In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Laminaria spp.: Whole Biomass Samples and Extracts
2.2. Batch Fermentation Assay
2.3. Quantification of Bacterial Groups Using Quantitative Real Time Polymerase Chain Reaction (QPCR)
Target Bacterial Group | Forward Primer (5′–3′) Reverse Primer (5′–3′) | Amplicon Length (bp) | Tm (°C) | References |
---|---|---|---|---|
Total bacteria | F: GTGCCAGCMGCCGCGGTAA R: GACTACCAGGGTATCTAAT | 291 | 64.2 52.4 | [38] |
Lactobacilli | F: AGCAGTAGGGAATCTTCCA R: CACCGCTACACATGGAG | 341 | 54.5 55.2 | [39] |
Bifidobacterium spp. | F: GCGTGCTTAACACATGCAAGTC R: CACCCGTTTCCAGGAGCTATT | 125 | 60.3 59.8 | [40] |
Enterobacteriaceae | F: ATGTTACAACCAAAGCGTACA R: TTACCYTGACGCTTAACTGC | 185 | 54.0 56.3 | [41] |
2.4. Bacterial Strains and Pure-Culture Growth Assays
2.5. Statistical Analysis
3. Results
3.1. Proximate Composition of L. digitata and L. hyperborea, and Laminarin and Fucoidan Content of Their Extracts
3.2. Effects of the Whole Biomass Samples of L. digitata and L. hyperborea on Selected Bacterial Populations
3.3. Identifying L. digitata and L. hyperborea Extracts with the Highest Antibacterial and Prebiotic Potential in Pure Bacterial Cultures
3.3.1. The Effect of the Different Extraction Conditions on the Antibacterial and Prebiotic Effects of L. hyperborea and L. digitata Extracts
3.3.2. The Effect of Concentration on the Antibacterial and Prebiotic Activity of the Different Extraction Conditions
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lozupone, C.A.; Stombaugh, J.I.; Gordon, J.I.; Jansson, J.K.; Knight, R. Diversity, stability and resilience of the human gut microbiota. Nature 2012, 489, 220–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belkaid, Y.; Hand, T.W. Role of the microbiota in immunity and inflammation. Cell 2014, 157, 121–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rolhion, N.; Chassaing, B. When pathogenic bacteria meet the intestinal microbiota. Philos. Trans. R Soc. Lond B Biol. Sci. 2016, 371, 20150504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rowland, I.; Gibson, G.; Heinken, A.; Scott, K.; Swann, J.; Thiele, I.; Tuohy, K. Gut microbiota functions: Metabolism of nutrients and other food components. Eur. J. Nutr. 2018, 57, 1–24. [Google Scholar] [CrossRef] [Green Version]
- DeGruttola, A.K.; Low, D.; Mizoguchi, A.; Mizoguchi, E. Current understanding of dysbiosis in disease in human and animal models. Inflamm. Bowel Dis. 2016, 22, 1137–1150. [Google Scholar] [CrossRef] [Green Version]
- Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef]
- Campbell, J.M.; Crenshaw, J.D.; Polo, J. The biological stress of early weaned piglets. J. Anim. Sci. Biotechnol. 2013, 4, 19. [Google Scholar] [CrossRef] [Green Version]
- Corino, C.; Modina, S.C.; Di Giancamillo, A.; Chiapparini, S.; Rossi, R. Seaweeds in Pig Nutrition. Animals 2019, 9, 1126. [Google Scholar] [CrossRef] [Green Version]
- Holdt, S.L.; Kraan, S. Bioactive compounds in seaweed: Functional food applications and legislation. J. Appl. Phycol. 2011, 23, 543–597. [Google Scholar] [CrossRef]
- Biancarosa, I.; Belghit, I.; Bruckner, C.G.; Liland, N.S.; Waagbo, R.; Amlund, H.; Heesch, S.; Lock, E.J. Chemical characterization of 21 species of marine macroalgae common in Norwegian waters: Benefits of and limitations to their potential use in food and feed. J. Sci. Food Agric. 2018, 98, 2035–2042. [Google Scholar] [CrossRef] [Green Version]
