Next Article in Journal
Spatial and Temporal Variability of Trace and Macro Elements in the Red Crab Pleuroncodes planipes in the Pacific Coast of the Baja California Peninsula, Mexico
Next Article in Special Issue
Differential Impacts of Cereal and Protein Sources Fed to Pigs after Weaning on Diarrhoea and Faecal Shedding of Escherichia coli, Production, and Total Tract Apparent Digestibility
Previous Article in Journal
Regulatory Role of microRNA of Milk Exosomes in Mastitis of Dairy Cows
Previous Article in Special Issue
Nutritional and Functional Roles of Phytase and Xylanase Enhancing the Intestinal Health and Growth of Nursery Pigs and Broiler Chickens
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 5
10.3390/ani13050823
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs

by
Brigkita Venardou
1,
John V. O’Doherty
2,
Marco Garcia-Vaquero
2,
Claire Kiely
2,
Gaurav Rajauria
2,
Mary J. McDonnell
2,
Marion T. Ryan
1 and
Torres Sweeney
1,*
1
School of Veterinary Medicine, University College Dublin, Belfield, D04 V1W8 Dublin, Ireland
2
School of Agriculture and Food Science, University College Dublin, Belfield, D04 V1W8 Dublin, Ireland
*
Author to whom correspondence should be addressed.
Animals 2023, 13(5), 823; https://doi.org/10.3390/ani13050823
Submission received: 13 January 2023 / Revised: 21 February 2023 / Accepted: 22 February 2023 / Published: 24 February 2023
(This article belongs to the Special Issue Dietary Measures and Feed Additives to Stabilise Intestinal Health in Pigs)
Review Reports Versions Notes

Abstract

:

Simple Summary

The transition from milk to solid feed in commercial pig-production systems negatively affects gut health, particularly the composition of the residing microbial community. This can subsequently impair pig growth and long-term health. Natural dietary supplements including seaweed extracts have the capacity to reduce pathogen load (antibacterial activity) and/or increase beneficial microbes (prebiotic activity). This study evaluated the antibacterial and prebiotic potential of two seaweed species, Laminaria hyperborea and Laminaria digitata, and their extracts using laboratory-based simulations of the gut microbial community of weaned pigs. Our investigation identified seaweed extracts that could decrease the numbers of pig- and food-related pathogens or increase the number of beneficial microbes, albeit to a different extent. These findings indicate that seaweeds are a promising source of antibacterial and prebiotic dietary supplements for use in pigs during the weaning period.

Abstract

Laminaria spp. and their extracts have preventative potential as dietary supplements during weaning in pigs. The first objective of this study was to evaluate increasing concentrations of four whole seaweed biomass samples from two different Laminaria species harvested in two different months in a weaned pig faecal batch fermentation assay. Particularly, February and November whole seaweed biomass samples of L. hyperborea (LHWB-F and LHWB-N) and L. digitata (LDWB-F and LDWB-N) were used. In the next part of the study, the increasing concentrations of four extracts produced from L. hyperborea (LHE1–4) and L. digitata (LDE1–4) were evaluated in individual pure-culture growth assays using a panel of beneficial and pathogenic bacterial strains (second objective). The LHE1–4 and LDE1–4 were obtained using different combinations of temperature, incubation time and volume of solvent within a hydrothermal-assisted extraction methodology (E1–4). In the batch fermentation assay, the L. hyperborea biomass samples, LHWB-F and LHWB-N, lowered Bifidobacterium spp. counts compared to the L. digitata biomass samples, LDWB-F and LDWB-N (p < 0.05). LHWB-F and LDWB-N reduced Enterobacteriaceae counts (p < 0.05). LHWB-F and LDWB-F were selected as the most and least promising sources of antibacterial extracts from which to produce LHE1–4 and LDE1–4. In the pure-culture growth assays, E1- and E4-produced extracts were predominantly associated with antibacterial and bifidogenic activities, respectively. LHE1 reduced both Salmonella Typhimurium and Enterotoxigenic Escherichia coli with LDE1 having a similar effect on both of these pathogenic strains, albeit to a lesser extent (p < 0.05). Both LHE1 and LDE1 reduced B. thermophilum counts (p < 0.05). LDE4 exhibited strong bifidogenic activity (p < 0.05), whereas LHE4 increased Bifidobacterium thermophilum and Lactiplantibacillus plantarum counts (p < 0.05). In conclusion, antibacterial and bifidogenic extracts of Laminaria spp. were identified in vitro with the potential to alleviate gastrointestinal dysbiosis in newly weaned pigs.

1. Introduction

A healthy gut microbiota which is compositionally and functionally diverse and stable is essential to support host health and growth [1,2,3,4]. Contrarily, dysbiosis represents a state of imbalance in the composition and function of this microbial community, characterised by decreases in beneficial microorganisms and/or overgrowth of pathogens and/or a loss of overall diversity, with a subsequent negative impact on gastrointestinal health [5]. Commercial weaning in pigs is a typical example of dysbiosis, whereby the transition from milk to solid feed, coupled with emotional, social and environmental stressors leads to gastrointestinal dysfunction characterised by dysbiosis that predisposes them to intestinal infection and disease [6,7].
In a recent review, the potential of marine macroalgae or seaweeds were considered as natural dietary supplements with which to promote gastrointestinal health and subsequently growth in weaned pigs [8]. Brown seaweeds are rich in nondigestible polysaccharides, minerals, polyphenols and vitamins [9,10]. Wide-ranging biological activities [11] have been attributed to seaweed components, particularly fucoidan and laminarin, including prebiotic [12,13] and antibacterial [14,15] potential. However, various factors influence the concentration, structure and biological activity of seaweed-derived polysaccharides, such as seaweed species, harvest season, environmental conditions, and extraction methodologies [14,16]. Recently, a multivariate statistic technique, response surface methodology, has been utilised to improve the extraction efficiency by optimising the extraction conditions for a selected seaweed polysaccharide and/or bioactivity [17]. In that study, a novel hydrothermal-assisted extraction (HAE) methodology with combinations of temperature, time and solvent to seaweed ratio optimised for the best concentration of laminarin and/or fucoidan and/or antioxidant activity was developed using the response surface methodology. Seaweed extracts of Ascophyllum nodosum produced using this HAE methodology exhibited enhanced antibacterial and prebiotic activity compared to the conventional extraction methods [18].
The brown seaweed Laminaria spp. is a rich source of biologically active nondigestible polysaccharides. Previous in vitro investigation has associated this seaweed species with various biological activities including anti-inflammatory, immunomodulatory, antioxidant, antitumor and antihypertensive [9,11] effects, several of which have also been observed in in vivo studies with pigs [19,20,21,22]. Concerning its effect on the gastrointestinal microbiota, dietary supplementation of pigs with crude Laminaria spp. extracts consistently led to a reduction in the numbers of the Enterobacteriaceae family [22,23,24,25,26,27] which include several animal and human pathogens such as Salmonella enterica subsp. enterica serotype Typhimurium and pathogenic Escherichia coli [28,29]. Furthermore, an increase in Enterobacteriaceae family is considered to be an indication of dysbiosis and a risk factor for post-weaning diarrhoea in pigs [6,30]. Dietary supplementation of pigs with crude Laminaria spp. extracts led to a more variable response in the intestinal lactobacilli and Bifidobacterium spp. populations, as both increases [22] and decreases [23,24] in their counts have been reported. Lactobacilli are dominant members of the gastrointestinal microbiota in pigs and have an important role in growth and health due to their contributions to nutrient bioavailability, inhibition of pathogen colonisation and immunomodulation [31,32]. Bifidobacterium spp. are considered a beneficial bacterial population due to their probiotic status [33], but are present in low abundance in the gastrointestinal tract of pigs [34].
The current study focused on the antibacterial and prebiotic potential of two polysaccharide-rich members of the Laminaria spp., L. digitata and L. hyperborea, with an average total carbohydrate content of 70.7% and 65.5% of dry weight, respectively, as described in previous reports [35]. Batch fermentation and pure-culture growth assays were useful screening tools when assessing the direct effects of whole biomass seaweed samples and their extracts on key bacterial populations and species in the porcine gastrointestinal tract [18]. Thus, the first objective of this study was to assess the influence of seaweed species and harvest season on the effect of whole biomass samples of L. digitata and L. hyperborea with respect to selected faecal bacterial populations in a batch fermentation assay inoculated with pig faeces. The second objective was to investigate whether the different extraction conditions of the HAE methodology led to L. digitata and L. hyperborea extracts with improved antibacterial and prebiotic activities using a panel of pure-culture growth assays.

2. Materials and Methods

2.1. Laminaria spp.: Whole Biomass Samples and Extracts

The whole biomass samples (WB) of L. digitata (LD) and L. hyperborea (LH) were harvested in February (LDWB-F and LHWB-F) and November (LDWB-N and LHWB-N) by Quality Sea Veg Ltd., Co. (Donegal, Ireland). For each seaweed species, whole biomass samples were collected at a single time point and from the same collection site. The preparation (oven-dying, milling) and compositional analysis (dry matter, ash, protein, crude lipids, polysaccharide content, total phenols) of the dried whole seaweed biomass samples was performed as previously described [36]. LDWB-F, LDWB-N, LHWB-F and LHWB-N were stored at room temperature until their evaluation in the batch fermentation assay.
A HAE methodology with optimised extraction conditions (temperature, incubation time and volume of solvent) was used to produce the extracts of LDWB-F and LHWB-F, as described previously by Garcia-Vaquero et al. [17] and presented in Table 1. The parameters for each extraction condition were optimised towards the concentration of fucoidan for E1, laminarin for E2, antioxidant activity for E3 and all the above for E4. The produced extracts of L. digitata (LDE1–4) and L. hyperborea (LHE1–4) were freeze-dried and their laminarin and fucoidan content was determined as previously described [18]. All extracts were analysed on two independent occasions (two biological replicates) with three readings each time. LDE1–4 and LHE1–4 were stored at −20 °C until their evaluation in the pure-culture growth assays.

