Genome-Wide Identification of 5-HT Receptor Gene Family in Razor Clam Sinonovacula constricta and Their Circadian Rhythm Expression Analysis
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Sample Collections
2.2. Identification and Sequence Analysis of Sc5-HTRs
2.3. Multiple Sequence Alignment and Phylogenetic Analysis
2.4. Motif Patterns and Chromosome Location
2.5. Prediction of Tertiary Structure of Sc5-HTR Proteins
2.6. Preliminary Identification of Effective Sc5-HTRs That Bind to 5-HT
2.7. Circadian Rhythm Expression Patterns of Sc5-HTRs
2.8. RNA Extraction and qRT-PCR
2.9. Statistical Analysis
3. Results
3.1. Sequence Analysis of Sc5-HTRs
3.2. Multiple Sequence Alignment and Phylogenetic Analysis
3.3. Motif Patterns and Chromosome Location
3.4. Prediction of Tertiary Structure of Sc5-HTRs
3.5. Tissue Expression Pattern of Sc5-HTRs
3.6. Preliminary Identification of Effective Sc5-HTRs That Binds to 5-HT
3.7. Circadian Rhythm Expression Patterns of Sc5-HTRs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kreshchenko, N.; Terenina, N.; Ermakov, A. Serotonin signaling in flatworms: An immunocytochemical localisation of 5-HT7 type of serotonin receptors in Opisthorchis felineus and Hymenolepis diminuta. Biomolecules 2021, 11, 1212. [Google Scholar] [CrossRef]
- Garnerot, F.; Pellerin, J.; Blaise, C.; Mathieu, M. Immunohistochemical localization of serotonin (5-hydroxytryptamine) in the gonad and digestive gland of Mya arenaria (Mollusca: Bivalvia). Gen. Comp. Endocrinol. 2006, 149, 278–284. [Google Scholar] [CrossRef]
- Ribeiro, P.; EI-Shehabi, F.; Patocka, N. Classical transmitters and their receptors in flatworms. Parasitology 2006, 131, 19–39. [Google Scholar] [CrossRef] [PubMed]
- Green, A.R. Neuropharmacology of 5-hydroxytryptamine. Br. J. pharmacol. 2006, 147, 45–52. [Google Scholar]
- Huang, S.J.; Xu, P.Y.; Shen, D.D.; Simon, I.A.; Mao, C.Y.; Tan, Y.X.; Zhang, H.B.; Harpsøe, K.; Li, H.D.; Zhang, Y.M.; et al. GPCRs steer Gi and Gs selectivity via TM5-TM6 switches as revealed by structures of serotonin receptors. Mol. Cell 2022, 82, 2681–2695. [Google Scholar] [CrossRef] [PubMed]
- Göthert, M. Serotonin discovery and stepwise disclosure of 5-HT receptor complexity over four decades. Part I. General background and discovery of serotonin as a basis for 5-HT receptor identification. Pharmacol. Rep. 2013, 65, 771–786. [Google Scholar] [CrossRef] [PubMed]
- Hannon, J.; Hoyer, D. Molecular biology of 5-HT receptors. Behav. Brain Res. 2008, 195, 198–213. [Google Scholar] [CrossRef]
- Maricq, A.; Peterson, A.; Brake, A.; Myers, R.; Julius, D. Primary structure and functional expression of the 5HT3 receptor, a serotonin-gated ion channel. Science 2008, 254, 432–437. [Google Scholar] [CrossRef]
- McCorvy, J.; Roth, B.L. Structure and function of serotonin G protein-coupled receptor. Pharmacol. Ther. 2015, 150, 129–142. [Google Scholar] [CrossRef]
- Nichols, D.E.; Nichols, C.D. Serotonin receptors. Chem. Rev. 2008, 108, 1614–1641. [Google Scholar] [CrossRef]
