Effects and Mechanisms Investigation of Heat Stress on Egg Yolk Quality in Huaixiang Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Housing, Experiment Design, and Diet
2.2. Sample Collection and Storage
2.3. Egg Yolk Quality Indicators Measurement
2.4. Yolk and Liver Lipids Analysis
2.5. Histological Examination
2.6. Quantitative Real-Time PCR Analysis
2.7. Yolk Amino Acid Traits
2.8. Statistical Analysis
3. Results
3.1. Effects of High Temperature on Egg Weight-Related Indexes of Huaixiang Chicken
3.2. Effects of High Temperature on Yolk Color of Huaixiang Chicken
3.3. Effects of High Temperature on Yolk Lipids of Huaixiang Chicken
3.4. Underlying Mechanisms of High Temperature on Yolk Lipids Changes of Huaixiang Chicken
3.4.1. Effects of Heat Temperature on the Liver Histological Changes of Huaixiang Chicken
3.4.2. Effects of High Temperature on the Liver Lipids of Huaixiang Chicken
3.4.3. Effects of High Temperature on Lipid Metabolism Gene Expressions in the Liver of Huaixiang Chicken
3.5. Effects of High Temperature on Yolk Amino Acid of Huaixiang Chicken
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Loyau, T.; Berri, C.; Bedrani, L.; Metayer-Coustard, S.; Praud, C.; Duclos, M.J.; Tesseraud, S.; Rideau, N.; Everaert, N.; Yahav, S. Thermal manipulation of the embryo modifies the physiology and body composition of broiler chickens reared in floor pens without affecting breast meat processing quality. J. Anim. Sci. 2013, 91, 3674–3685. [Google Scholar] [CrossRef] [PubMed]
- Bahar, K.; Nurinisa, E.; Ahmet, Y.; Ekrem, L.; Muhlis, M. Effect of Environmental Conditions in Poultry Houses on the Performance of Laying Hens. Int. J. Poult. Sci. 2006, 5, 26–30. [Google Scholar]
- Balnave, D.; Brake, J. Nutrition and management of heat-stressed pullets and laying hens. World’s Poult. Sci. J. 2005, 61, 399–406. [Google Scholar] [CrossRef]
- El-Kholy, M.S.; Mohamed, M.A.; Mahmoud, A.E.; Mohamed, E.E.; Sabry, A.E. Dietary Supplementation of Chromium Can Alleviate Negative Impacts of Heat Stress on Performance, Carcass Yield, and Some Blood Hematology and Chemistry Indices of Growing Japanese Quail. Biol. Trace Elem. Res. 2017, 179, 148–157. [Google Scholar] [CrossRef]
- St-Pierre, N.R.; Cobanov, B.; Schnitkey, G. Economic Losses from Heat Stress by US Livestock Industries1. J. Dairy Sci. 2003, 86, E52–E77. [Google Scholar] [CrossRef]
- Nawab, A.; Li, G.; Liu, W.; Lan, R.; Wu, J.; Zhao, Y.; Kang, K.; Kieser, B.; Sun, C.; Tang, S.; et al. Effect of dietary curcumin on the antioxidant status of laying hens under high-temperature condition. J. Therm. Biol. 2019, 86, 102449. [Google Scholar] [CrossRef]
- Ye, Q.; Du, B.; Liu, Y.; Chen, Y.; Chen, J.; Li, D. Analysis and fitting of growth curve in different strains of Xinyi Huai Xiang Chicken. Poult. Sci. 2014, 12, 4–7. [Google Scholar]
- Song, K.T.; Choi, S.H.; Oh, H.R. A Comparison of Egg Quality of Pheasant, Chukar, Quail and Guinea Fowl. Asian-Australas. J. Anim. Sci. 2000, 13, 986–990. [Google Scholar] [CrossRef]
- El-Tarabany, M.S. Effect of thermal stress on fertility and egg quality of Japanese quail. J. Therm. Biol. 2016, 61, 38–43. [Google Scholar] [CrossRef]
- Wolanski, N.J.; Renema, R.A.; Robinson, F.E.; Carney, V.L.; Fancher, B.I. Relationships among egg characteristics, chick measurements, and early growth traits in ten broiler breeder strains. Poult. Sci. 2007, 86, 1784. [Google Scholar] [CrossRef]