2.2. Batch Fermentation Assay

The preparation of the faecal inoculum and the batch fermentation assay were carried out as described previously [37]. Briefly, faeces from 29 healthy newly weaned crossbred pigs (Large White × Landrace) fed a cereal- and milk-based diet were pooled, aliquoted and stored at −20 °C. One day prior to the batch fermentation assay, the pooled faeces were diluted (1:5 w/v) in phosphate-buffered saline (Sigma-Aldrich, St. Louis, MO, USA) after oxygen removal using oxyrase (Sigma-Aldrich, St. Louis, MO, USA) to prepare the faecal inoculum (FI) that was stored at 4 °C anaerobically. The FI was added to the fermentation medium at a 1:10 v/v ratio (21 mL final volume). The inclusion levels of LDWB-F, LHWB-F, LDWB-N and LHWB-N in the FI/fermentation medium were 0 (control tubes), 1, 2.5 and 5 mg/mL. The batch fermentation was carried out under anaerobic conditions using oxyrase and CO2 flushing at 39 °C for 24 h with gentle stirring (100 rpm). Sampling (5 mL fermentation broth) was performed at 0 and 24 h in duplicate. After centrifuging at 12,000× g for 5 min, the resultant pellets were stored in −20 °C until further analysis. All experiments were repeated on three independent occasions (biological replicates n = 3).

2.3. Quantification of Bacterial Groups Using Quantitative Real Time Polymerase Chain Reaction (QPCR)

DNA extraction: Bacterial DNA was extracted using QIAamp Fast DNA stool mini kit (Qiagen, West Sussex, UK) according to the manufacturer’s instructions, and its quantity and quality was evaluated spectrophotometrically (Nanodrop, Thermo Fisher Scientific, Waltham, MA, USA).
Bacterial primers: The primers targeting the 16S rRNA gene of selected bacterial groups (total bacteria, lactobacilli and Bifidobacterium spp.) or the rplP gene (Enterobacteriaceae) are provided in Table 2. Primer design software, Primer3 (https://primer3.org/ (accessed on 26 June 2018)) and Primer Express™ (Applied Biosystems, Foster City, CA, USA) were used for larger amplicons (>150 bp) and smaller amplicons (<125 bp), respectively. Primer specificity was verified using Primer Basic Local Alignment Search Tool (Primer-BLAST), https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi, accessed on 26 June 2018.
Bacterial enumeration by QPCR: The quantification of the above-mentioned bacterial groups was carried out using QPCR with plasmid-based standard curves as described previously [37]. Briefly, Competent E. coli was transformed with a pCR4-TOPO™ TA vector containing each fragment of the targeted 16S rRNA genes for total bacteria, lactobacilli and Bifidobacterium spp. or the rplP gene for Enterobacteriaceae and the resistance to ampicillin gene using a TOPO™ TA Cloning™ Kit for Sequencing (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and stored in cryoprotective beads (TS/71-MX, Protect Multi-purpose, Technical Service Consultants Ltd., Lancashire, UK). Transformed E. coli was recultured in 200 mL LB Broth Base (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) containing ampicillin (100 µg/mL) at 37 °C for 18 h at 150 rpm. Plasmids were extracted on a large scale using the GenElute™ HP Plasmid Maxiprep kit, (Sigma-Aldrich, St. Louis, MO, USA), linearised using APA1 restriction enzyme (Promega, Madison, WI, USA) and purified using GenElute™ PCR Clean-Up kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturers’ instructions. Following quantification, the plasmid copy number/μL was determined using the URI Genomics & Sequencing Centre online tool (http://cels.uri.edu/gsc/cndna.htmL, accessed on 14 May 2019). For the QPCR, the final reaction volume (20 μL) included 3 μL template DNA, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 5 μL nuclease-free water and 10 μL of Fast SYBR® Green Master Mix (Applied Biosystems, Foster City, CA, USA) for the lactobacilli or GoTaq® qPCR Master Mix (Promega, Madison, WI, USA) for the remaining bacterial groups. All QPCR reactions were performed in duplicate on the ABI 7500 Fast PCR System (Applied Biosystems, Foster City, CA, USA) using the following cycling conditions: a denaturation step (95 °C/10 min), 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Dissociation curve analysis and visualisation on a 2% agarose gel stained with ethidium bromide were used to confirm the production of single and specific PCR products. All PCR reactions used in this study exhibited 90–110% efficiency established by plotting the threshold cycles (Ct) derived from the 5-fold serial dilutions of each plasmid against their arbitrary quantities. Bacterial counts were determined using the standard curve derived from the mean Ct value and the log-transformed gene copy number of the respective plasmid and expressed as log-transformed gene copy number per gram of digesta (logGCN/g digesta).
Table
Table 2. List of forward and reverse primers used for the bacterial quantification by QPCR.
Table 2. List of forward and reverse primers used for the bacterial quantification by QPCR.
Target Bacterial GroupForward Primer (5′–3′)
Reverse Primer (5′–3′)		Amplicon Length (bp) Tm (°C)References
Total bacteriaF: GTGCCAGCMGCCGCGGTAA
R: GACTACCAGGGTATCTAAT		29164.2
52.4		[38]
LactobacilliF: AGCAGTAGGGAATCTTCCA
R: CACCGCTACACATGGAG		34154.5
55.2		[39]
Bifidobacterium spp.F: GCGTGCTTAACACATGCAAGTC
R: CACCCGTTTCCAGGAGCTATT		12560.3
59.8		[40]
EnterobacteriaceaeF: ATGTTACAACCAAAGCGTACA
R: TTACCYTGACGCTTAACTGC		18554.0
56.3		[41]
bp, base pairs; Tm, melting temperature.

2.4. Bacterial Strains and Pure-Culture Growth Assays

Pure-culture growth assays using a panel of commensal strains Lactiplantibacillus plantarum subsp. plantarum (formerly Lactobacillus plantarum, DSMZ 20174), Limosilactobacillus reuteri (formerly Lactobacillus reuteri, DSMZ 20016) and Bifidobacterium thermophilum (DSMZ 20210) and pathogens S. typhimurium PT12 and enterotoxigenic E. coli (ETEC) O149A+ selected for their beneficial roles and negative impacts on pig and human health, respectively, were carried out as described in our previous work [37]. Briefly, 24 h cultures of all bacterial strains were prepared using standard procedures and diluted in 10% medium: 10% de Man, Rogosa and Sharpe broth (MRS, Oxoid Ltd., Hampshire, UK) for L. plantarum, L. reuteri and B. thermophilum cultures; or 10% Tryptone Soya Broth (TSB, Oxoid Ltd., Hampshire, UK) for S. typhimurium and ETEC cultures, to obtain an inoculum of 106–107 CFU (colony-forming unit)/mL (verified for each assay). Two-fold dilutions (2–0.125 mg/mL) of LDE1–4 and LHE1–4 were performed in 10% MRS and 10% TSB prior to each assay from a working concentration of 4 mg/mL. 100 μL of each extract and each dilution and 100 μL of inoculum were added to duplicate wells of 96-well microtiter plates (CELLSTAR, Greiner Bio-One, Kremsmünster, Austria). Control wells were also included (bacterial inoculum only). Assay sterility was assessed using blank wells (no bacterial inoculum) for each dilution of each extract. After gentle agitation to ensure thorough mixing, plates were incubated aerobically at 37 °C for 18 h, apart from B. thermophilum, which was incubated anaerobically. Afterwards, bacterial enumeration was carried out by 10-fold serial dilution (10−1–10−8), spread plating onto MRS agar (Oxoid Ltd., Hampshire, UK) for L. plantarum, L. reuteri and B. thermophilum, and Tryptone Soya Agar (Oxoid Ltd., Hampshire, UK) for ETEC and S. typhimurium, and incubation aerobically at 37 °C for 24 h or anaerobically at 37 °C for 48 h for B. thermophilum. The dilution resulting in 5–50 colonies was selected for the calculation of CFU/mL using the formula, CFU/mL = average colony number × 50 × dilution factor. The bacterial counts were logarithmically transformed (logCFU/mL) for the subsequent statistical analysis. All experiments were carried out with technical replicates on three independent occasions (3 biological replicates n).

2.5. Statistical Analysis

All data were statistically analysed using Statistical Analysis Software (SAS) 9.4 (SAS Institute, Cary, NC, USA). Normality tests were initially carried out using PROC UNIVARIATE procedure for each data set.
Batch fermentation assay: For each bacterial group and tested compound, the bacterial counts (n = 12, 3 flasks/each compound concentration) were analysed using PROC GLM procedure (Tukey’s test). The statistical model included the fixed effects of seaweed species (L. digitata, L. hyperborea), the season of collection (February, November), the concentration of whole biomass (0, 1, 2.5 and 5 mg/mL) and assay replicates (3 biological replicates) and their associated two- and three-way interactions with the bacterial counts at 0 h as a covariate.
Pure-culture growth assay: To control for the natural variability in bacterial growth in the pure-culture assays, bacterial counts were expressed as the difference between the counts of each bacterial strain for each extract concentration and their respective control (0 mg/mL). The resulting positive or negative values representing the difference in bacterial counts were analysed using PROC GLM procedure (Tukey’s test). The statistical model assessed the effects of seaweed species (L. digitata, L. hyperborea), extraction conditions (E1–4) and concentration of extracts (0.125, 0.25, 0.5, 1 and 2 mg/mL) and their associated two- and three-way interactions. The biological replicate was the experimental unit.
Probability values of < 0.05 denote statistical significance. Results are presented as least-square mean values ± standard error of the means (SEM).

