bass (Micropterus salmoides) larvae. Aquaculture 2024, 578, 740036. [Google Scholar] [CrossRef]
- Sun, J.L.; Zhao, L.L.; Liao, L.; Tang, X.H.; Cui, C.; Liu, Q.; He, K.; Ma, J.D.; Jin, L.; Yan, T.; et al. Interactive effect of thermal and hypoxia on largemouth bass (Micropterus salmoides) gill and liver: Aggravation of oxidative stress, inhibition of immunity and promotion of cell apoptosis. Fish Shellfish. Immun. 2020, 98, 923–936. [Google Scholar] [CrossRef]
- Luo, W.; Li, Q.; Liu, X.; Wang, L.; Zhou, J.; Yang, R. Water temperature characteristics and prediction of fish ponds in Sichuan basin in summer. Chin. J. Agrometeorol. 2022, 43, 980–990. [Google Scholar] [CrossRef]
- Bailey, R.M.; Hubbs, C.L. The Black Basses (Micropterus) of Florida, with Description of a New Species; University of Michigan Press: Ann Arbor, MI, USA, 1949; p. 516. [Google Scholar]
- Maceina, M.J.; Murphy, B.R. Stocking Florida largemouth bass outside its native range. Trans. Am. Fish. Soc. 1992, 121, 686–691. [Google Scholar] [CrossRef]
- Fields, R.; Lowe, S.S.; Kaminski, C.; Whitt, G.S.; Philippet, D.P. Critical and chronic thermal maxima of northern and Florida largemouth bass and their reciprocal F1 and F2 hybrids. Trans. Am. Fish. Soc. 1987, 116, 856–863. [Google Scholar] [CrossRef]
- McCormick, J.H.; Wegner, J.A. Responses of largemouth bass from different latitudes to elevated water temperatures. Trans. Am. Fish. Soc. 1981, 110, 417–429. [Google Scholar] [CrossRef]
- Fan, J.; Bai, J.; Ye, X.; Li, S.; He, X. Taxonomic status of largemouth bass Micropterus salmoides cultured in China. J. Dalian Fish Univ. 2009, 24, 83–86. [Google Scholar] [CrossRef]
- Fan, J.J.; Bai, J.J.; Li, S.J.; Ma, D.M.; Jiang, P. Analysis on genetic diversity of three breeding populations of largemouth bass using formulated feeds. Prog. Fish. Sci. 2019, 40, 57–64. [Google Scholar] [CrossRef]
- Du, J.X.; Li, S.J.; Shao, J.Q.; Song, H.M.; Jiang, P.; Lei, S.X.; Bai, J.J.; Han, L.Q. Genetic diversity analysis and development of molecular markers for the identification of largemouth bass (Micropterus salmoides L.) based on whole-genome re-sequencing. Front. Genet. 2022, 13, 936610. [Google Scholar] [CrossRef]
- Bruce, A.B. Stress in fishes: A diversity of responses with particular reference to changes in circulating corticosteroids. Integr. Comp. Biol. 2002, 42, 517–525. [Google Scholar] [CrossRef]
- Tsalafouta, A.; Papandroulakis, N.; Gorissen, M.; Katharios, P.; Flik, G.; Pavlidis, M. Ontogenesis of the HPI axis and molecular regulation of the cortisol stress response during early development in Dicentrarchus labrax. Sci. Rep. 2014, 4, 5525. [Google Scholar] [CrossRef]
- Ramsay, J.M.; Feist, G.W.; Varga, Z.M.; Westerfield, M.; Kent, M.L.; Schreck, C.B. Whole-body cortisol is an indicator of crowding stress in adult zebrafish, Danio rerio. Aquaculture 2007, 258, 565–574. [Google Scholar] [CrossRef]
- Li, D.L.; Wang, G.X.; Du, L.; Zheng, Y.Y.; Wang, Z.H. Recent advances in intelligent recognition methods for fish stress behavior. Aquacult. Eng. 2022, 96, 102222. [Google Scholar] [CrossRef]
- Fazio, F.; Piccione, G.; Arfuso, F.; Faggio, C. Peripheral blood and head kidney haematopoietic tissue response to experimental blood loss in mullet (Mugil cephalus). Mar. Biol. Res. 2015, 11, 197–202. [Google Scholar] [CrossRef]
- Faggio, C.; Arfuso, F.; Piccione, G.; Zumbo, A.; Fazio, F. Effect of three different anticoagulants and storage time on haematological parameters of mugil cephalus (Linneaus, 1758). Turk. J. Fish. Aquat. Sci. 2014, 14, 615–621. [Google Scholar] [CrossRef]