- Hamdan, F.F.; Ungrin, M.D.; Abramovitz, M.; Ribeiro, P. Characterization of a novel serotonin receptor from Caenorhabditis elegans: Cloning and expression of two splice variants. J. Mol. Neurosci. 1999, 72, 1372–1383. [Google Scholar] [CrossRef]
- Henne, S.; Sombke, A.; Schmidt-Rhaesa, A. Immunohistochemical analysis of the anterior nervous system of the free-living nematode Plectus spp (Nematoda, Plectidae). Zoomorphology 2017, 136, 175–190. [Google Scholar] [CrossRef]
- Kamhi, J.F.; Arganda, S.; Moreau, C.S.; Traniello, J.F.A. Origins of aminergic regulation of behavior in complex insect social systems. Front. Syst. Neurosci. 2017, 11, 74–82. [Google Scholar] [CrossRef] [PubMed]
- Vleugels, R.; Verlinden, H.; Broeck, J.V. Serotonin, serotonin receptors and their actions in insects. Neurotransmitter 2015, 2, 314–327. [Google Scholar]
- Ivashkin, E.; Khabarova, M.Y.; Melnikova, V.I.; Kharchenko, O.; Voronezhskaya, E.E. Local serotonin-immunoreactive plexus in the female reproductive system of hermaphroditic gastropod mollusc Lymnaea stagnalis. Zool. Bespozvon. 2017, 14, 134–139. [Google Scholar] [CrossRef]
- Sukhan, Z.P.; Sharker, R.; Cho, Y.; Hossen, S.; Choi, K.S.; Kho, K.H. Thermal stress affects gonadal maturation by regulating GnRH, GnRH receptor, APGWamide, and serotonin receptor gene expression in male Pacific abalone, Haliotis discus hannai during breeding season. Front. Mar. Sci. 2021, 8, 664426. [Google Scholar] [CrossRef]
- Olde, B.; McCombie, W.R. Molecular cloning and functional expression of a serotonin receptor from Caenorhabditis elegans. J. Mol. Neurosci. 1997, 8, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Martínez, G.; Mettifogo, L.; Perez, M.A.; Callejas, C. A method to eliminate self-fertilization in a simultaneous hermaphrodite scallop. 1. Effects on growth and survival of larvae and juveniles. Aquaculture 2007, 273, 459–469. [Google Scholar] [CrossRef]
- Martínez, G.; Saleh, F.; Mettifogo, L.; Campos, E.; Inestrosa, N. Monoamines and the release of gametes by the scallop Argopecten purpuratu. J. Exp. Zool. 1996, 274, 365–372. [Google Scholar] [CrossRef]
- Fong, P.P.; Warner, F. Serotonin-induced parturition in the fingernail clam Sphaerium (Musculium) transversum (Say). J. Exp. Zool. 1995, 2, 163–166. [Google Scholar] [CrossRef]
- Ram, J.L.; Crawford, G.W.; Walker, J.U.; Mojares, J.J.; Patel, N.; Fong, P.P.; Kyozuka, K. Spawning in the zebra mussel (Dreissena polymorpha): Activation by internal or external application of serotonin. J. Exp. Zool. 1993, 265, 527–598. [Google Scholar] [CrossRef]
- Lee, Y.; Wickamarachchi, W.; Whang, I.; Oh, M.; Umasuthan, N.; De, Z.M.; Oh, C.; Kang, D.H.; Lee, J. Immune response-related gene expression profile of a novel molluscan IκB protein member from Manila clam (Ruditapes philippinarum). Mol. Biol. Rep. 2013, 40, 1519–1527. [Google Scholar] [CrossRef]
- Marc, F.; Marlène, F.; Delphine, F.; PierreHervé, R.; Pauline, B.; Michel, F.; Céline, S.; Cathy, V. Exposure to low environmental concentrations of manganese, lead, and cadmium alters the serotonin system of blue mussels. Environ. Toxicol. Chem. 2017, 37, 192–200. [Google Scholar]