3. Results

3.1. Proximate Composition of L. digitata and L. hyperborea, and Laminarin and Fucoidan Content of Their Extracts

The proximate composition of the whole seaweed biomass samples LDWB-F, LHWB-F, LDWB-N and LHWB-N is presented in Table 3, as reported previously [36].
The laminarin and fucoidan contents in the L. digitata (LDE1–4) and L. hyperborea (LHE1–4) extracts are presented in Table 4.

3.2. Effects of the Whole Biomass Samples of L. digitata and L. hyperborea on Selected Bacterial Populations

The effects of the whole biomass samples of L. digitata and L. hyperborea collected in February (LDWB-F and LHWB-F) and November (LDWB-N and LHWB-N) were evaluated on selected faecal bacterial populations in a batch fermentation assay. The effects of species, season and concentration and their interactions are presented in Table 5 and Table 6 and are described below. The species × concentration interaction and the season × concentration interaction were only significant for Bifidobacterium spp. (p < 0.05) and, as a result, were excluded from the statistical analysis of the other bacterial groups.
Enterobacteriaceae: There was a species × season interaction whereby LHWB-F led to lower Enterobacteriaceae counts compared to LHWB-N, while the opposite was true for L. digitata (p < 0.05, Table 5). There was also a concentration effect on Enterobacteriaceae counts, whereby the 5 mg/mL reduced Enterobacteriaceae counts compared to the control (7.74 logGCN/g digesta (5 mg/mL) vs. 7.99 logGCN/g digesta (0 mg/mL) ± 0.056, p < 0.05).
Bifidobacterium spp.: There was a species × season interaction, whereby LHWB-N led to lower Bifidobacterium spp. counts compared to LHWB-F, while harvest season had no effect on Bifidobacterium spp. counts with regard to L. digitata (p > 0.05, Table 5). There was a species × concentration interaction, whereby the concentrations of 2.5 and 5 mg/mL of L. hyperborea led to lower Bifidobacterium spp. counts compared to the control and 1 mg/mL (2.73 logGCN/g digesta (2.5 mg/mL) and below the limits of detection (5 mg/mL) vs. 6.72 (0 mg/mL) and 6.60 (1 mg/mL) logGCN/g digesta ± 0.056, p < 0.05)), while this effect was not as potent with the corresponding L. digitata concentrations (5.95 logGCN/g digesta (5 mg/mL) vs. 6.46 (0 mg/mL), 6.55 (1 mg/mL) and 6.37 (2.5 mg/mL) logGCN/g digesta ± 0.056, p < 0.05)). There was a season × concentration interaction, whereby the 5 mg/mL of both February and November suppressed Bifidobacterium spp. counts, while at 2.5 mg/mL, there was a greater reduction in the counts in November relative to February (p < 0.05, Table 6).
Total bacteria: There was a species effect and a concentration effect on total bacterial counts. L. hyperborea increased total bacteria compared to L. digitata (9.83 logGCN/g digesta (L. hyperborea) vs. 9.72 logGCN/g digesta (L. digitata) ± 0.034, p < 0.05). The 1 and 2.5 mg/mL gave higher counts compared to the control (9.87 (1 mg/mL) and 9.87 (2.5 mg/mL) logGCN/g digesta vs. 9.64 logGCN/g digesta (0 mg/ mL) ± 0.048, p < 0.05).
Lactobacilli: There was a species effect and a concentration effect on lactobacilli counts. L. hyperborea increased lactobacilli counts compared to L. digitata (8.79 logGCN/g digesta (L. hyperborea) vs. 8.45 logGCN/g digesta (L. digitata) ± 0.030, p < 0.05). The concentrations of 1 and 2.5 mg/mL were associated with higher counts compared to the control (8.66 logGCN/g digesta (1 mg/mL) and 8.69 logGCN/g digesta (2.5 mg/mL) vs. 8.56 logGCN/g digesta (0 mg/mL) ± 0.035, p < 0.05).
In summary, whole seaweed biomass samples from L. hyperborea and L. digitata collected in February had the least negative impact on Bifidobacterium spp. counts. Furthermore, LHWB-F reduced Enterobacteriaceae counts to the greatest degree, while LDWB-F had no effect. Both LHWB-F and LDWB-F were selected to generate the extracts evaluated in the next part of the screening process to determine whether the extraction methodology could improve the bioactivity of two whole seaweed biomass samples with varying effects.

3.3. Identifying L. digitata and L. hyperborea Extracts with the Highest Antibacterial and Prebiotic Potential in Pure Bacterial Cultures

The HAE methodology with four different extraction conditions (E1–4) was employed for producing the extracts from the L. digitata (LD) and L. hyperborea (LH) samples, collected in February, to investigate whether the extraction method could improve their biological properties. LDE1–4 and LHE1–4 were evaluated for their antibacterial and prebiotic activities in pure-culture growth assays with selected beneficial (L. plantarum, L. reuteri, B. thermophilum) and pathogenic (ETEC, S. typhimurium) bacterial strains. Bacterial counts were expressed as the difference between the counts of each bacterial strain for each extract concentration and their respective control (0 mg/mL). The effects of species, extraction condition and concentration and their interactions are presented in Table 7 and Table 8 and are described below. The species × concentration interaction was significant only for S. typhimurium (p < 0.05) and was excluded from the statistical analysis of the other bacterial species.

3.3.1. The Effect of the Different Extraction Conditions on the Antibacterial and Prebiotic Effects of L. hyperborea and L. digitata Extracts

ETEC and S. typhimurium: There was a species × extraction condition interaction, whereby LHE1 had more potent antibacterial activity than LHE2, LHE3 and LHE4, whereas the effect of the E1 extraction condition was not as potent with L. digitata, despite being significant (p < 0.05, Table 7).
B. thermophilum: There was a species × extraction condition interaction, whereby LDE4 was more bifidogenic than LDE1, LDE2 and LDE3, whereas the effect of E4 extraction condition was not as evident with L. hyperborea, despite being significant compared with E1 and E2 (p < 0.05, Table 7).
L. plantarum: There was a species × extraction condition interaction, whereby LHE4 was more stimulating on L. plantarum growth than LHE1, LHE2 and LHE3 (p < 0.05) and there was no effect of the extraction condition on L. digitata (p > 0.05, Table 7).
L. reuteri: There was a species effect and an extraction condition effect on L. reuteri counts. LH extracts led to higher L. reuteri counts compared to LD extracts (0.24 logCFU/mL (LH extracts) vs. 0.16 logCFU/mL (LD extracts) ± 0.029, p < 0.05). The extraction conditions E1 and E2 increased L. reuteri counts compared to E3 (0.30 logCFU/mL (E1) and 0.27 logCFU/mL (E2) vs. 0.07 logCFU/mL (E3) ± 0.041, p < 0.05).

3.3.2. The Effect of Concentration on the Antibacterial and Prebiotic Activity of the Different Extraction Conditions

ETEC and S. typhimurium: There was a concentration × extraction condition interaction, whereby 2 mg/mL was more potent than 1, 0.5, 0.25 and 0.125 mg/mL for the E1 extraction condition (p < 0.05), whereas the effect of concentration was not as evident with E2, E3 and E4 extraction conditions (p > 0.05, Table 8). There was also a species × concentration interaction for S. typhimurium (p < 0.05), whereby the 2 mg/mL LH extracts led to lower counts compared to the 2 mg/mL LD extracts (−1.56 logCFU/mL (LH extracts) vs. −0.66 logCFU/mL (LD extracts) ± 0.058, p < 0.05), however, species had no effect at any of the other concentrations.
B. thermophilum: There was a concentration × extraction condition interaction, whereby all concentrations of E4 were more bifidogenic than the equivalent concentrations in E1, E2 and E3, where some of the concentrations had no effect, while some were antibacterial (p < 0.05, Table 8).
L. plantarum: There was a concentration effect on L. plantarum counts. The concentration of 1 and 2 mg/mL of all extracts increased L. plantarum counts compared to the 0.125 mg/mL (0.15 (1 mg/mL) and 0.15 (2 mg/mL) logCFU/mL vs. 0.02 logCFU/mL (0.125 mg/mL) ± 0.032, p < 0.05).
L. reuteri: There was a concentration effect on L. reuteri counts. The concentration of 2 mg/mL of all extracts increased L. reuteri counts compared to 0.125 mg/mL (0.34 logCFU/mL (2 mg/mL) vs. 0.10 logCFU/mL (0.125 mg/mL) ± 0.045, p < 0.05).