- de Jesus Raposo, M.F.; de Morais, A.M.; de Morais, R.M. Marine polysaccharides from algae with potential biomedical applications. Mar. Drugs 2015, 13, 2967–3028. [Google Scholar] [CrossRef] [Green Version]
- Cherry, P.; Yadav, S.; Strain, C.R.; Allsopp, P.J.; McSorley, E.M.; Ross, R.P.; Stanton, C. Prebiotics from seaweeds: An ocean of opportunity? Mar. Drugs 2019, 17, 327. [Google Scholar] [CrossRef] [Green Version]
- O’Sullivan, L.; Murphy, B.; McLoughlin, P.; Duggan, P.; Lawlor, P.G.; Hughes, H.; Gardiner, G.E. Prebiotics from marine macroalgae for human and animal health applications. Mar. Drugs 2010, 8, 2038–2064. [Google Scholar] [CrossRef] [Green Version]
- Perez, M.J.; Falque, E.; Dominguez, H. Antimicrobial action of compounds from marine seaweed. Mar. Drugs 2016, 14, 52. [Google Scholar] [CrossRef] [Green Version]
- Shannon, E.; Abu-Ghannam, N. Antibacterial derivatives of marine algae: An overview of pharmacological mechanisms and applications. Mar. Drugs 2016, 14, 81. [Google Scholar] [CrossRef]
- Garcia-Vaquero, M.; Rajauria, G.; O’Doherty, J.V.; Sweeney, T. Polysaccharides from macroalgae: Recent advances, innovative technologies and challenges in extraction and purification. Food Res. Int. 2017, 99, 1011–1020. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Vaquero, M.; O’Doherty, J.V.; Tiwari, B.K.; Sweeney, T.; Rajauria, G. Enhancing the extraction of polysaccharides and antioxidants from macroalgae using sequential hydrothermal-assisted extraction followed by ultrasound and thermal technologies. Mar. Drugs 2019, 17, 457. [Google Scholar] [CrossRef] [Green Version]
- Venardou, B.; O’Doherty, J.V.; Garcia-Vaquero, M.; Kiely, C.; Rajauria, G.; McDonnell, M.J.; Ryan, M.T.; Sweeney, T. Evaluation of the Antibacterial and Prebiotic Potential of Ascophyllum nodosum and Its Extracts Using Selected Bacterial Members of the Pig Gastrointestinal Microbiota. Mar. Drugs 2022, 20, 41. [Google Scholar] [CrossRef]
- Sweeney, T.; Collins, C.B.; Reilly, P.; Pierce, K.M.; Ryan, M.; O’Doherty, J.V. Effect of purified beta-glucans derived from Laminaria digitata, Laminaria hyperborea and Saccharomyces cerevisiae on piglet performance, selected bacterial populations, volatile fatty acids and pro-inflammatory cytokines in the gastrointestinal tract of pigs. Br. J. Nutr. 2012, 108, 1226–1234. [Google Scholar] [CrossRef] [Green Version]
- Walsh, A.M.; Sweeney, T.; O’Shea, C.J.; Doyle, D.N.; O’Doherty, J.V. Effect of dietary laminarin and fucoidan on selected microbiota, intestinal morphology and immune status of the newly weaned pig. Br. J. Nutr 2013, 110, 1630–1638. [Google Scholar] [CrossRef] [Green Version]
- Moroney, N.C.; O’Grady, M.N.; Robertson, R.C.; Stanton, C.; O’Doherty, J.V.; Kerry, J.P. Influence of level and duration of feeding polysaccharide (laminarin and fucoidan) extracts from brown seaweed (Laminaria digitata) on quality indices of fresh pork. Meat Sci. 2015, 99, 132–141. [Google Scholar] [CrossRef] [PubMed]
- Rattigan, R.; Sweeney, T.; Maher, S.; Thornton, K.; Rajauria, G.; O’Doherty, J.V. Laminarin-rich extract improves growth performance, small intestinal morphology, gene expression of nutrient transporters and the large intestinal microbial composition of piglets during the critical post-weaning period. Br. J. Nutr. 2020, 123, 255–263. [Google Scholar] [CrossRef] [PubMed]