- Liu, Y.Z.; He, Q.Y.; Yao, H.H.; Lin, Z.H.; Dong, Y.H. Circadian clock genes Bmal1 and Period may regulate nocturnal spawning by controlling sex hormone secretion in razor clam Sinonovacula constricta. Front. Mar. Sci. 2022, 9, 1074816. [Google Scholar] [CrossRef]
- Mo, Y.K. Industrialized artificial seedling technology in lianyungang Sinonovacula constricta. China Fish. 2008, 6, 55. [Google Scholar]
- Chen, C.J.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, Y.H.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Gianasi, B.L.; Hamel, J.; Mercier, A. Triggers of spawning and oocyte maturation in the commercial sea cucumber Cucumaria frondosa. Aquaculture 2018, 498, 50–60. [Google Scholar] [CrossRef]
- Liu, Z.Q.; Wang, L.L.; Yan, Y.C.; Zheng, Y.; Ge, W.J.; Li, M.J.; Wang, W.L.; Song, X.R.; Song, L.S. D1dopamine receptor is involved in shell formation in larvae of Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. 2018, 84, 337–342. [Google Scholar] [CrossRef] [PubMed]
- Vázquez, Y.R.; Alstyne, K.V.; Bingham, B.L. Exudates of the green alga Ulvaria obscura(Kützing) affect larval development of the sand dollar Dendraster excentricus (Eschscholtz) and the Pacific oyster Crassostrea gigas (Thunberg). Mar. Biol. 2017, 164, 194–204. [Google Scholar] [CrossRef]
- Blenau, W.; Thamm, M. Distribution of serotonin (5-HT) and its receptors in the insect brain with focus on the mushroom bodies. Lessons from Drosophila melanogaster and Apis mellifera. Arthropod. Struct. Dev. 2011, 40, 381–394. [Google Scholar] [CrossRef] [PubMed]
- Barbas, D.; Zappulla, J.P.; Angers, S.; Bouvier, M.; Castellucci, V.F.; DesGroseillers, L. Functional characterization of a novel serotonin receptor (5-HTap2) expressed in the CNS of Aplysia californica. J. Neurochem. 2002, 80, 335–345. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.J.; Liu, Z.Q.; Qiu, L.M.; Wang, W.L.; Song, X.R.; Wang, X.D.; Li, Y.Q.; Xin, L.S.; Wang, L.L.; Song, L.S. The modulation role of serotonin in Pacific oyster Crassostrea gigas in response to air exposure. Fish Shellfish Immunol. 2017, 62, 341–348. [Google Scholar] [CrossRef]
- Angers, A.; Storozhuk, M.V.; Duchaîne, T.; Castellucci, V.F.; DesGroseillers, L. Cloning and functional expression of an Aplysia 5-HT receptor negatively coupled to adenylate cyclase. J. Neurosci. 1998, 18, 5586–5593. [Google Scholar] [CrossRef] [PubMed]
- Panasophonkul, S.; Apisawetakan, S.; Cummins, S.F.; York, P.S.; Degnan, B.M.; Hanna, P.J.; Saitongdee, P.; Sobhon, P.; Sretarugsa, P. Molecular characterization and analysis of a truncated serotonin receptor gene expressed in neural and reproductive tissues of abalone. Histochem. Cell Biol. 2009, 131, 629–642. [Google Scholar] [CrossRef]
- Karpa, K.D.; Lin, R.; Kabbani, N.; Levenson, R. The dopamine D3 receptor interacts with itself and the truncated D3 splice variant d3nf: D3-D3nf interaction causes mislocalization of D3 receptors. Mol. Pharmacol. 2000, 58, 677–683. [Google Scholar] [CrossRef]