4. Discussion

The influence of seaweed species and harvest season on the effects of the whole biomass samples of L. hyperborea and L. digitata on selected bacterial markers of the porcine faecal microbiota were evaluated in a batch fermentation assay. In this study, seaweed species was the predominant factor affecting the growth of Bifidobacterium spp., Enterobacteriaceae, lactobacilli and total bacteria. Bifidobacterium spp. counts were also influenced by the harvest season. The February-harvested L. hyperborea biomass sample, LHWB-F, led to the lowest Enterobacteriaceae counts among all tested samples whilst also having a reduced negative impact on Bifidobacterium spp. compared to the November-harvested counterpart, LHWB-N. Contrarily, the February-harvested L. digitata biomass sample, LDWB-F, was the least promising in terms of its antibacterial properties, having no major effects on the tested bacterial groups. These two whole biomass seaweed samples were used to produce LHE1–4 and LDE1–4 using four extraction conditions (E1–4) of the HAE methodology. The extracts were assessed in a panel of pure-culture growth assays with selected beneficial and pathogenic bacterial strains, to evaluate whether the optimised extraction conditions could enhance their antibacterial and prebiotic activities. Regardless of the seaweed species, the extraction condition E1 was predominantly associated with improved antibacterial activity against S. typhimurium, ETEC and to a lesser extent B. thermophilum, while the E4 extraction condition was predominantly associated with bifidogenic activity.
Total bacteria, lactobacilli, Bifidobacterium spp. and Enterobacteriaceae were monitored in the batch fermentation assay as part of the evaluation of the whole biomass of L. digitata and L. hyperborea collected in February (LDWB-F and LHWB-F) and November (LDWB-N and LHWB-N). The whole biomass of L. hyperborea, LHWB-N and LHWB-F, reduced the Bifidobacterium spp. counts in a concentration-dependent manner with LHWB-F having a lesser impact. The whole biomass of L. digitata, LDWB-F and LDWB-N, also showed evidence of minor reductions in this bacterial population. In addition, LHWB-F and LDWB-N were associated with reduced Enterobacteriaceae counts. Reductions in Bifidobacterium spp. and Enterobacteriaceae counts have been previously observed in the faeces and colonic and caecal digesta in pigs supplemented with crude extracts of L. hyperborea, L. digitata or Laminaria spp. [23,24,25,26]. In this study, whole biomass samples of L. hyperborea were associated with minor increases in lactobacilli and total bacterial counts compared to whole biomass samples of L. digitata. Thus, bacterial growth was predominantly influenced by the seaweed species rather than harvest season, which only had a significant effect on the Bifidobacterium spp. population.
It is interesting to hypothesise what the bioactive components within the whole seaweed biomass samples could be based on their proximate composition analysis and the results of the batch fermentation assay. The whole biomass samples of L. hyperborea had higher total polysaccharide content compared to L. digitata for both months. The main polysaccharides present in L. digitata and L. hyperborea are laminarin, mannitol, alginate and cellulose, of which laminarin and mannitol have been reported to exhibit significant seasonal variation in their concentration [35]. This, along with the increase in total glucans (laminarin and cellulose combined) observed in November for both seaweed species in the current study suggests that the variation in the total carbohydrate content was due to laminarin. Fucoidan was confirmed to be a relatively minor polysaccharide in the whole biomass samples of L. digitata and L. hyperborea as expected for the Laminaria spp. [42] and increased in November in both seaweed species. Previous research has reported that laminarin reduced the Enterobacteriaceae counts in the caecum and increased lactobacilli counts in the faeces and colon of weaned pigs [22,27,43], while fucoidan from whole A. nodosum biomass samples was considered to be the bioactive reducing Bifidobacterium spp. and Enterobacteriaceae counts in a batch fermentation assay inoculated with faeces from weaned pigs [18]. The reduction in Bifidobacterium spp. counts could additionally be attributed to inhibitory effects due to the wide-ranging components within the extracts, including phenols, alginate, cellulose and fucoidan, on the activity of bacterial carbohydrate-degrading enzymes [44,45,46]. As whole seaweed biomass samples are inherently complex, it is not possible to attribute the observed effects on the faecal microbiota to specific bioactive components within the whole biomass samples of L. hyperborea and L. digitata with certainty.
For the second part of the study, LHE1–4 and LDE1–4 were produced from LHWB-F and LDWB-F, respectively, using the HAE methodology with four extraction conditions (E1–4). Of these, LHWB-F was identified as the most promising antibacterial sample in the batch fermentation assay and was selected for further analysis. In parallel, LDWB-F was included to investigate whether the extraction protocol could improve its limited bioactivity, an effect that was demonstrated in a previous study [18]. LHE1–4 and LDE1–4 were evaluated for their antibacterial and prebiotic potential in a panel of pure-culture growth assays. The pathogens S. typhimurium and ETEC were selected as representatives of the Enterobacteriaceae family. While S. typhimurium infection in pigs is mostly asymptomatic, it is associated with intestinal inflammation and compositional changes in the gastrointestinal microbiota that can have a negative impact on animal health and performance [47,48,49]. Furthermore, pigs and their meat products can become a reservoir for S. typhimurium, which can impact on human health [50]. ETEC infection in newly weaned pigs contributes to the development of post-weaning diarrhoea, an economically significant disease characterised by diarrhoea, dehydration, stunted growth and significant mortality [51]. The effects of the L. hyperborea and L. digitata extracts on representative beneficial bacterial strains, B. thermophilum, L. plantarum and L. reuteri, were also evaluated. These bacterial species commonly colonise the porcine gastrointestinal tract and exert a range of beneficial roles such as inhibition of intestinal pathogens, immunomodulation, improved composition in the gastrointestinal microbiota and enhanced health and growth [52,53,54,55,56,57,58]. In the pure-culture growth assays, the E1 and E4 extraction conditions were predominantly associated with antibacterial and bifidogenic activities, respectively. LHE1 was the most potent extract in reducing S. typhimurium and ETEC counts. LDE1 also inhibited the growth of both pathogenic strains to a lesser extent. Additionally, LHE1 and LDE1 reduced B. thermophilum counts, whereas both extracts were also associated with a slight increase in L. reuteri counts. Interestingly, LDE4 followed by LHE4 increased B. thermophilum counts in a concentration-dependent manner, with LHE4 additionally stimulating the growth of L. plantarum. Based on the above, the use of the E1 and E4 extraction conditions of the HAE methodology produced antibacterial and bifidogenic extracts with the potential to promote a healthy composition in the gastrointestinal microbiota of pigs.
The laminarin and fucoidan contents of LHE1–4 and LDE1–4 were determined to establish the concentrations of these polysaccharides achieved by each combination of extraction conditions of the HAE methodology [17]. LHE1–4 extracts had higher concentrations of laminarin and fucoidan compared to LDE1–4, an expected outcome based on the proximate composition of the respective whole seaweed biomass. Interestingly, both sets of extracts had higher fucoidan content (12.76–14.68% for LHE1–4 and 3.84–5.80% for LDE1–4) than laminarin content (4.94–7.59% for LHE1–4 and ≤0.70% for LDE1–4). The presence of laminarin is reported to be at lower concentrations during the winter months in these seaweed species, in agreement with our observation [35,59]. Apart from laminarin and fucoidan, alginate is a polysaccharide which is present in high and relative stable concentrations throughout the year in both L. hyperborea and L. digitata [35], and could also be a significant component of the LHE1–4 and LDE1–4. While the alginate content of the tested extracts was not determined in the current study, this assumption is supported by the findings of a recent study evaluating an L. hyperborea extract produced using the E2 extraction conditions of HAE methodology [60]. Furthermore, the different extraction conditions (Table 1) could affect not only the content but also the structure of these seaweed polysaccharides in the produced extracts, and hence, their bioactivity. For instance, the use of HCl and increasing temperatures in the extraction protocol was previously associated with changes in the chemical composition (monosaccharide content, sulphation level) and lower molecular weight due to partial hydrolysis of fucoidan and partial depolymerisation of alginate [61,62,63].
Although we did not determine the antibacterial and bifidogenic components of the L. hyperborea and L. digitata E1 and E4 extracts, we hypothesise that fucoidan was likely the main bioactive, with the variation in bioactivities attributed to structural alterations due to the different extraction conditions (Table 1). Regarding the antibacterial activity, this assumption is supported by the following three facts: (1) LHE1 had both higher fucoidan content and stronger antibacterial activity against S. typhimurium and ETEC compared to LDE1, suggesting a connection between this bioactivity and fucoidan; (2) The fucoidan-rich A. nodosum extracts produced using the same E1 extraction protocol also led to significant reductions in S. typhimurium and ETEC counts in our previous studies [18,64]; (3) Depolymerised fucoidans from Laminaria spp., Sargassum spp. and Undaria spp. were reported to have improved antibacterial activity against various pathogenic strains including E. coli and S. typhimurium compared to the parent polysaccharide [65,66,67]. The antibacterial activity of LHE1 and LDE1 against B. thermophilum indicate that bioactives other than fucoidan are involved. The bifidogenic effect of LHE4 and LDE4 may also be attributed to the depolymerised fucoidan fraction due to the similar effects on Bifidobacterium spp. growth of the fucoidan-rich A. nodosum extract produced using the same E4 extraction protocol and depolymerised fucoidans of Laminaria spp. and Sargassum spp. in previous in vitro studies [18,68,69]. Alginate oligosaccharides have also exhibited a bifidogenic effect in pure-culture growth assays [70,71]. Therefore, depolymerised alginate may have contributed to the increases in B. thermophilum, particularly in the case of LDE4. The slight increases in L. plantarum and L. reuteri counts with LHE4 counts and E1-produced extracts, respectively, indicate limited ability of these bacterial strains to utilise seaweed polysaccharides, most likely laminarin [72] and alginate oligosaccharides [71]. Taken together, all of the above results suggest a strong indication that fucoidan is the candidate bioactive responsible for the antibacterial and bifidogenic activities, although other seaweed constituents such as alginate may also contribute to the latter in the E4-produced extracts, particularly LDE4. In future studies, investigation into the chemical composition of LHE1, LDE1, LHE4 and LDE4 would provide better insight into the prebiotic and antibacterial bioactive components of these extracts, which was not possible at the laboratory-scale production of the extracts during the development of the HAE methodology.