- Reilly, P.; O’Doherty, J.V.; Pierce, K.M.; Callan, J.J.; O’Sullivan, J.T.; Sweeney, T. The effects of seaweed extract inclusion on gut morphology, selected intestinal microbiota, nutrient digestibility, volatile fatty acid concentrations and the immune status of the weaned pig. Animal 2008, 2, 1465–1473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lynch, M.B.; Sweeney, T.; Callan, J.J.; O’Sullivan, J.T.; O’Doherty, J.V. The effect of dietary Laminaria-derived laminarin and fucoidan on nutrient digestibility, nitrogen utilisation, intestinal microflora and volatile fatty acid concentration in pigs. J. Sci. Food Agric. 2010, 90, 430–437. [Google Scholar] [CrossRef] [PubMed]
- O’Doherty, J.V.; Dillon, S.; Figat, S.; Callan, J.J.; Sweeney, T. The effects of lactose inclusion and seaweed extract derived from Laminaria spp. on performance, digestibility of diet components and microbial populations in newly weaned pigs. Anim. Feed Sci. Technol. 2010, 157, 173–180. [Google Scholar] [CrossRef]
- Leonard, S.G.; Sweeney, T.; Bahar, B.; Lynch, B.P.; O’Doherty, J.V. Effects of dietary seaweed extract supplementation in sows and post-weaned pigs on performance, intestinal morphology, intestinal microflora and immune status. Br. J. Nutr. 2011, 106, 688–699. [Google Scholar] [CrossRef] [Green Version]
- Vigors, S.; O’Doherty, J.V.; Rattigan, R.; McDonnell, M.J.; Rajauria, G.; Sweeney, T. Effect of a laminarin rich macroalgal extract on the caecal and colonic microbiota in the post-weaned pig. Mar. Drugs 2020, 18, 157. [Google Scholar] [CrossRef] [Green Version]
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Fitzpatrick, E.S.; Fanning, S.; Hartigan, P.J. Veterinary Microbiology and Microbial Disease, 2nd ed.; Wiley-Blackwell: Chichester, UK, 2011. [Google Scholar]
- Heredia, N.; Garcia, S. Animals as sources of food-borne pathogens: A review. Anim. Nutr. 2018, 4, 250–255. [Google Scholar] [CrossRef]
- Dou, S.; Gadonna-Widehem, P.; Rome, V.; Hamoudi, D.; Rhazi, L.; Lakhal, L.; Larcher, T.; Bahi-Jaber, N.; Pinon-Quintana, A.; Guyonvarch, A.; et al. Characterisation of early-life fecal microbiota in susceptible and healthy pigs to post-weaning diarrhoea. PLoS ONE 2017, 12, e0169851. [Google Scholar] [CrossRef] [Green Version]
- Lebeer, S.; Vanderleyden, J.; De Keersmaecker, S.C. Genes and molecules of lactobacilli supporting probiotic action. Microbiol. Mol. Biol. Rev. 2008, 72, 728–764. [Google Scholar] [CrossRef] [Green Version]
- Valeriano, V.D.; Balolong, M.P.; Kang, D.K. Probiotic roles of Lactobacillus sp. in swine: Insights from gut microbiota. J. Appl. Microbiol. 2017, 122, 554–567. [Google Scholar] [CrossRef] [Green Version]
- Liao, S.F.; Nyachoti, M. Using probiotics to improve swine gut health and nutrient utilization. Anim. Nutr. 2017, 3, 331–343. [Google Scholar] [CrossRef]
- Mikkelsen, L.L.; Bendixen, C.; Jakobsen, M.; Jensen, B.B. Enumeration of bifidobacteria in gastrointestinal samples from piglets. Appl. Environ. Microbiol. 2003, 69, 654–658. [Google Scholar] [CrossRef] [Green Version]