- National Research Council. Nutrient Requirements of Poultry, 9th rev. ed.; The National Academies Press: Washington, DC, USA, 1994. [Google Scholar]
- Gholizadeh, H.; Torki, M.; Mohammadi, H. Production performance, egg quality and some blood parameters of heat-stressed laying hens as affected by dietary supplemental Vit B6, Mg and Zn. Vet. Med. Sci. 2022, 8, 681–694. [Google Scholar] [CrossRef] [PubMed]
- Friedewald, W.T.; Levy, R.I.; Fredrickson, D.S. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin. Chem. 1972, 18, 499–502. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Jeong, S.-W.; Quan, H.; Jeong, C.-W.; Choi, J.-I.; Bae, H.-B. Effect of curcumin (Curcuma longa extract) on LPS-induced acute lung injury is mediated by the activation of AMPK. J. Anesth. 2016, 30, 100–108. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Yu, S.; Gao, W.; Zhao, Z.; Wu, J.; Xiao, M.; An, L. Dietary curcumin supplementation regulates the lipid metabolism in laying hens. Ital. J. Anim. Sci. 2022, 21, 1106–1116. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Duncan, D.; Shellduncan, B.; Duncan Lyngdoh, R.H.; Duncan, D.; Duncan, D. Multiple ranges and multiple F-test. Biometrics 1995, 11, 1–42. [Google Scholar] [CrossRef]
- Renaudeau, D.; Collin, A.; Yahav, S.; de Basilio, V.; Gourdine, J.L.; Collier, R.J. Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal 2012, 6, 707–728. [Google Scholar] [CrossRef]
- Hamidi, O.; Chamani, M.; Ghahri, H.; Sadeghi, A.A.; Malekinejad, H.; Palangi, V. Effects of Supplemental Chromium Nanoparticles on IFN-γ expression of Heat Stress Broilers. Biol. Trace Elem. Res. 2022, 200, 339–347. [Google Scholar] [CrossRef]
- Star, L.; Kemp, B.; van den Anker, I.; Parmentier, H.K. Effect of single or combined climatic and hygienic stress in four layer lines: 1. Performance. Poult. Sci. 2008, 87, 1022–1030. [Google Scholar] [CrossRef]
- Allahverdi, A.; Feizi, A.; Takhtfooladi, H.A.; Nikpiran, H. Effects of Heat Stress on Acid-Base Imbalance, Plasma Calcium Concentration, Egg Production and Egg Quality in Commercial Layers. Glob. Vet. 2013, 10, 203–207. [Google Scholar]
- Mashaly, M.M.; Hendricks, G.L., 3rd; Kalama, M.A.; Gehad, A.E.; Abbas, A.O.; Patterson, P.H. Effect of heat stress on production parameters and immune responses of commercial laying hens. Poult. Sci. 2004, 83, 889–894. [Google Scholar] [CrossRef]
- Barrett, N.W.; Rowland, K.; Schmidt, C.J.; Lamont, S.J.; Rothschild, M.F.; Ashwell, C.M.; Persia, M.E. Effects of acute and chronic heat stress on the performance, egg quality, body temperature, and blood gas parameters of laying hens. Poult. Sci. 2019, 98, 6684–6692. [Google Scholar] [CrossRef]
- Zhuye, N.; Jin, F.; Yupeng, G.; Fuzhu, L. Influence of Paprika Extract Supplement on Egg Quality of Laying Hens Fed Wheat-Based Diet. Int. J. Poult. Sci. 2008, 7, 887–889. [Google Scholar]
- Chowdhury, S.D.; Hassin, B.M.; Das, S.C.; Rashid, M.H.; Ferdaus, A.J.M. Evaluation of Marigold Flower and Orange Skin as Sources of Xanthophyll Pigment for the Improvement of Egg Yolk Color. J. Poult. Sci. 2008, 45, 265–272. [Google Scholar] [CrossRef]