- Pawson, A.J.; Maudsley, S.; Morgan, K.; Davidson, L.; Naor, Z.; Millar, R.P. Inhibition of human type i gonadotropin-releasing hormone receptor (GnRHR) function by expression of a human type II GnRHR gene fragment. Endocrinology 2005, 146, 2639–2649. [Google Scholar] [CrossRef]
- Bender, E.; Pindon, A.; Oers, I.; Zhang, Y.B.; Gommeren, W.; Verhasselt, P.; Jurzak, M.; Leysen, J.; Luyten, W. Structure of the human serotonin 5-HT4 receptor gene and cloning of a novel 5-HT4 splice variant. J. Neurochem. 2000, 74, 478–489. [Google Scholar] [CrossRef]
- Olivier, B.; Mos, J.; Oorschot, R.; Hen, R. Serotonin receptors and animal models of aggressive behavior. Pharmacopsychiatry 1995, 28, 80–90. [Google Scholar] [CrossRef]
- Komal, P.; Richie, B.; Daniel, C.; Vinay, V. Cardiovascular concern of 5-HT2B receptor and recent vistas in the development of its antagonists. Cardiovasc. Hematol. Disord. Drug 2017, 17, 86–104. [Google Scholar]
- Jorge, J.; Pérez, M.; María, M.; Manuel, A. The involvement of 5-HT- like receptors in the regulation of food intake in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. 2014, 161, 1–6. [Google Scholar]
- Zhang, B.; Yang, J.; Han, T.; Huang, D.X.; Zhao, Z.H.; Feng, J.Q.; Zhou, N.M.; Xie, H.Q.; Wang, T.M. Identification and characterization of a novel 5-hydroxytryptamine receptor in the sea cucumber Apostichopus japonicus (Selenka). J. Exp. Zool. 2021, 335, 67–380. [Google Scholar] [CrossRef] [PubMed]
- Gerhardt, C.C.; Leysen, J.E.; Planta, R.J.; Vreugdenhil, E.; Heerikhuizen, H.V. Functional characterisation of a 5-HT2 receptor cDNA cloned from Lymnaea stagnalis. Eur. J Pharmacol. 1996, 311, 249–258. [Google Scholar] [CrossRef] [PubMed]
- Garau, C.; Aparicio, S.; Rial, R.V.; Nicolau, M.C.; Esteban, S. Age-related changes in circadian rhythm of serotonin synthesis in ring doves: Effects of increased tryptophan ingestion. Exp. Gerontol. 2006, 41, 40–48. [Google Scholar] [CrossRef] [PubMed]
- Alves, J.A.; Marie, J.S.; Rodriguez, A.E.J.M. Hard to get, easy to lose: Evolution of mantle photoreceptor organs in bivalves (Bivalvia, Pteriomorphia). Evolution 2020, 74, 2105–2120. [Google Scholar] [CrossRef]
- Wolken, J.J. Photobehavior of marine invertebrates: Extraocular photoreception. Comp. Biochem. Physiol. 1988, 91, 145–149. [Google Scholar] [CrossRef]
- Chalermporn, O.; Yaowaluck, R.; Suthasinee, S.; Chetsada, P.; Soontaree, P.; Jarasporn, K.; Samaisukh, S.; Sakol, P. Molecular cloning and functional expression of the Penaeus monodon 5-HT receptor. BBA Gene Struct. Expr. 2006, 1759, 328–339. [Google Scholar]
- Tiu, S.H.K.; He, J.G.; Chan, S.M. Organization and expression study of the shrimp (Metapenaeus ensis) putative 5-HT receptor: Up-regulation in the brain by 5-HT. Gene 2005, 353, 41–52. [Google Scholar] [CrossRef]
- Tinikul, Y.; Mercier, J.; Soonklang, N.; Sobhon, P. Changes in the levels of serotonin and dopamine in the central nervous system and ovary, and their possible roles in the ovarian development in the giant freshwater prawn, Macrobrachium rosenbergii. Gen. Comp. Endocrinol. 2018, 158, 250–258. [Google Scholar] [CrossRef]