- Schiener, P.; Black, K.D.; Stanley, M.S.; Green, D.H. The seasonal variation in the chemical composition of the kelp species Laminaria digitata, Laminaria hyperborea, Saccharina latissima and Alaria esculenta. J. Appl. Phycol. 2015, 27, 363–373. [Google Scholar] [CrossRef]
- Garcia-Vaquero, M.; Rajauria, G.; Miranda, M.; Sweeney, T.; Lopez-Alonso, M.; O’Doherty, J. Seasonal Variation of the Proximate Composition, Mineral Content, Fatty Acid Profiles and Other Phytochemical Constituents of Selected Brown Macroalgae. Mar. Drugs 2021, 19, 204. [Google Scholar] [CrossRef]
- Venardou, B.; O’Doherty, J.V.; McDonnell, M.J.; Mukhopadhya, A.; Kiely, C.; Ryan, M.T.; Sweeney, T. Evaluation of the in vitro effects of the increasing inclusion levels of yeast beta-glucan, a casein hydrolysate and its 5 kDa retentate on selected bacterial populations and strains commonly found in the gastrointestinal tract of pigs. Food Funct. 2021, 12, 2189–2200. [Google Scholar] [CrossRef]
- Frank, D.N.; St. Amand, A.L.; Feldman, R.A.; Boedeker, E.C.; Harpaz, N.; Pace, N.R. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. PNAS 2007, 104, 13780. [Google Scholar] [CrossRef] [Green Version]
- Metzler-Zebeli, B.U.; Hooda, S.; Pieper, R.; Zijlstra, R.T.; van Kessel, A.G.; Mosenthin, R.; Ganzle, M.G. Nonstarch polysaccharides modulate bacterial microbiota, pathways for butyrate production, and abundance of pathogenic Escherichia coli in the pig gastrointestinal tract. Appl. Environ. Microbiol. 2010, 76, 3692–3701. [Google Scholar] [CrossRef] [Green Version]
- Penders, J.; Vink, C.; Driessen, C.; London, N.; Thijs, C.; Stobberingh, E.E. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol. Lett. 2005, 243, 141–147. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, H.; Saito, R.; Miya, S.; Tanaka, Y.; Miyamura, N.; Kuda, T.; Kimura, B. Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae. Int. J. Food Microbiol. 2017, 246, 92–97. [Google Scholar] [CrossRef]
- MacArtain, P.; Gill, C.I.; Brooks, M.; Campbell, R.; Rowland, I.R. Nutritional value of edible seaweeds. Nutr. Rev. 2007, 65, 535–543. [Google Scholar] [CrossRef]
- Heim, G.; Walsh, A.M.; Sweeney, T.; Doyle, D.N.; O’Shea, C.J.; Ryan, M.T.; O’Doherty, J.V. Effect of seaweed-derived laminarin and fucoidan and zinc oxide on gut morphology, nutrient transporters, nutrient digestibility, growth performance and selected microbial populations in weaned pigs. Br. J. Nutr. 2014, 111, 1577–1585. [Google Scholar] [CrossRef]
- Kim, K.T.; Rioux, L.E.; Turgeon, S.L. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum. Phytochemistry 2014, 98, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Dhital, S.; Gidley, M.J.; Warren, F.J. Inhibition of alpha-amylase activity by cellulose: Kinetic analysis and nutritional implications. Carbohydr. Polym. 2015, 123, 305–312. [Google Scholar] [CrossRef] [PubMed]
- Zaharudin, N.; Salmean, A.A.; Dragsted, L.O. Inhibitory effects of edible seaweeds, polyphenolics and alginates on the activities of porcine pancreatic alpha-amylase. Food Chem. 2018, 245, 1196–1203. [Google Scholar] [CrossRef] [PubMed]
- Farzan, A.; Friendship, R.M. A clinical field trial to evaluate the efficacy of vaccination in controlling Salmonella infection and the association of Salmonella-shedding and weight gain in pigs. Can. J. Vet. Res. 2010, 74, 258–263. [Google Scholar] [PubMed]