- Emami, N.K.; Jung, U.; Voy, B.; Dridi, S. Radical Response: Effects of Heat Stress-Induced Oxidative Stress on Lipid Metabolism in the Avian Liver. Antioxidants 2020, 10, 35. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Cheng, Y.; Wen, C.; Zhou, Y. Protective effects of dietary mannan oligosaccharide on heat stress-induced hepatic damage in broilers. Environ. Sci. Pollut. Res. Int. 2020, 27, 29000–29008. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.L.; Ding, K.N.; Shen, X.L.; Liu, H.X.; Zhang, Y.A.; Liu, Y.Q.; He, Y.M.; Tang, L.P. Chronic heat stress promotes liver inflammation in broilers via enhancing NF-κB and NLRP3 signaling pathway. BMC Vet. Res. 2022, 18, 289. [Google Scholar] [CrossRef] [PubMed]
- Ma, B.; Xing, T.; Li, J.; Zhang, L.; Jiang, Y.; Gao, F. Chronic heat stress causes liver damage via endoplasmic reticulum stress-induced apoptosis in broilers. Poult. Sci. 2022, 101, 102063. [Google Scholar] [CrossRef]
- Yin, C.; Tang, S.; Liu, L.; Cao, A.; Zhang, H. Effects of Bile Acids on Growth Performance and Lipid Metabolism during Chronic Heat Stress in Broiler Chickens. Animals 2021, 11, 630. [Google Scholar] [CrossRef]
- Lu, Q.; Wen, J.; Zhang, H. Effect of chronic heat exposure on fat deposition and meat quality in two genetic types of chicken. Poult. Sci. 2007, 86, 1059. [Google Scholar] [CrossRef]
- Lu, Z.; He, X.; Ma, B.; Zhang, L.; Gao, F. Serum metabolomics study of nutrient metabolic variations in chronic heatstressed broilers. Br. J. Nutr. 2018, 119, 771. [Google Scholar] [CrossRef] [PubMed]
- Demeure, O.; Duby, C.; Désert, C.; Assaf, S.; Hazard, D.; Guillou, H.; Lagarrigue, S. Liver X receptor l regulates fatty acid synthase expression in chicken. Poult. Sci. 2009, 88, 2628–2635. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; He, X.F.; Ma, B.B.; Zhang, L.; Li, J.L.; Jiang, Y.; Zhou, G.H.; Gao, F. Increased fat synthesis and limited apolipoprotein B cause lipid accumulation in the liver of broiler chickens exposed to chronic heat stress. Poult. Sci. 2019, 98, 3695–3704. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Ma, H.; Zou, S.; Chen, W.; Zhao, R. Hepatic Lipogenesis in Broiler Chickens with Different Fat Deposition during Embryonic Development. J. Vet. Med. Ser. A 2007, 54, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Song, Z.; Wang, X.; Jiao, H.; Lin, H. Dexamethasone-induced hepatic lipogenesis is insulin dependent in chickens (Gallus gallus domesticus). Stress 2011, 14, 273–281. [Google Scholar] [CrossRef]
- Hoskin, S.O.; Bremner, D.M.; Holtrop, G.; Lobley, G.E. Responses in whole-body amino acid kinetics to an acute, sub-clinical endotoxin challenge in lambs. Br. J. Nutr. 2016, 115, 576–584. [Google Scholar] [CrossRef]
- Cervantes, M.; Ibarra, N.; Vásquez, N.; Reyes, F.; Avelar, E.; Espinoza, S.; Morales, A. Serum concentrations of free amino acids in growing pigs exposed to diurnal heat stress fluctuations. J. Therm. Biol. 2017, 69, 69–75. [Google Scholar] [CrossRef]
- Belhadj Slimen, I.; Najar, T.; Ghram, A.; Dabbebi, H.; Ben Mrad, M.; Abdrabbah, M. Reactive oxygen species, heat stress and oxidative-induced mitochondrial damage. A review. Int. J. Hyperth. 2014, 30, 513. [Google Scholar] [CrossRef]
- Baumgard, L.H.; Rhoads, R.P., Jr. Effects of heat stress on postabsorptive metabolism and energetics. Annu. Rev. Anim. Biosci. 2013, 1, 311–337. [Google Scholar] [CrossRef]