5. Conclusions

The species of seaweed was the main determinant of the growth of Bifidobacterium spp., Enterobacteriaceae and lactobacilli when whole seaweed biomass samples were tested in a porcine batch fermentation assay. Whole biomass samples of L. hyperborea (LHWB-F) and L. digitata (LDWB-F) harvested in February were then selected as the most and least promising sources, respectively, for the generation of antibacterial extracts, based on their effects on the Enterobacteriaceae counts in the batch fermentation assay. E1- and E4-produced extracts from both seaweed species were associated with antibacterial and bifidogenic activities, respectively, indicating that the extraction conditions were a more important determinant of bioactivity than seaweed species. Of these extracts, LHE1 was the most potent extract against S. typhimurium and ETEC, whereas LDE4 stimulated the growth of B. thermophilum to the greatest extent. Further compositional characterisation of these extracts is required to facilitate the identification and purification of the bioactive components involved in the observed bioactivities. Nevertheless. these crude extracts, particularly LHE1, merit further exploration in terms of their ability to promote a more beneficial microbiota and, thus, overall health and growth in weaned pigs, as a means of minimising the costs associated with the purification of the responsible bioactives from these extracts.

Author Contributions

Conceptualization, T.S. and J.V.O.; methodology, B.V., M.J.M., M.G.-V., G.R., M.T.R. and T.S.; formal analysis, B.V.; investigation, B.V., C.K. and M.G.-V.; data curation, B.V.; writing—original draft preparation, B.V.; writing—review and editing, B.V., T.S., J.V.O., M.G.-V., G.R., M.T.R., M.J.M. and C.K.; supervision, T.S. and J.V.O.; funding acquisition, T.S. and J.V.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Science Foundation Ireland (SFI), grant number 14/IA/2548.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data supporting the reported results are available in this article.