- Bearson, S.M.; Allen, H.K.; Bearson, B.L.; Looft, T.; Brunelle, B.W.; Kich, J.D.; Tuggle, C.K.; Bayles, D.O.; Alt, D.; Levine, U.Y.; et al. Profiling the gastrointestinal microbiota in response to Salmonella: Low versus high Salmonella shedding in the natural porcine host. Infect. Genet. Evol. 2013, 16, 330–340. [Google Scholar] [CrossRef]
- Drumo, R.; Pesciaroli, M.; Ruggeri, J.; Tarantino, M.; Chirullo, B.; Pistoia, C.; Petrucci, P.; Martinelli, N.; Moscati, L.; Manuali, E.; et al. Salmonella enterica serovar Typhimurium exploits inflammation to modify swine intestinal microbiota. Front. Cell Infect. Microbiol. 2015, 5, 106. [Google Scholar] [CrossRef] [Green Version]
- Ferrari, R.G.; Rosario, D.K.A.; Cunha-Neto, A.; Mano, S.B.; Figueiredo, E.E.S.; Conte-Junior, C.A. Worldwide epidemiology of Salmonella serovars in animal-based foods: A meta-analysis. Appl. Environ. Microbiol. 2019, 85, e00591-19. [Google Scholar] [CrossRef] [Green Version]
- Rhouma, M.; Fairbrother, J.M.; Beaudry, F.; Letellier, A. Post weaning diarrhea in pigs: Risk factors and non-colistin-based control strategies. Acta Vet. Scand. 2017, 59, 31. [Google Scholar] [CrossRef] [Green Version]
- De Angelis, M.; Siragusa, S.; Berloco, M.; Caputo, L.; Settanni, L.; Alfonsi, G.; Amerio, M.; Grandi, A.; Ragni, A.; Gobbetti, M. Selection of potential probiotic lactobacilli from pig feces to be used as additives in pelleted feeding. Res. Microbiol. 2006, 157, 792–801. [Google Scholar] [CrossRef]
- Klose, V.; Bayer, K.; Bruckbeck, R.; Schatzmayr, G.; Loibner, A.P. In vitro antagonistic activities of animal intestinal strains against swine-associated pathogens. Vet. Microbiol. 2010, 144, 515–521. [Google Scholar] [CrossRef]
- Lee, J.S.; Awji, E.G.; Lee, S.J.; Tassew, D.D.; Park, Y.B.; Park, K.S.; Kim, M.K.; Kim, B.; Park, S.C. Effect of Lactobacillus plantarum CJLP243 on the growth performance and cytokine response of weaning pigs challenged with enterotoxigenic Escherichia coli1. J. Anim. Sci. 2012, 90, 3709–3717. [Google Scholar] [CrossRef] [Green Version]
- Tanner, S.A.; Chassard, C.; Zihler Berner, A.; Lacroix, C. Synergistic effects of Bifidobacterium thermophilum RBL67 and selected prebiotics on inhibition of Salmonella colonization in the swine proximal colon PolyFermS model. Gut Pathog. 2014, 6, 44. [Google Scholar] [CrossRef] [PubMed]
- Hou, C.; Liu, H.; Zhang, J.; Zhang, S.; Yang, F.; Zeng, X.; Thacker, P.A.; Zhang, G.; Qiao, S. Intestinal microbiota succession and immunomodulatory consequences after introduction of Lactobacillus reuteri I5007 in neonatal piglets. PLoS ONE 2015, 10, e0119505. [Google Scholar] [CrossRef] [Green Version]
- Hou, C.; Zeng, X.; Yang, F.; Liu, H.; Qiao, S. Study and use of the probiotic Lactobacillus reuteri in pigs: A review. J. Anim. Sci. Biotechnol. 2015, 6, 14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gagnon, M.; Vimont, A.; Darveau, A.; Fliss, I.; Jean, J. Study of the ability of bifidobacteria of human origin to prevent and treat Rotavirus infection using colonic cell and mouse models. PLoS ONE 2016, 11, e0164512. [Google Scholar] [CrossRef] [Green Version]
- Adams, J.M.; Ross, A.B.; Anastasakis, K.; Hodgson, E.M.; Gallagher, J.A.; Jones, J.M.; Donnison, I.S. Seasonal variation in the chemical composition of the bioenergy feedstock Laminaria digitata for thermochemical conversion. Bioresour. Technol. 2011, 102, 226–234. [Google Scholar] [CrossRef]