- Gao, S.T.; Guo, J.; Quan, S.Y.; Nan, X.M.; Fernandez, M.V.S.; Baumgard, L.H.; Bu, D.P. The effects of heat stress on protein metabolism in lactating Holstein cows. J. Dairy Sci. 2017, 100, 5040–5049. [Google Scholar] [CrossRef]




| Ingredients | Percent (%) | Nutrients 2 (Analyzed Composition, %) | Content |
|---|---|---|---|
| Corn | 55.0 | ME (MJ/kg) | 11.3 |
| Soybean meal | 20.0 | CP, % | 15.5 |
| Wheat bran | 9.5 | Ca, % | 3.0 |
| Fish meal | 5.0 | TP, % | 0.6 |
| Limestone | 7.5 | Met, % | 0.4 |
| Ca(HCO3) 2 | 2.5 | Cys, % | 0.3 |
| NaCl | 0.1 | Lys, % | 0.8 |
| Premix 1 | 0.4 |
| Genes 1 | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|
| SREBP-1c | F: GCCCTCTGTGCCTTTGTCTTC | 130 |
| R: ACTCAGCCATGATGCTTCTTCC | ||
| ACACA | F: AATGGCAGCTTTGGAGGTGT | 136 |
| R: TCTGTTTGGGTGGGAGGTG | ||
| FASN | F: CGCAGTTTGTTGATGGTGAG | 179 |
| R: TCCTTGGTGTTCGTGACG | ||
| LXRα | F: GTCCCTGACCCTAATAACCGC | 186 |
| R: GTCTCCAACAACATCACCTCTATG | ||
| ME | F: TGCCAGCATTACGGTTTAGC | 175 |
| R: CCATTCCATAACAGCCAAGGTC | ||
| β-actin | F:CAACACAGTGCTGTCTGGTGGTAC | 199 |
| R: CTCCTGCTTGCTGATCCACATCTG |
| Items | NT | HT | SEM | p-Value |
|---|---|---|---|---|
| Egg weight (g) | 44.33 | 39.20 | 1.00 | 0.003 |
| Yolk weight (g) | 15.94 | 13.65 | 0.50 | 0.012 |
| Yolk weight/egg weight (%) | 0.36 | 0.35 | 0.01 | 0.483 |
| Items | NT | HT | SEM | p-Value |
|---|---|---|---|---|
| Yolk color | 7.17 | 5.83 | 0.289 | 0.012 |
| Items | NT | HT | SEM | p-Value |
|---|---|---|---|---|
| TG mg/g | 29.43 | 37.66 | 2.06 | 0.016 |
| TC mg/g | 10.17 | 12.95 | 0.88 | 0.155 |
| LDL-C μmol/g | 27.60 | 26.26 | 2.15 | 0.740 |
| HDL-C μmol/g | 6.09 | 6.43 | 0.66 | 0.763 |
| Items | NT | HT | SEM | p-Value |
|---|---|---|---|---|
| Total amino acid μmol/g | 137.24 | 117.54 | 5.20 | 0.033 |
| Lys mg/g | 7.50 | 8.12 | 0.32 | 0.395 |
| Phe mg/g | 4.93 | 4.98 | 0.09 | 0.839 |
| Met mg/g | 1.74 | 1.75 | 0.04 | 0.961 |
| Thr mg/g | 4.89 | 5.04 | 0.05 | 0.181 |
| Ile mg/g | 5.19 | 5.03 | 0.12 | 0.565 |
| Leu mg/g | 9.75 | 10.13 | 0.12 | 0.810 |
| Val mg/g | 5.38 | 5.40 | 0.02 | 0.635 |
| Ala mg/g | 4.58 | 4.36 | 0.10 | 0.336 |
| Arg mg/g | 6.47 | 6.94 | 0.23 | 0.414 |
| Gly mg/g | 3.19 | 3.37 | 0.11 | 0.489 |
| Glu mg/g | 5.94 | 6.02 | 0.23 | 0.895 |
| Cys mg/g | 1.26 | 0.52 | 0.20 | 0.041 |
| Tyr mg/g | 5.98 | 5.38 | 0.16 | 0.035 |
| Pro mg/g | 3.94 | 4.08 | 0.09 | 0.506 |
| Ser mg/g | 8.00 | 8.36 | 0.11 | 0.101 |
| Asp mg/g | 4.55 | 5.01 | 0.23 | 0.367 |
| His mg/g | 2.18 | 2.20 | 0.03 | 0.733 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Yu, S.; Zhang, L.; Xiao, M.; An, L. Effects and Mechanisms Investigation of Heat Stress on Egg Yolk Quality in Huaixiang Chickens. Animals 2023, 13, 3513. https://doi.org/10.3390/ani13223513
Chen Y, Yu S, Zhang L, Xiao M, An L. Effects and Mechanisms Investigation of Heat Stress on Egg Yolk Quality in Huaixiang Chickens. Animals. 2023; 13(22):3513. https://doi.org/10.3390/ani13223513
Chicago/Turabian StyleChen, Yuxia, Sumeng Yu, Li Zhang, Mei Xiao, and Lilong An. 2023. "Effects and Mechanisms Investigation of Heat Stress on Egg Yolk Quality in Huaixiang Chickens" Animals 13, no. 22: 3513. https://doi.org/10.3390/ani13223513
APA StyleChen, Y., Yu, S., Zhang, L., Xiao, M., & An, L. (2023). Effects and Mechanisms Investigation of Heat Stress on Egg Yolk Quality in Huaixiang Chickens. Animals, 13(22), 3513. https://doi.org/10.3390/ani13223513