Acknowledgments

The authors acknowledge the contribution of the laboratory staff in Lyons Research Farm and the School of Veterinary Medicine at University College Dublin and thank Áine O’Doherty from the Pathology Division, Central Veterinary Research laboratory, DAFM-Laboratories Backweston, Co., Kildare, Ireland for kindly providing us with the ETEC O149 bacterial strain.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Lozupone, C.A.; Stombaugh, J.I.; Gordon, J.I.; Jansson, J.K.; Knight, R. Diversity, stability and resilience of the human gut microbiota. Nature 2012, 489, 220–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Belkaid, Y.; Hand, T.W. Role of the microbiota in immunity and inflammation. Cell 2014, 157, 121–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Rolhion, N.; Chassaing, B. When pathogenic bacteria meet the intestinal microbiota. Philos. Trans. R Soc. Lond B Biol. Sci. 2016, 371, 20150504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Rowland, I.; Gibson, G.; Heinken, A.; Scott, K.; Swann, J.; Thiele, I.; Tuohy, K. Gut microbiota functions: Metabolism of nutrients and other food components. Eur. J. Nutr. 2018, 57, 1–24. [Google Scholar] [CrossRef] [Green Version]
  5. DeGruttola, A.K.; Low, D.; Mizoguchi, A.; Mizoguchi, E. Current understanding of dysbiosis in disease in human and animal models. Inflamm. Bowel Dis. 2016, 22, 1137–1150. [Google Scholar] [CrossRef] [Green Version]
  6. Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef]
  7. Campbell, J.M.; Crenshaw, J.D.; Polo, J. The biological stress of early weaned piglets. J. Anim. Sci. Biotechnol. 2013, 4, 19. [Google Scholar] [CrossRef] [Green Version]
  8. Corino, C.; Modina, S.C.; Di Giancamillo, A.; Chiapparini, S.; Rossi, R. Seaweeds in Pig Nutrition. Animals 2019, 9, 1126. [Google Scholar] [CrossRef] [Green Version]
  9. Holdt, S.L.; Kraan, S. Bioactive compounds in seaweed: Functional food applications and legislation. J. Appl. Phycol. 2011, 23, 543–597. [Google Scholar] [CrossRef]
  10. Biancarosa, I.; Belghit, I.; Bruckner, C.G.; Liland, N.S.; Waagbo, R.; Amlund, H.; Heesch, S.; Lock, E.J. Chemical characterization of 21 species of marine macroalgae common in Norwegian waters: Benefits of and limitations to their potential use in food and feed. J. Sci. Food Agric. 2018, 98, 2035–2042. [Google Scholar] [CrossRef] [Green Version]
  11. de Jesus Raposo, M.F.; de Morais, A.M.; de Morais, R.M. Marine polysaccharides from algae with potential biomedical applications. Mar. Drugs 2015, 13, 2967–3028. [Google Scholar] [CrossRef] [Green Version]
  12. Cherry, P.; Yadav, S.; Strain, C.R.; Allsopp, P.J.; McSorley, E.M.; Ross, R.P.; Stanton, C. Prebiotics from seaweeds: An ocean of opportunity? Mar. Drugs 2019, 17, 327. [Google Scholar] [CrossRef] [Green Version]
  13. O’Sullivan, L.; Murphy, B.; McLoughlin, P.; Duggan, P.; Lawlor, P.G.; Hughes, H.; Gardiner, G.E. Prebiotics from marine macroalgae for human and animal health applications. Mar. Drugs 2010, 8, 2038–2064. [Google Scholar] [CrossRef] [Green Version]
  14. Perez, M.J.; Falque, E.; Dominguez, H. Antimicrobial action of compounds from marine seaweed. Mar. Drugs 2016, 14, 52. [Google Scholar] [CrossRef] [Green Version]
  15. Shannon, E.; Abu-Ghannam, N. Antibacterial derivatives of marine algae: An overview of pharmacological mechanisms and applications. Mar. Drugs 2016, 14, 81. [Google Scholar] [CrossRef]
  16. Garcia-Vaquero, M.; Rajauria, G.; O’Doherty, J.V.; Sweeney, T. Polysaccharides from macroalgae: Recent advances, innovative technologies and challenges in extraction and purification. Food Res. Int. 2017, 99, 1011–1020. [Google Scholar] [CrossRef] [Green Version]
  17. Garcia-Vaquero, M.; O’Doherty, J.V.; Tiwari, B.K.; Sweeney, T.; Rajauria, G. Enhancing the extraction of polysaccharides and antioxidants from macroalgae using sequential hydrothermal-assisted extraction followed by ultrasound and thermal technologies. Mar. Drugs 2019, 17, 457. [Google Scholar] [CrossRef] [Green Version]
  18. Venardou, B.; O’Doherty, J.V.; Garcia-Vaquero, M.; Kiely, C.; Rajauria, G.; McDonnell, M.J.; Ryan, M.T.; Sweeney, T. Evaluation of the Antibacterial and Prebiotic Potential of Ascophyllum nodosum and Its Extracts Using Selected Bacterial Members of the Pig Gastrointestinal Microbiota. Mar. Drugs 2022, 20, 41. [Google Scholar] [CrossRef]
  19. Sweeney, T.; Collins, C.B.; Reilly, P.; Pierce, K.M.; Ryan, M.; O’Doherty, J.V. Effect of purified beta-glucans derived from Laminaria digitata, Laminaria hyperborea and Saccharomyces cerevisiae on piglet performance, selected bacterial populations, volatile fatty acids and pro-inflammatory cytokines in the gastrointestinal tract of pigs. Br. J. Nutr. 2012, 108, 1226–1234. [Google Scholar] [CrossRef] [Green Version]
  20. Walsh, A.M.; Sweeney, T.; O’Shea, C.J.; Doyle, D.N.; O’Doherty, J.V. Effect of dietary laminarin and fucoidan on selected microbiota, intestinal morphology and immune status of the newly weaned pig. Br. J. Nutr 2013, 110, 1630–1638. [Google Scholar] [CrossRef] [Green Version]
  21. Moroney, N.C.; O’Grady, M.N.; Robertson, R.C.; Stanton, C.; O’Doherty, J.V.; Kerry, J.P. Influence of level and duration of feeding polysaccharide (laminarin and fucoidan) extracts from brown seaweed (Laminaria digitata) on quality indices of fresh pork. Meat Sci. 2015, 99, 132–141. [Google Scholar] [CrossRef] [PubMed]
  22. Rattigan, R.; Sweeney, T.; Maher, S.; Thornton, K.; Rajauria, G.; O’Doherty, J.V. Laminarin-rich extract improves growth performance, small intestinal morphology, gene expression of nutrient transporters and the large intestinal microbial composition of piglets during the critical post-weaning period. Br. J. Nutr. 2020, 123, 255–263. [Google Scholar] [CrossRef] [PubMed]
  23. Reilly, P.; O’Doherty, J.V.; Pierce, K.M.; Callan, J.J.; O’Sullivan, J.T.; Sweeney, T. The effects of seaweed extract inclusion on gut morphology, selected intestinal microbiota, nutrient digestibility, volatile fatty acid concentrations and the immune status of the weaned pig. Animal 2008, 2, 1465–1473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Lynch, M.B.; Sweeney, T.; Callan, J.J.; O’Sullivan, J.T.; O’Doherty, J.V. The effect of dietary Laminaria-derived laminarin and fucoidan on nutrient digestibility, nitrogen utilisation, intestinal microflora and volatile fatty acid concentration in pigs. J. Sci. Food Agric. 2010, 90, 430–437. [Google Scholar] [CrossRef] [PubMed]
  25. O’Doherty, J.V.; Dillon, S.; Figat, S.; Callan, J.J.; Sweeney, T. The effects of lactose inclusion and seaweed extract derived from Laminaria spp. on performance, digestibility of diet components and microbial populations in newly weaned pigs. Anim. Feed Sci. Technol. 2010, 157, 173–180. [Google Scholar] [CrossRef]
  26. Leonard, S.G.; Sweeney, T.; Bahar, B.; Lynch, B.P.; O’Doherty, J.V. Effects of dietary seaweed extract supplementation in sows and post-weaned pigs on performance, intestinal morphology, intestinal microflora and immune status. Br. J. Nutr. 2011, 106, 688–699. [Google Scholar] [CrossRef] [Green Version]
  27. Vigors, S.; O’Doherty, J.V.; Rattigan, R.; McDonnell, M.J.; Rajauria, G.; Sweeney, T. Effect of a laminarin rich macroalgal extract on the caecal and colonic microbiota in the post-weaned pig. Mar. Drugs 2020, 18, 157. [Google Scholar] [CrossRef] [Green Version]
  28. Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Fitzpatrick, E.S.; Fanning, S.; Hartigan, P.J. Veterinary Microbiology and Microbial Disease, 2nd ed.; Wiley-Blackwell: Chichester, UK, 2011. [Google Scholar]
  29. Heredia, N.; Garcia, S. Animals as sources of food-borne pathogens: A review. Anim. Nutr. 2018, 4, 250–255. [Google Scholar] [CrossRef]
  30. Dou, S.; Gadonna-Widehem, P.; Rome, V.; Hamoudi, D.; Rhazi, L.; Lakhal, L.; Larcher, T.; Bahi-Jaber, N.; Pinon-Quintana, A.; Guyonvarch, A.; et al. Characterisation of early-life fecal microbiota in susceptible and healthy pigs to post-weaning diarrhoea. PLoS ONE 2017, 12, e0169851. [Google Scholar] [CrossRef] [Green Version]
  31. Lebeer, S.; Vanderleyden, J.; De Keersmaecker, S.C. Genes and molecules of lactobacilli supporting probiotic action. Microbiol. Mol. Biol. Rev. 2008, 72, 728–764. [Google Scholar] [CrossRef] [Green Version]
  32. Valeriano, V.D.; Balolong, M.P.; Kang, D.K. Probiotic roles of Lactobacillus sp. in swine: Insights from gut microbiota. J. Appl. Microbiol. 2017, 122, 554–567. [Google Scholar] [CrossRef] [Green Version]
  33. Liao, S.F.; Nyachoti, M. Using probiotics to improve swine gut health and nutrient utilization. Anim. Nutr. 2017, 3, 331–343. [Google Scholar] [CrossRef]
  34. Mikkelsen, L.L.; Bendixen, C.; Jakobsen, M.; Jensen, B.B. Enumeration of bifidobacteria in gastrointestinal samples from piglets. Appl. Environ. Microbiol. 2003, 69, 654–658. [Google Scholar] [CrossRef] [Green Version]
  35. Schiener, P.; Black, K.D.; Stanley, M.S.; Green, D.H. The seasonal variation in the chemical composition of the kelp species Laminaria digitata, Laminaria hyperborea, Saccharina latissima and Alaria esculenta. J. Appl. Phycol. 2015, 27, 363–373. [Google Scholar] [CrossRef]
  36. Garcia-Vaquero, M.; Rajauria, G.; Miranda, M.; Sweeney, T.; Lopez-Alonso, M.; O’Doherty, J. Seasonal Variation of the Proximate Composition, Mineral Content, Fatty Acid Profiles and Other Phytochemical Constituents of Selected Brown Macroalgae. Mar. Drugs 2021, 19, 204. [Google Scholar] [CrossRef]
  37. Venardou, B.; O’Doherty, J.V.; McDonnell, M.J.; Mukhopadhya, A.; Kiely, C.; Ryan, M.T.; Sweeney, T. Evaluation of the in vitro effects of the increasing inclusion levels of yeast beta-glucan, a casein hydrolysate and its 5 kDa retentate on selected bacterial populations and strains commonly found in the gastrointestinal tract of pigs. Food Funct. 2021, 12, 2189–2200. [Google Scholar] [CrossRef]