- Rajauria, G.; Ravindran, R.; Garcia-Vaquero, M.; Rai, D.K.; Sweeney, T.; O’Doherty, J. Molecular characteristics and antioxidant activity of laminarin extracted from the seaweed species Laminaria hyperborea, using hydrothermal-assisted extraction and a multi-step purification procedure. Food Hydrocoll. 2021, 112, 106332. [Google Scholar] [CrossRef]
- Yuan, Y.; Macquarrie, D. Microwave assisted extraction of sulfated polysaccharides (fucoidan) from Ascophyllum nodosum and its antioxidant activity. Carbohydr. Polym. 2015, 129, 101–107. [Google Scholar] [CrossRef]
- Yuan, Y.; Macquarrie, D.J. Microwave assisted step-by-step process for the production of fucoidan, alginate sodium, sugars and biochar from Ascophyllum nodosum through a biorefinery concept. Bioresour. Technol. 2015, 198, 819–827. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Yang, S.; Li, X.; Yan, Q.; Reaney, M.J.T.; Jiang, Z. Alginate oligosaccharides: Production, biological activities, and potential applications. Compr. Rev. Food Sci. Food Saf. 2019, 18, 1859–1881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Venardou, B.; O’Doherty, J.V.; Maher, S.; Ryan, M.T.; Gath, V.; Ravindran, R.; Kiely, C.; Rajauria, G.; Garcia-Vaquero, M.; Sweeney, T. Potential of a fucoidan-rich Ascophyllum nodosum extract to reduce Salmonella shedding and improve gastrointestinal health in weaned pigs naturally infected with Salmonella. J. Anim. Sci. Biotechnol. 2022, 13, 39. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Liu, Y.; Cao, M.J.; Liu, G.M.; Chen, Q.; Sun, L.; Chen, H. Antibacterial activity and mechanisms of depolymerized fucoidans isolated from Laminaria japonica. Carbohydr. Polym. 2017, 172, 294–305. [Google Scholar] [CrossRef] [PubMed]
- Saravana, P.S.; Cho, Y.N.; Patil, M.P.; Cho, Y.J.; Kim, G.D.; Park, Y.B.; Woo, H.C.; Chun, B.S. Hydrothermal degradation of seaweed polysaccharide: Characterization and biological activities. Food Chem. 2018, 268, 179–187. [Google Scholar] [CrossRef] [PubMed]
- Palanisamy, S.; Vinosha, M.; Rajasekar, P.; Anjali, R.; Sathiyaraj, G.; Marudhupandi, T.; Selvam, S.; Prabhu, N.M.; You, S. Antibacterial efficacy of a fucoidan fraction (Fu-F2) extracted from Sargassum polycystum. Int. J. Biol. Macromol. 2019, 125, 485–495. [Google Scholar] [CrossRef]
- Hwang, P.A.; Phan, N.N.; Lu, W.J.; Ngoc Hieu, B.T.; Lin, Y.C. Low-molecular-weight fucoidan and high-stability fucoxanthin from brown seaweed exert prebiotics and anti-inflammatory activities in Caco-2 cells. Food Nutr. Res. 2016, 60, 32033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kong, Q.; Dong, S.; Gao, J.; Jiang, C. In vitro fermentation of sulfated polysaccharides from E. prolifera and L. japonica by human fecal microbiota. Int. J. Biol. Macromol. 2016, 91, 867–871. [Google Scholar] [CrossRef]
- Akiyama, H.; Endo, T.; Nakakita, R.; Murata, K.; Yonemoto, Y.; Okayama, K. Effect of depolymerized alginates on the growth of bifidobacteria. Biosci. Biotechnol. Biochem. 1992, 56, 355–356. [Google Scholar] [CrossRef]
- Wang, Y.; Han, F.; Hu, B.; Li, J.; Yu, W. In vivo prebiotic properties of alginate oligosaccharides prepared through enzymatic hydrolysis of alginate. Nutr. Res. 2006, 26, 597–603. [Google Scholar] [CrossRef]