- Mulhollem, J.J.; Suski, C.D.; Wahl, D.H. Response of largemouth bass (Micropterus salmoides) from different thermal environments to increased water temperature. Fish Physiol. Biochem. 2015, 41, 833–842. [Google Scholar] [CrossRef]
- Lu, J.; Zhang, J.J.; Wang, P.P.; Zhou, G.Q.; Qin, H. Effect of acute temperature stress on survival rate and biochemical indices in the liver of Micropterus salmoides “Youlu No.3”. Freshw. Fish. 2020, 2, 87–93. [Google Scholar] [CrossRef]
- Lu, J.; Zhang, J.J.; Wang, P.P.; Zhou, G.Q.; Qin, H. Effect of acute high temperature stress on tissue damage and HSPs Gene expression of largemouth bass Micropterus salmoides “Youlu No.3”. Fish. Sci. 2021, 4, 508–515. [Google Scholar] [CrossRef]
- Zhu, Z.W.; Zhu, W.M.; Lan, H.B. The biological characteristics and nutritional requirement of largemouth bass (Micropterus salmoides). Feed Ind. 2014, 469, 31–36. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Aluru, N.; Vijayan, M.M. Aryl hydrocarbon receptor activation impairs cortisol response to stress in rainbow trout by disrupting the rate-limiting steps in steroidogenesis. Endocrinology 2006, 147, 1895–1903. [Google Scholar] [CrossRef]
- Aluru, N.; Vijayan, M.M. Hepatic transcriptome response to glucocorticoid receptor activation in rainbow trout. Physiol. Genom. 2015, 31, 483–491. [Google Scholar] [CrossRef]
- Kuo, T.; McQueen, A.; Chen, T.C.; Wang, J.C. Regulation of glucose homeostasis by glucocorticoids. Adv. Exp. Med. Biol. 2015, 872, 99–126. [Google Scholar] [CrossRef]
- Li, Q.C.; Chen, X.M.; Liu, X.D. Acute heat stress on the influence of large yellow croaker (Larimichthys crocea) serum physiological indicators. J. Fish. Res. 2016, 6, 437–444. [Google Scholar] [CrossRef]
- Wen, H.C.; Lv, L.K.; Li, L.M.; Zhao, J.; Zhang, S.M. Effect of temperature on physiological and biochemical parameters and gene expression of male Sebastes schlegelii. Period. Ocean. Univ. China 2016, 11, 44–51. [Google Scholar] [CrossRef]
- Zhang, N.; Luo, G.Z.; Tan, H.X.; Sun, D.C.; Ban, Y.F.; Zheng, H.S. Effects of water temperature on growth and blood biochemical immunological indices of Scortum barcoo. J. Fish. Sci. China 2010, 6, 1236–1242. [Google Scholar]
- Fei, G.P.; Zhuang, P.; Zhang, L.Z.; Hou, J.L.; Liu, J.Y.; Zhang, T. Effects of water temperature on biochemical parameters of juvenile Chinese sturgeon (Acipenser sinensis) blood. Chin. J. Ecol. 2010, 10, 1973–1978. [Google Scholar] [CrossRef]
- Oyarzún-Salazar, R.; Rojas, J.J.; Pontigo, J.P.; Mardones, O.; Muoz, J.L.P.; Dantagnan, P.; Vargas-Chacoff, L. Long-term effects of temperatures on the physiological response of juveniles of the eurythermal subantarctic notothenioid Eleginops maclovinus. Aquaculture 2021, 530, 735797. [Google Scholar] [CrossRef]
- Madeira, D.; Narciso, L.; Cabral, H.N.; Vinagre, C.; Diniz, M.S. Influence of temperature in thermal and oxidative stress responses in estuarine fish. Comp. Biochem. Physiol. Mol. Integr. Physiol. 2013, 166, 237–243. [Google Scholar] [CrossRef] [PubMed]
- Nakano, T.; Kameda, M.; Shoji, Y.; Hayashi, S.; Yamaguchi, T.; Sato, M. Effect of severe environmental thermal stress on redox state in salmon. Redox. Biol. 2014, 2, 772–776. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.Y.; Huang, M.; Yang, X.G.; Zhou, Y.G.; Gao, Q.F.; Dong, S.L. Antioxidant enzyme activities of juvenile rainbow and steelhead trout (Oncorhynchus mykiss) in response to acute high-temperature stress. J. Fish. Sci. China 2021, 28, 57–65. [Google Scholar] [CrossRef]