- Wang, C.; Croll, R.P. Effects of sex steroids on spawning in the sea scallop, Placopecten magellanicus. Aquaculture 2006, 256, 423–432. [Google Scholar] [CrossRef]
- Gao, X.L.; Zhang, M.; Lin, S.H.; Lyu, M.X.; Luo, X.; You, W.W.; Ke, C.H. Reproduction strategy of nocturnal marine molluscs: Running for love. Integr. Zool. 2023, 18, 906–923. [Google Scholar] [CrossRef]
- Deguchi, R.; Takeda, N.; Stricker, S.A. Calcium signals and oocyte maturation in marine invertebrates. J. Dev. Biol. 2015, 59, 271–280. [Google Scholar] [CrossRef]
- Guerrier, P.; Leclerc-David, C.; Moreau, M. Evidence for the involvement of internal calcium stores during serotonin-induced meiosis reinitation in oocytes of the bivalve mollusc Ruditapes philippinarum. Dev. Biol. 1993, 159, 474–484. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, D.; Loi, B.; Porte, C. Biosynthesis and metabolism of steroids in molluscs. J. Steroid Biochem. Mol. Biol. 2010, 127, 189–195. [Google Scholar] [CrossRef] [PubMed]
- Gauthier-Clerc, S.; Pellerin, J.; Amiard, J.C. Estradiol-17beta and testosterone concentrations in male and female Mya arenaria (Mollusca bivalvia) during the reproductive cycle. Gen. Comp. Endocrinol. 2006, 145, 133–139. [Google Scholar] [CrossRef]
- Osada, M.; Nomura, T. Estrogen effect on the seasonal levels of catecholamines in the scallop Patinopecten yessoensis. Comp. Biochem. Physiol. 1989, 2, 349–353. [Google Scholar] [CrossRef]
- Osada, M.; Nakata, A.; Matsumoto, T.; Mori, K. Pharmacological characterization of serotonin receptor in the oocyte membrane of bivalve molluscs and its formation duringoogenesis. J. Exp. Zool. 1998, 281, 124–131. [Google Scholar] [CrossRef]
- Wang, C.; Croll, R.P. Effects of sex steroids on gonadal development and gender determination in the sea scallop, Placopecten magellanicus. Aquaculture 2004, 238, 483–498. [Google Scholar] [CrossRef]
- Kim, K.S.; Kim, M.A.; Sohn, Y.C. Molecular characterization, expression analysis, and functional properties of multiple 5-hydroxytryptamine receptors in Pacific abalone (Haliotis discus hannai). Gen. Comp. Endocrinol. 2019, 276, 52–59. [Google Scholar] [CrossRef]
- Kuz’mina, V.V.; Garina, D.V. Feeding behavior in fish: Influence of long-term lightdeprivation on serotonin effects in the carp Cyprinus carpio L. J. Evol. Biochem. Physiol. 2019, 55, 475–482. [Google Scholar] [CrossRef]
- Gabina, C.; Gonzalo, F.; Leonardo, R. Diurnal rhythm in the levels of the serotonin 5-HT1A receptors in the crayfish eyestalk. Synapse 2006, 59, 368–373. [Google Scholar]
- Holmes, M.C.; French, K.L.; Seckl, J.R. Dysregulation of diurnal rhythms of serotonin 5-HT2C and corticosteroid receptor gene expression in the hippocampus with food restriction and glucocorticoids. J. Neurosci. 1997, 17, 4056–4065. [Google Scholar] [CrossRef] [PubMed]
- Natsumi, A.; Hiroyuki, W.; Kazuya, P.; Kazuyuki, A.; Takuma, I.; Daisuke, Y.; Ryosuke, Y.; Shigenobu, S. Involvement of 5-HT3 and 5-HT4 Receptors in the Regulation of Circadian Clock Gene Expression in Mouse Small Intestine. J. Pharmacological. Sci. 2014. 2, 267–275.