- Seong, H.; Bae, J.-H.; Seo, J.S.; Kim, S.-A.; Kim, T.-J.; Han, N.S. Comparative analysis of prebiotic effects of seaweed polysaccharides laminaran, porphyran, and ulvan using in vitro human fecal fermentation. J. Funct. Foods 2019, 57, 408–416. [Google Scholar] [CrossRef]
Laminaria spp. Extract | Extraction Method * | Solvent * | Extraction Conditions * | Optimised for Targeted Bioactives |
---|---|---|---|---|
LDE1 LHE1 | HAE | 0.1 M HCl | 120 °C 62.1 min 30 mL solvent/g seaweed | Fucoidan |
LDE2 LHE2 | HAE | 0.1 M HCl | 99.3 °C 30 min 21.3 mL solvent/g seaweed | Laminarin |
LDE3 LHE3 | HAE | 0.1 M HCl | 120 °C 76.06 min 10 mL solvent/g seaweed | Antioxidant activity |
LDE4 LHE4 | HAE | 0.1 M HCl | 120 °C 80.9 min 12.02 mL solvent/g seaweed | For laminarin, fucoidan and antioxidant activity |
Proximate Composition * | Whole L. digitata Biomass | Whole L. hyperborea Biomass | ||
---|---|---|---|---|
LDWB-F | LDWB-N | LHWB-F | LHWB-N | |
Dry matter (%) | 91.39 ± 0.01 | 95.93 ± 0.01 | 90.83 ± 0.00 | 95.75 ± 0.02 |
Ash (% DW basis) | 34.84 ± 0.08 | 21.82 ± 0.00 | 30.01 ± 0.03 | 18.91 ± 0.16 |
Protein (% DW basis) | 11.12 ± 0.76 | 4.01 ± 0.04 | 9.98 ± 0.01 | 3.57 ± 0.00 |
Ether extract (% DW basis) | 0.26 ± 0.05 | 1.12 ± 0.05 | 0.76 ± 0.07 | 0.69 ± 0.06 |
Total soluble sugars (% DW basis) | 11.88 ± 0.13 | 20.39 ± 0.56 | 14.49 ± 0.11 | 26.69 ± 0.05 |
Total glucans (% DW basis) | 1.51 ± 0.02 | 17.68 ± 0.09 | 6.40 ± 0.09 | 25.70 ± 0.10 |
Fucose (% DW basis) | 0.77 ± 0.09 | 4.83 ± 0.15 | 2.66 ± 0.03 | 4.86 ± 0.05 |
Total phenolic content (% DW basis) | 0.06 ± 0.00 | 0.05 ± 0.00 | 0.06 ± 0.00 | 0.10 ±0.00 |
Laminaria spp. Extract | Laminarin (mg Laminarin/100 mg Freeze-Dried Extract) * | Fucoidan (mg Fucoidan/100 mg Freeze-Dried Extract) * |
---|---|---|
LDE1 | 0.52 ± 0.06 | 4.46 ± 0.03 |
LDE2 | 0.70 ± 0.07 | 3.84 ± 0.06 |
LDE3 | 0.44 ± 0.03 | 5.80 ± 0.05 |
LDE4 | 0.67 ± 0.08 | 5.74 ± 0.05 |
LHE1 | 4.94 ± 0.20 | 14.41 ± 0.46 |
LHE2 | 7.59 ± 0.02 | 12.76 ± 0.34 |
LHE3 | 6.17 ± 0.03 | 14.53 ± 0.12 |
LHE4 | 6.19 ± 0.03 | 14.68 ± 0.37 |
Bacterial Group (logGCN/g Faeces) | Whole Seaweed Biomass samples | SEM | p-Value | |||||
---|---|---|---|---|---|---|---|---|
LDWB-F * | LDWB-N * | LHWB-F * | LHWB-N * | Species | Season | Species × Season | ||
Total bacteria | 9.75 | 9.69 | 9.76 | 9.89 | 0.057 | 0.032 | NS | 0.058 |
Lactobacilli | 8.40 | 8.50 | 8.78 | 8.81 | 0.041 | <0.001 | NS | NS |
Bifidobacterium spp. | 6.31 c | 6.35 c | 4.69 b | 3.31 a | 0.044 | <0.001 | <0.001 | <0.001 |
Enterobacteriaceae | 8.13 b | 7.79 a | 7.68 a | 7.98 b | 0.068 | 0.034 | NS | <0.001 |
Bacterial Group (logGCN/g Faeces) | Season | SEM | p-Value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
February | November | |||||||||||
Concentration (mg/mL) | Season | Concentration | Season × Concentration | |||||||||
0 * | 1 * | 2.5 * | 5 * | 0 ‡ | 1 ‡ | 2.5 ‡ | 5 ‡ | |||||
Total bacteria | 9.55 | 9.86 | 9.90 | 9.72 | 9.73 | 9.87 | 9.84 | 9.71 | 0.073 | NS | 0.003 | NS |
Lactobacilli | 8.50 | 8.67 | 8.68 | 8.53 | 8.62 | 8.66 | 8.69 | 8.64 | 0.052 | NS | 0.041 | NS |
Bifidobacterium spp. | 6.53 d | 6.59 d | 5.95 c | 2.93 a | 6.64 d | 6.55 d | 3.15 b | 2.98 a | 0.056 | <0.001 | <0.001 | <0.001 |
Enterobacteriaceae | 7.97 | 8.03 | 7.90 | 7.72 | 8.01 | 7.90 | 7.89 | 7.75 | 0.085 | NS | 0.012 | NS |