- Zhao, W.; Han, T.T.; Wei, J.; Pu, H.Y.; Wang, S.; Yuan, X. Effect of acute temperature change on antioxidant enzyme activities and lipid peroxidation in the ark shell Scapharca subcrenata (Lischke, 1869). J. Shellfish Res. 2016, 35, 399–403. [Google Scholar] [CrossRef]
- Wang, Y.F.; Li, C.J.; Pan, C.L.; Liu, E.G.; Zhao, X.Q.; Ling, Q.F. Alterations to transcriptomic profile, histopathology, and oxidative stress in liver of pikeperch (Sander lucioperca) under heat stress. Fish Shellfish Immun. 2019, 95, 659–669. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.B.; Deng, W.; Zhang, D.D.; Gao, Y.; Yang, Z.; Shi, X.C.; Sun, J.; Zhou, J.S.; Ji, H. Antioxidant defenses of Onychostoma macrolepis in response to thermal stress: Insight from mRNA expression and activity of superoxide dismutase and catalase (Article). Fish Shellfish Immun. 2017, 66, 50–61. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.Y.; Liu, E.G.; Li, C.J.; Pan, C.L.; Zhao, X.Q.; Wang, Y.F.; Ling, Q.F. Effects of heat stress on histopathology, antioxidant enzymes, and transcriptomic profiles in gills of pikeperch Sander lucioperca. Aquaculture 2021, 534, 736277. [Google Scholar] [CrossRef]
- Liu, S.L.; Ru, X.S.; Xu, Q.Z.; Bo, X.C.; Li, J.; Zhang, L.B.; Yang, H.S. Effects of high-temperature stress on several immune enzyme activities of Apostichopus japonicus thermotolerant and normal species. J. Fish. Sci. China 2016, 23, 344–351. [Google Scholar]
- Richards, J.G.; Sardella, B.A.; Schulte, P.M. Regulation of pyruvate dehydrogenase in the common killifish, Fundulus heteroclitus, during hypoxia exposure. Am. J. Physiol-Reg. I. 2008, 295, R979–R990. [Google Scholar] [CrossRef]
- Couto, A.; Enes, P.; Peres, H.; Oliva-Teles, A. Effect of water temperature and dietary starch on growth and metabolic utilization of diets in gilthead sea bream (Sparus aurata) juveniles. Com. Biochem. Physiol. A Mol. Integr. Physiol. 2008, 151, 45–50. [Google Scholar] [CrossRef]
- Enes, P.; Panserat, S.; Kaushik, S.; Oliva-Teles, A. Rearing temperature enhances hepatic glucokinase but not glucose-6-phosphatase activities in European sea bass (Dicentrarchus labrax) and gilthead sea bream (Sparus aurata) juveniles fed with the same level of glucose. Com. Biochem. Physiol. A Mol. Integr. Physiol. 2008, 150, 355–358. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Jia, H.X.; Xiong, P.P.; Yao, G.Y.; He, M.X. Transcriptome and enzyme activity analyses of tolerance mechanisms in pearl oyster (Pinctada fucata) under high-temperature stress. Aquaculture 2022, 550, 737888. [Google Scholar] [CrossRef]
- Ding, J.F.; Li, J.; Yang, D.M.; Yang, F.; Nie, H.T.; Huo, Z.M.; Yan, X.W. Molecular characteristics of a novel HSP60 gene and its differential expression in Manila clams (Ruditapes philippinarum) under thermal and hypotonic stress. Cell Stress Chaperones 2018, 23, 179–187. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.L.; Wen, H.S.; Tian, Y.; Mao, X.B.; Li, X.R.; Li, J.J.; Hu, Y.B.; Liu, Y.; Li, J.F.; Li, Y. HSP90 and HSP70 families in Lateolabrax maculatus: Genome-wide identification, molecular characterization, and expression profiles in response to various environmental stressors. Front. Physiol. 2021, 12, 784803. [Google Scholar] [CrossRef] [PubMed]