- Nichols, C.D. 5-HT2 receptors in Drosophila are expressed in the brain and modulate aspects of circadian behaviors. Dev. Neurobiol. 2007, 67, 752–763. [Google Scholar] [CrossRef] [PubMed]
- Aulakh, C.S.; Mazzola-Pomietto, P.; Hulihan-Giblin, B.A.; Murphy, D.L. Lack of cross-tolerance for hypophagia induced by DOI versus m-CPP suggests separate mediation by 5-HT2A and 5-HT2C receptors, respectively. Neuropsychopharmacology 1995, 13, 1–8. [Google Scholar] [CrossRef]
- Alavi, S.M.H.; Matsumura, N.; Shiba, K.; Itoh, N.; Takahashi, K.G.; Inaba, K.; Osada, M. Roles of extracellular ions and pH in 5-HT-induced sperm motility in marine bivalve. Reproduction 2014, 147, 331–345. [Google Scholar] [CrossRef] [PubMed]
Gene | GenBank Accession No. | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
Sc5-HT1A | OR344072 | GAACATCTAGTCGGCACCACCATC | GCCACAGCAAGTGAGAGGATAAGG |
Sc5-HT1D | OR344075 | TCAGACGGTGAAAGTGGGA | TGGTATGGGTTGTTGTGGTG |
Sc5-HT2-1 | OR344076 | CAAACAGCGTCTTGCGATT | GAGATTCCGTTGATGAACCAG |
Sc5-HT2-2 | OR344077 | GAACATCTAGTCGGCACCACCATC | GCCACAGCAAGTGAGAGGATAAGG |
Sc5-HT2-3 | OR344078 | GAGGAGAATCACAACAATGGG | TACTGGTGGCTTTGAGAACAAG |
Sc5-HT4 | OR344073 | CCGTTCATTGGATACAGGATTC | GCAACTAAGGAGCCGTCTGA |
Sc5-HT6 | OR344074 | CATTCGGGAACCATTTACCA | CCGTCAAGTTTGCGACAAG |
RS9 | OQ244850 | TGAAGTCTGGCGTGTCAAGT | CGTCCAAAAGGGCATTACC |
Protein | Species | Similarity (%) | Accession Number |
---|---|---|---|
Sc5-HT1A | Mercenaria mercenaria | 87.4 | XP_045168822.1 |
Sc5-HT1D | Mercenaria mercenaria | 72.6 | XP_045169056.1 |
Sc5-HT2-1 | Mercenaria mercenaria | 74.1 | XP_045200212.1 |
Sc5-HT2-2 | Mercenaria mercenaria | 58.2 | XP_053404391.1 |
Sc5-HT2-3 | Mercenaria mercenaria | 78.1 | XP_045200167.1 |
Sc5-HT4 | Mercenaria mercenaria | 82.7 | XP_045189937.1 |
Sc5-HT6 | Mercenaria mercenaria | 77.9 | XP_045159152.1 |
Protein | Molecular Weight (kD) | Isoelectric Point (pI) | Transmembrane Structure | Phosphorylation Site |
---|---|---|---|---|
Sc5-HT1A | 45.980 | 8.80 | 7 | 29 |
Sc5-HT1D | 57.135 | 9.16 | 7 | 50 |
Sc5-HT2-1 | 54.932 | 9.40 | 7 | 66 |
Sc5-HT2-2 | 54.568 | 8.16 | 6 | 70 |
Sc5-HT2-3 | 60.478 | 9.34 | 7 | 67 |
Sc5-HT4 | 46.885 | 7.88 | 7 | 28 |
Sc5-HT6 | 43.945 | 9.19 | 7 | 33 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
You, Q.; Li, Q.; Lv, L.; Lin, Z.; Dong, Y.; Yao, H. Genome-Wide Identification of 5-HT Receptor Gene Family in Razor Clam Sinonovacula constricta and Their Circadian Rhythm Expression Analysis. Animals 2023, 13, 3208. https://doi.org/10.3390/ani13203208
You Q, Li Q, Lv L, Lin Z, Dong Y, Yao H. Genome-Wide Identification of 5-HT Receptor Gene Family in Razor Clam Sinonovacula constricta and Their Circadian Rhythm Expression Analysis. Animals. 2023; 13(20):3208. https://doi.org/10.3390/ani13203208
Chicago/Turabian StyleYou, Qiyi, Qijun Li, Liyuan Lv, Zhihua Lin, Yinghui Dong, and Hanhan Yao. 2023. "Genome-Wide Identification of 5-HT Receptor Gene Family in Razor Clam Sinonovacula constricta and Their Circadian Rhythm Expression Analysis" Animals 13, no. 20: 3208. https://doi.org/10.3390/ani13203208
APA StyleYou, Q., Li, Q., Lv, L., Lin, Z., Dong, Y., & Yao, H. (2023). Genome-Wide Identification of 5-HT Receptor Gene Family in Razor Clam Sinonovacula constricta and Their Circadian Rhythm Expression Analysis. Animals, 13(20), 3208. https://doi.org/10.3390/ani13203208