Laminaria spp. Extract | Bacterial Strain (logCFU Difference/mL) * | ||||
---|---|---|---|---|---|
L. plantarum‡ | L. reuteri‡ | B. thermophilum‡ | ETEC ‡ | S. typhimurium ‡ | |
LDE1 | 0.16 c | 0.28 | −0.21 a | −0.45 b | −0.18 b |
LDE2 | 0.15 c | 0.25 | 0.09 b | −0.08 c | −0.01 c |
LDE3 | 0.02 ab | 0.03 | 0.14 bc | 0.02 cd | −0.07 bc |
LDE4 | 0.05 bc | 0.08 | 0.89 e | 0.04 cd | −0.03 c |
LHE1 | −0.07 a | 0.32 | −0.28 a | −1.02 a | −1.14 a |
LHE2 | 0.06 bc | 0.28 | −0.24 a | 0.01 cd | −0.17 b |
LHE3 | 0.07 bc | 0.10 | 0.30 cd | 0.26 e | 0.07 c |
LHE4 | 0.28 d | 0.26 | 0.43 d | 0.09 d | 0.00 c |
SEM | 0.040 | 0.058 | 0.073 | 0.055 | 0.052 |
p-value | |||||
Species | NS | 0.048 | 0.001 | NS | <0.001 |
Extraction condition | 0.013 | <0.001 | <0.001 | <0.001 | <0.001 |
Species × Extraction condition | <0.001 | NS | <0.001 | <0.001 | <0.001 |
Extraction Condition | LD/LH Extract Concentration (mg/mL) | Bacterial Strains (logCFU Difference/mL) * | ||||
---|---|---|---|---|---|---|
L. plantarum‡ | L. reuteri‡ | B. thermophilum‡ | ETEC ‡ | S. typhimurium ‡ | ||
E1 | 2 | 0.09 | 0.35 | −0.96 a | −4.63 a | −3.12 a |
1 | 0.16 | 0.27 | −0.44 b | 0.17 cdef | −0.14 d | |
0.5 | −0.03 | 0.34 | −0.04 cde | 0.27 def | −0.07 de | |
0.25 | 0.04 | 0.36 | 0.15 efg | 0.36 f | 0.00 def | |
0.125 | −0.02 | 0.18 | 0.05 defg | 0.17 cdef | 0.03 def | |
E2 | 2 | 0.19 | 0.47 | −0.33 bc | −0.25 b | −0.78 b |
1 | 0.12 | 0.34 | 0.12 defg | −0.04 bc | 0.05 def | |
0.5 | 0.07 | 0.34 | 0.01 def | 0.05 cd | 0.09 ef | |
0.25 | 0.08 | 0.06 | −0.19 bcd | 0.00 c | 0.07 def | |
0.125 | 0.05 | 0.14 | 0.03 defg | 0.06 cde | 0.11 ef | |
E3 | 2 | 0.19 | 0.24 | 0.33 fgh | 0.07 cde | −0.48c |
1 | 0.10 | 0.04 | 0.28 efgh | 0.29 ef | 0.10 ef | |
0.5 | 0.04 | 0.03 | 0.25 efgh | 0.19 cdef | 0.07 def | |
0.25 | −0.05 | −0.03 | 0.15 efg | 0.12 cdef | 0.17 f | |
0.125 | −0.05 | 0.05 | 0.08 defg | 0.03 cd | 0.14 ef | |
E4 | 2 | 0.15 | 0.32 | 0.87 j | 0.13 cdef | −0.05 def |
1 | 0.20 | 0.24 | 0.93 j | 0.10 cde | 0.00 def | |
0.5 | 0.20 | 0.18 | 0.67 ij | 0.04 cd | −0.01 def | |
0.25 | 0.17 | 0.07 | 0.47 hi | 0.03 c | 0.03 def | |
0.125 | 0.09 | 0.04 | 0.35 gh | 0.04 cd | −0.04 def | |
SEM | 0.064 | 0.091 | 0.115 | 0.087 | 0.082 | |
p-value | ||||||
Concentration | 0.012 | 0.002 | 0.022 | <0.001 | <0.001 | |
Extraction condition | 0.013 | <0.001 | <0.001 | <0.001 | <0.001 | |
Concentration × Extraction condition | NS | NS | <0.001 | <0.001 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Venardou, B.; O’Doherty, J.V.; Garcia-Vaquero, M.; Kiely, C.; Rajauria, G.; McDonnell, M.J.; Ryan, M.T.; Sweeney, T. In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs. Animals 2023, 13, 823. https://doi.org/10.3390/ani13050823
Venardou B, O’Doherty JV, Garcia-Vaquero M, Kiely C, Rajauria G, McDonnell MJ, Ryan MT, Sweeney T. In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs. Animals. 2023; 13(5):823. https://doi.org/10.3390/ani13050823
Chicago/Turabian StyleVenardou, Brigkita, John V. O’Doherty, Marco Garcia-Vaquero, Claire Kiely, Gaurav Rajauria, Mary J. McDonnell, Marion T. Ryan, and Torres Sweeney. 2023. "In Vitro Evaluation of Brown Seaweed Laminaria spp. as a Source of Antibacterial and Prebiotic Extracts That Could Modulate the Gastrointestinal Microbiota of Weaned Pigs" Animals 13, no. 5: 823. https://doi.org/10.3390/ani13050823