  38. Frank, D.N.; St. Amand, A.L.; Feldman, R.A.; Boedeker, E.C.; Harpaz, N.; Pace, N.R. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. PNAS 2007, 104, 13780. [Google Scholar] [CrossRef] [Green Version]
  39. Metzler-Zebeli, B.U.; Hooda, S.; Pieper, R.; Zijlstra, R.T.; van Kessel, A.G.; Mosenthin, R.; Ganzle, M.G. Nonstarch polysaccharides modulate bacterial microbiota, pathways for butyrate production, and abundance of pathogenic Escherichia coli in the pig gastrointestinal tract. Appl. Environ. Microbiol. 2010, 76, 3692–3701. [Google Scholar] [CrossRef] [Green Version]
  40. Penders, J.; Vink, C.; Driessen, C.; London, N.; Thijs, C.; Stobberingh, E.E. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol. Lett. 2005, 243, 141–147. [Google Scholar] [CrossRef] [Green Version]
  41. Takahashi, H.; Saito, R.; Miya, S.; Tanaka, Y.; Miyamura, N.; Kuda, T.; Kimura, B. Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae. Int. J. Food Microbiol. 2017, 246, 92–97. [Google Scholar] [CrossRef]
  42. MacArtain, P.; Gill, C.I.; Brooks, M.; Campbell, R.; Rowland, I.R. Nutritional value of edible seaweeds. Nutr. Rev. 2007, 65, 535–543. [Google Scholar] [CrossRef]
  43. Heim, G.; Walsh, A.M.; Sweeney, T.; Doyle, D.N.; O’Shea, C.J.; Ryan, M.T.; O’Doherty, J.V. Effect of seaweed-derived laminarin and fucoidan and zinc oxide on gut morphology, nutrient transporters, nutrient digestibility, growth performance and selected microbial populations in weaned pigs. Br. J. Nutr. 2014, 111, 1577–1585. [Google Scholar] [CrossRef]
  44. Kim, K.T.; Rioux, L.E.; Turgeon, S.L. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum. Phytochemistry 2014, 98, 27–33. [Google Scholar] [CrossRef] [PubMed]
  45. Dhital, S.; Gidley, M.J.; Warren, F.J. Inhibition of alpha-amylase activity by cellulose: Kinetic analysis and nutritional implications. Carbohydr. Polym. 2015, 123, 305–312. [Google Scholar] [CrossRef] [PubMed]
  46. Zaharudin, N.; Salmean, A.A.; Dragsted, L.O. Inhibitory effects of edible seaweeds, polyphenolics and alginates on the activities of porcine pancreatic alpha-amylase. Food Chem. 2018, 245, 1196–1203. [Google Scholar] [CrossRef] [PubMed]
  47. Farzan, A.; Friendship, R.M. A clinical field trial to evaluate the efficacy of vaccination in controlling Salmonella infection and the association of Salmonella-shedding and weight gain in pigs. Can. J. Vet. Res. 2010, 74, 258–263. [Google Scholar] [PubMed]
  48. Bearson, S.M.; Allen, H.K.; Bearson, B.L.; Looft, T.; Brunelle, B.W.; Kich, J.D.; Tuggle, C.K.; Bayles, D.O.; Alt, D.; Levine, U.Y.; et al. Profiling the gastrointestinal microbiota in response to Salmonella: Low versus high Salmonella shedding in the natural porcine host. Infect. Genet. Evol. 2013, 16, 330–340. [Google Scholar] [CrossRef]
  49. Drumo, R.; Pesciaroli, M.; Ruggeri, J.; Tarantino, M.; Chirullo, B.; Pistoia, C.; Petrucci, P.; Martinelli, N.; Moscati, L.; Manuali, E.; et al. Salmonella enterica serovar Typhimurium exploits inflammation to modify swine intestinal microbiota. Front. Cell Infect. Microbiol. 2015, 5, 106. [Google Scholar] [CrossRef] [Green Version]
  50. Ferrari, R.G.; Rosario, D.K.A.; Cunha-Neto, A.; Mano, S.B.; Figueiredo, E.E.S.; Conte-Junior, C.A. Worldwide epidemiology of Salmonella serovars in animal-based foods: A meta-analysis. Appl. Environ. Microbiol. 2019, 85, e00591-19. [Google Scholar] [CrossRef] [Green Version]
  51. Rhouma, M.; Fairbrother, J.M.; Beaudry, F.; Letellier, A. Post weaning diarrhea in pigs: Risk factors and non-colistin-based control strategies. Acta Vet. Scand. 2017, 59, 31. [Google Scholar] [CrossRef] [Green Version]
  52. De Angelis, M.; Siragusa, S.; Berloco, M.; Caputo, L.; Settanni, L.; Alfonsi, G.; Amerio, M.; Grandi, A.; Ragni, A.; Gobbetti, M. Selection of potential probiotic lactobacilli from pig feces to be used as additives in pelleted feeding. Res. Microbiol. 2006, 157, 792–801. [Google Scholar] [CrossRef]
  53. Klose, V.; Bayer, K.; Bruckbeck, R.; Schatzmayr, G.; Loibner, A.P. In vitro antagonistic activities of animal intestinal strains against swine-associated pathogens. Vet. Microbiol. 2010, 144, 515–521. [Google Scholar] [CrossRef]
  54. Lee, J.S.; Awji, E.G.; Lee, S.J.; Tassew, D.D.; Park, Y.B.; Park, K.S.; Kim, M.K.; Kim, B.; Park, S.C. Effect of Lactobacillus plantarum CJLP243 on the growth performance and cytokine response of weaning pigs challenged with enterotoxigenic Escherichia coli1. J. Anim. Sci. 2012, 90, 3709–3717. [Google Scholar] [CrossRef] [Green Version]
  55. Tanner, S.A.; Chassard, C.; Zihler Berner, A.; Lacroix, C. Synergistic effects of Bifidobacterium thermophilum RBL67 and selected prebiotics on inhibition of Salmonella colonization in the swine proximal colon PolyFermS model. Gut Pathog. 2014, 6, 44. [Google Scholar] [CrossRef] [PubMed]
  56. Hou, C.; Liu, H.; Zhang, J.; Zhang, S.; Yang, F.; Zeng, X.; Thacker, P.A.; Zhang, G.; Qiao, S. Intestinal microbiota succession and immunomodulatory consequences after introduction of Lactobacillus reuteri I5007 in neonatal piglets. PLoS ONE 2015, 10, e0119505. [Google Scholar] [CrossRef] [Green Version]
  57. Hou, C.; Zeng, X.; Yang, F.; Liu, H.; Qiao, S. Study and use of the probiotic Lactobacillus reuteri in pigs: A review. J. Anim. Sci. Biotechnol. 2015, 6, 14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Gagnon, M.; Vimont, A.; Darveau, A.; Fliss, I.; Jean, J. Study of the ability of bifidobacteria of human origin to prevent and treat Rotavirus infection using colonic cell and mouse models. PLoS ONE 2016, 11, e0164512. [Google Scholar] [CrossRef] [Green Version]
  59. Adams, J.M.; Ross, A.B.; Anastasakis, K.; Hodgson, E.M.; Gallagher, J.A.; Jones, J.M.; Donnison, I.S. Seasonal variation in the chemical composition of the bioenergy feedstock Laminaria digitata for thermochemical conversion. Bioresour. Technol. 2011, 102, 226–234. [Google Scholar] [CrossRef]
  60. Rajauria, G.; Ravindran, R.; Garcia-Vaquero, M.; Rai, D.K.; Sweeney, T.; O’Doherty, J. Molecular characteristics and antioxidant activity of laminarin extracted from the seaweed species Laminaria hyperborea, using hydrothermal-assisted extraction and a multi-step purification procedure. Food Hydrocoll. 2021, 112, 106332. [Google Scholar] [CrossRef]
  61. Yuan, Y.; Macquarrie, D. Microwave assisted extraction of sulfated polysaccharides (fucoidan) from Ascophyllum nodosum and its antioxidant activity. Carbohydr. Polym. 2015, 129, 101–107. [Google Scholar] [CrossRef]
  62. Yuan, Y.; Macquarrie, D.J. Microwave assisted step-by-step process for the production of fucoidan, alginate sodium, sugars and biochar from Ascophyllum nodosum through a biorefinery concept. Bioresour. Technol. 2015, 198, 819–827. [Google Scholar] [CrossRef] [PubMed]
  63. Liu, J.; Yang, S.; Li, X.; Yan, Q.; Reaney, M.J.T.; Jiang, Z. Alginate oligosaccharides: Production, biological activities, and potential applications. Compr. Rev. Food Sci. Food Saf. 2019, 18, 1859–1881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Venardou, B.; O’Doherty, J.V.; Maher, S.; Ryan, M.T.; Gath, V.; Ravindran, R.; Kiely, C.; Rajauria, G.; Garcia-Vaquero, M.; Sweeney, T. Potential of a fucoidan-rich Ascophyllum nodosum extract to reduce Salmonella shedding and improve gastrointestinal health in weaned pigs naturally infected with Salmonella. J. Anim. Sci. Biotechnol. 2022, 13, 39. [Google Scholar] [CrossRef] [PubMed]
  65. Liu, M.; Liu, Y.; Cao, M.J.; Liu, G.M.; Chen, Q.; Sun, L.; Chen, H. Antibacterial activity and mechanisms of depolymerized fucoidans isolated from Laminaria japonica. Carbohydr. Polym. 2017, 172, 294–305. [Google Scholar] [CrossRef] [PubMed]
  66. Saravana, P.S.; Cho, Y.N.; Patil, M.P.; Cho, Y.J.; Kim, G.D.; Park, Y.B.; Woo, H.C.; Chun, B.S. Hydrothermal degradation of seaweed polysaccharide: Characterization and biological activities. Food Chem. 2018, 268, 179–187. [Google Scholar] [CrossRef] [PubMed]
  67. Palanisamy, S.; Vinosha, M.; Rajasekar, P.; Anjali, R.; Sathiyaraj, G.; Marudhupandi, T.; Selvam, S.; Prabhu, N.M.; You, S. Antibacterial efficacy of a fucoidan fraction (Fu-F2) extracted from Sargassum polycystum. Int. J. Biol. Macromol. 2019, 125, 485–495. [Google Scholar] [CrossRef]
  68. Hwang, P.A.; Phan, N.N.; Lu, W.J.; Ngoc Hieu, B.T.; Lin, Y.C. Low-molecular-weight fucoidan and high-stability fucoxanthin from brown seaweed exert prebiotics and anti-inflammatory activities in Caco-2 cells. Food Nutr. Res. 2016, 60, 32033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Kong, Q.; Dong, S.; Gao, J.; Jiang, C. In vitro fermentation of sulfated polysaccharides from E. prolifera and L. japonica by human fecal microbiota. Int. J. Biol. Macromol. 2016, 91, 867–871. [Google Scholar] [CrossRef]
  70. Akiyama, H.; Endo, T.; Nakakita, R.; Murata, K.; Yonemoto, Y.; Okayama, K. Effect of depolymerized alginates on the growth of bifidobacteria. Biosci. Biotechnol. Biochem. 1992, 56, 355–356. [Google Scholar] [CrossRef]
  71. Wang, Y.; Han, F.; Hu, B.; Li, J.; Yu, W. In vivo prebiotic properties of alginate oligosaccharides prepared through enzymatic hydrolysis of alginate. Nutr. Res. 2006, 26, 597–603. [Google Scholar] [CrossRef]
  72. Seong, H.; Bae, J.-H.; Seo, J.S.; Kim, S.-A.; Kim, T.-J.; Han, N.S. Comparative analysis of prebiotic effects of seaweed polysaccharides laminaran, porphyran, and ulvan using in vitro human fecal fermentation. J. Funct. Foods 2019, 57, 408–416. [Google Scholar] [CrossRef]
Table
Table 1. Extraction conditions employed to obtain the different L. digitata and L. hyperborea extracts.
Table 1. Extraction conditions employed to obtain the different L. digitata and L. hyperborea extracts.
Laminaria spp. ExtractExtraction Method *Solvent *Extraction Conditions *Optimised for Targeted