- Mailhos, C.; Howard, M.K.; Latchman, D.S. Heat shock proteins hsp90 and hsp70 protect neuronal cells from thermal stress but not from programmed cell death. J. Neurochem. 1994, 63, 1787–1795. [Google Scholar] [CrossRef] [PubMed]
- Feder, M.E.; Hofmann, G.E. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 1999, 61, 243–282. [Google Scholar] [CrossRef] [PubMed]
- Pratt, W.B. The role of the HSP90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Annu. Rev. Pharmacol. 1997, 37, 297–326. [Google Scholar] [CrossRef]
- Wang, X.W.; Zhang, R.; Zhu, J.Y.; Liu, L.L.; Ma, G.Q.; Zhu, H. Effects of acute heat stress on hepatic biochemical index and gene expression of heat shock proteins in Acipenser Baeri. J. Sichuan Agric. Univ. 2019, 37, 122–128. [Google Scholar] [CrossRef]
- Zhang, C.G.; Ding, W.D.; Cao, Z.M.; Bing, X.W.; Xu, C.; Li, L. Effects of acute high temperature stress on antioxidant enzymes activity, digestive enzymes activity and gene expression of heat shock proteins in mandarin fish (Siniperca chuatsi). Guangxi Agric. Sci. 2021, 52, 815–826. [Google Scholar] [CrossRef]
- Sharmaa, J.; Singhb, S.P.; Chakrabartib, R. Effect of temperature on digestive physiology, immune-modulatory parameters, and expression level of Hsp and LDH genes in Catla catla (Hamilton, 1822). Aquaculture 2017, 479, 134–141. [Google Scholar] [CrossRef]
- Han, D.; Huang, S.S.Y.; Wang, W.F.; Deng, D.F.; Hung, S.S.O. Starvation reduces the heat shock protein responses in white sturgeon larvae. Environ. Biol. Fish 2012, 93, 333–342. [Google Scholar] [CrossRef]
- Ahmad, M.; Zuberi, A.; Ali, M.; Syed, A.; Murtaza, M.H.; Khan, A.; Kamran, M. Effect of acclimated temperature on thermal tolerance, immune response and expression of HSP genes in Labeo rohita, Catla catla and their intergeneric hybrids. J. Therm. Biol. 2020, 89, 102570. [Google Scholar] [CrossRef] [PubMed]
- Shin, M.K.; Park, H.R.; Yeo, W.J.; Han, K.N. Effects of thermal stress on the mRNA expression of SOD, HSP90, and HSP70 in the Spotted sea bass (Lateolabrax maculatus). Ocean Sci. J. 2018, 53, 43–52. [Google Scholar] [CrossRef]
- Sathiyaa, R.; Campbell, T.; Vijayan, M.M. Cortisol modulates HSP90 mRNA expression in primary cultures of trout hepatocytes. Comp. Biochem. Physiol. B 2001, 129, 679–685. [Google Scholar] [CrossRef] [PubMed]
Gene Game | Primer Sequence (5′→3′) | |
---|---|---|
Forward Primer | Reverse Primer | |
hsp70 (MN121693.1) | GCAGACGCAGACCTTCACCA | GGGAACACCACGAGGAGCAG |
hsp90 (XM_038705070.1) | TGCGCTTCCAGACCTCCAAC | TCAGCCTCCTTCCTGCTGGT |
β-actin | AAAGGGAAATCGTGCGTGAC | AAGGAAGGCTGGAAGAGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, M.; Du, J.; Li, S.; Zhu, T.; Lei, C.; Yan, H.; Song, H. Screening and Identification of the Biomarkers Applied for the Evaluation of Acute and Chronic Thermal Tolerance Ability in Largemouth Bass (Micropterus salmoides). Animals 2024, 14, 1435. https://doi.org/10.3390/ani14101435
Li M, Du J, Li S, Zhu T, Lei C, Yan H, Song H. Screening and Identification of the Biomarkers Applied for the Evaluation of Acute and Chronic Thermal Tolerance Ability in Largemouth Bass (Micropterus salmoides). Animals. 2024; 14(10):1435. https://doi.org/10.3390/ani14101435
Chicago/Turabian StyleLi, Ming, Jinxing Du, Shengjie Li, Tao Zhu, Caixia Lei, Hanwei Yan, and Hongmei Song. 2024. "Screening and Identification of the Biomarkers Applied for the Evaluation of Acute and Chronic Thermal Tolerance Ability in Largemouth Bass (Micropterus salmoides)" Animals 14, no. 10: 1435. https://doi.org/10.3390/ani14101435