Bioactives
LDE1
LHE1		HAE0.1 M HCl120 °C
62.1 min
30 mL solvent/g seaweed		Fucoidan
LDE2
LHE2		HAE0.1 M HCl99.3 °C
30 min
21.3 mL solvent/g seaweed		Laminarin
LDE3
LHE3		HAE0.1 M HCl120 °C
76.06 min
10 mL solvent/g seaweed		Antioxidant activity
LDE4
LHE4		HAE0.1 M HCl120 °C
80.9 min
12.02 mL solvent/g seaweed		For laminarin, fucoidan and antioxidant activity
* Extraction methods and conditions used to produce L. digitata and L. hyperborea extracts as described by Garcia-Vaquero et al. [17]. LDE1–4, L. digitata extract 1–4; LHE1–4, L. hyperborea extract 1–4; HAE, hydrothermal-assisted extraction.
Table
Table 3. Proximate composition (dry matter, ash, protein, crude lipids, total glucans, fucose and phenols) of whole L. digitata and L. hyperborea biomass (data published in [36]).
Table 3. Proximate composition (dry matter, ash, protein, crude lipids, total glucans, fucose and phenols) of whole L. digitata and L. hyperborea biomass (data published in [36]).
Proximate Composition *Whole L. digitata BiomassWhole L. hyperborea Biomass
LDWB-FLDWB-NLHWB-FLHWB-N
Dry matter (%)91.39 ± 0.0195.93 ± 0.0190.83 ± 0.0095.75 ± 0.02
Ash (% DW basis)34.84 ± 0.0821.82 ± 0.0030.01 ± 0.0318.91 ± 0.16
Protein (% DW basis)11.12 ± 0.764.01 ± 0.049.98 ± 0.013.57 ± 0.00
Ether extract (% DW basis)0.26 ± 0.051.12 ± 0.050.76 ± 0.070.69 ± 0.06
Total soluble sugars (% DW basis)11.88 ± 0.1320.39 ± 0.5614.49 ± 0.1126.69 ± 0.05
Total glucans (% DW basis)1.51 ± 0.0217.68 ± 0.096.40 ± 0.0925.70 ± 0.10
Fucose (% DW basis)0.77 ± 0.094.83 ± 0.152.66 ± 0.034.86 ± 0.05
Total phenolic content (% DW basis)0.06 ± 0.000.05 ± 0.000.06 ± 0.000.10 ±0.00
* Results are expressed as mean values ± standard deviation of the mean. DW, Dry weight.
Table
Table 4. Laminarin and fucoidan content of L. digitata and L. hyperborea extracts.
Table 4. Laminarin and fucoidan content of L. digitata and L. hyperborea extracts.
Laminaria spp. ExtractLaminarin (mg Laminarin/100 mg Freeze-Dried Extract) *Fucoidan (mg Fucoidan/100 mg Freeze-Dried Extract) *
LDE10.52 ± 0.064.46 ± 0.03
LDE20.70 ± 0.073.84 ± 0.06
LDE30.44 ± 0.035.80 ± 0.05
LDE40.67 ± 0.085.74 ± 0.05
LHE14.94 ± 0.2014.41 ± 0.46
LHE27.59 ± 0.0212.76 ± 0.34
LHE36.17 ± 0.0314.53 ± 0.12
LHE46.19 ± 0.0314.68 ± 0.37
* Results are expressed as mean values ± standard deviation of the mean. LD1–4, L. digitata extract 1–4; LH1–4, L. hyperborea extract 1–4.
Table
Table 5. Effects of seaweed species and harvest season on the selected bacterial populations of the faecal microbiota in the batch fermentation assay (least-square means and standard error of the means).
Table 5. Effects of seaweed species and harvest season on the selected bacterial populations of the faecal microbiota in the batch fermentation assay (least-square means and standard error of the means).
Bacterial Group
(logGCN/g Faeces)		Whole Seaweed Biomass samplesSEMp-Value
LDWB-F *LDWB-N *LHWB-F *LHWB-N *SpeciesSeasonSpecies × Season
Total bacteria9.759.699.769.890.0570.032NS0.058
Lactobacilli8.408.508.788.810.041<0.001NSNS
Bifidobacterium spp.6.31 c6.35 c4.69 b3.31 a0.044<0.001<0.001<0.001
Enterobacteriaceae8.13 b7.79 a7.68 a7.98 b0.0680.034NS<0.001
* Average of least-square mean values at 0, 1, 2.5 and 5 mg/mL. a,b,c Mean values within a row with different superscript letter were significantly different (p < 0.05). NS, not significant (p > 0.10); logGCN/g faeces, log-transformed gene copy number per gram of faeces; SEM, standard error of the means.
Table
Table 6. Effect of harvest season and seaweed concentration on the selected bacterial populations of the faecal microbiota in the batch fermentation assay (least-square means and standard error of the means).
Table 6. Effect of harvest season and seaweed concentration on the selected bacterial populations of the faecal microbiota in the batch fermentation assay (least-square means and standard error of the means).
Bacterial Group
(logGCN/g Faeces)		SeasonSEMp-Value
FebruaryNovember
Concentration (mg/mL)SeasonConcentrationSeason × Concentration
0 *1 *2.5 *5 *0 ‡1 ‡2.5 ‡5 ‡
Total bacteria9.559.869.909.729.739.879.849.710.073NS0.003NS
Lactobacilli8.508.678.688.538.628.668.698.640.052NS0.041NS
Bifidobacterium spp.6.53 d6.59 d5.95 c2.93 a6.64 d6.55 d3.15 b2.98 a0.056<0.001<0.001<0.001
Enterobacteriaceae7.978.037.907.728.017.907.897.750.085NS0.012NS
* Average of least-square mean values of LDWB-F and LHWB-F. ‡ Average of least-square mean values of LDWB-N and LHWB-N. a,b,c,d Mean values within a row with different superscript letter were significantly different (p < 0.05). NS, not significant (p > 0.10); logGCN/g faeces, log-transformed gene copy number per gram of faeces; SEM, standard error of the means.
Table
Table 7. Effects of seaweed species and extraction conditions on the antibacterial and prebiotic potential of the L. digitata and L. hyperborea extracts in the pure-culture growth assays (least-square means and standard error of the means).
Table 7. Effects of seaweed species and extraction conditions on the antibacterial and prebiotic potential of the L. digitata and L. hyperborea extracts in the pure-culture growth assays (least-square means and standard error of the means).
Laminaria spp. ExtractBacterial Strain (logCFU Difference/mL) *
L. plantarum‡L. reuteri‡B. thermophilum‡ETEC ‡S. typhimurium ‡
LDE10.16 c0.28−0.21 a−0.45 b−0.18 b
LDE20.15 c0.250.09 b−0.08 c−0.01 c
LDE30.02 ab0.030.14 bc0.02 cd−0.07 bc
LDE40.05 bc0.080.89 e0.04 cd−0.03 c
LHE1−0.07 a0.32−0.28 a−1.02 a−1.14 a
LHE20.06 bc0.28−0.24 a0.01 cd−0.17 b
LHE30.07 bc0.100.30 cd0.26 e0.07 c
LHE40.28 d0.260.43 d0.09 d0.00 c
SEM0.0400.0580.0730.0550.052
p-value
SpeciesNS0.0480.001NS<0.001
Extraction
condition		0.013<0.001<0.001<0.001<0.001
Species ×
Extraction
condition		<0.001NS<0.001<0.001<0.001
* Bacterial counts are expressed as the difference between the counts of each bacterial strain for each LD/LH extract concentration and their respective control (0 mg/mL). Bacterial counts at 0 mg/mL were as follows: 7.92 ± 0.030 logCFU/mL for L. plantarum, 7.40 ± 0.040 logCFU/mL for L. reuteri, 6.49 ± 0.055 logCFU/mL for B. thermophilum, 8.46 ± 0.046 logCFU/mL for ETEC and 8.93 ± 0.086 logCFU/mL for S. typhimurium. ‡ Average of least-square mean values at 0.125, 0.25, 0.5, 1 and 2 mg/mL for each extract. a,b,c,d,e Mean values within a column with different superscript letter were significantly different (p < 0.05). LD1–4, L. digitata extract 1–4; LH1–4, L. hyperborea extract 1–4.; NS, not significant (p > 0.10); CFU, colony-forming unit; SEM, standard error of the means.
Table
Table 8. Effects of extraction conditions and increasing concentrations of L. digitata and L. hyperborea extracts on the counts of selected beneficial and pathogenic bacterial strains in the pure-culture growth assays (least-square means and standard error of the means).
Table 8. Effects of extraction conditions and increasing concentrations of L. digitata and L. hyperborea extracts on the counts of selected beneficial and pathogenic bacterial strains in the pure-culture growth assays (least-square means and standard error of the means).
Extraction ConditionLD/LH Extract Concentration (mg/mL)Bacterial Strains (logCFU Difference/mL) *
L. plantarum‡L. reuteri‡B. thermophilum‡ETEC ‡S. typhimurium ‡
E120.090.35−0.96 a−4.63 a−3.12 a
10.160.27−0.44 b0.17 cdef−0.14 d
0.5−0.030.34−0.04 cde0.27 def−0.07 de
0.250.040.360.15 efg0.36 f0.00 def
0.125−0.020.180.05 defg0.17 cdef0.03 def
E220.190.47−0.33 bc−0.25 b−0.78 b
10.120.340.12 defg−0.04 bc0.05 def
0.50.070.340.01 def0.05 cd0.09 ef
0.250.080.06−0.19 bcd0.00 c0.07 def
0.1250.050.140.03 defg0.06 cde0.11 ef
E320.190.240.33 fgh0.07 cde−0.48c
10.100.040.28 efgh0.29 ef0.10 ef
0.50.040.030.25 efgh0.19 cdef0.07 def
0.25−0.05−0.030.15 efg0.12 cdef0.17 f
0.125−0.050.050.08 defg0.03 cd0.14 ef
E420.150.320.87 j0.13 cdef−0.05 def
10.200.240.93 j0.10 cde0.00 def
0.50.200.180.67 ij0.04 cd−0.01 def
0.250.170.070.47 hi0.03 c0.03 def
0.1250.090.040.35 gh0.04 cd−0.04 def
SEM0.0640.0910.1150.0870.082
p-value
Concentration0.0120.0020.022<0.001<0.001
Extraction condition0.013<0.001<0.001<0.001<0.001
Concentration × Extraction conditionNSNS<0.001<0.001<0.001
* Bacterial counts are expressed as the difference between the counts of each bacterial strain for each LD/LH extract concentration and their respective control (0 mg/mL). Bacterial counts at 0 mg/mL were as follows: 7.92 ± 0.030 logCFU/mL for L. plantarum, 7.40 ± 0.040 logCFU/mL for L. reuteri, 6.49 ± 0.055 logCFU/mL for B. thermophilum, 8.46 ± 0.046 logCFU/mL for ETEC and 8.93 ± 0.086 logCFU/mL for S. typhimurium. ‡ Average of least-square mean values of LD and LH extracts for each extraction condition. a,b,c,d,e,f,g,h,i,j Mean values within a column with different superscript letter were significantly different (p < 0.05). LD, L. digitata; LH, L. hyperborea; NS, not significant (p > 0.10); CFU, colony-forming unit; SEM, standard error of the means.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Venardou, B.; O’Doherty, J.V.; Garcia-Vaquero, M.; Kiely, C.; Rajauria, G.; McDonnell, M.J.; Ryan, M.T.; Sweeney, T. In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs. Animals 2023, 13, 823. https://doi.org/10.3390/ani13050823

AMA Style

Venardou B, O’Doherty JV, Garcia-Vaquero M, Kiely C, Rajauria G, McDonnell MJ, Ryan MT, Sweeney T. In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs. Animals. 2023; 13(5):823. https://doi.org/10.3390/ani13050823

Chicago/Turabian Style

Venardou, Brigkita, John V. O’Doherty, Marco Garcia-Vaquero, Claire Kiely, Gaurav Rajauria, Mary J. McDonnell, Marion T. Ryan, and Torres Sweeney. 2023. "In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs" Animals 13, no. 5: 823. https://doi.org/10.3390/ani13050823

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop