Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia)
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Katavolos, P.; Armstrong, P.M.; Dawson, J.E.; Iii, S.R.T. Duration of Tick Attachment Required for Transmission of Granulocytic Ehrlichiosis. J. Infect. Dis. 1998, 177, 1422–1425. [Google Scholar] [CrossRef]
- Lappin, M.R.; Griffin, B.; Brunt, J.; Riley, A.; Burney, D.; Hawley, J.; Brewer, M.M.; Jensen, W.A. Prevalence of Bartonella species, haemoplasma species, Ehrlichia species, Anaplasma phagocytophilum, and Neorickettsia risticii DNA in the blood of cats and their fleas in the United States. J. Feline Med. Surg. 2006, 8, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Pennisi, M.-G.; Persichetti, M.-F.; Serrano, L.; Altet, L.; Reale, S.; Gulotta, L.; Solano-Gallego, L. Ticks and associated pathogens collected from cats in Sicily and Calabria (Italy). Parasites Vectors 2015, 8, 512. [Google Scholar] [CrossRef] [PubMed]
- Gilles, J.; Just, F.T.; Silaghi, C.; Pradel, I.; Passos, L.M.F.; Lengauer, H.; Hellmann, K.; Pfister, K. Rickettsia felis in Fleas, Germany. Emerg. Infect. Dis. 2008, 14, 1294–1296. [Google Scholar] [CrossRef] [PubMed]
- Bouhsira, E.; Ferrandez, Y.; Liu, M.; Franc, M.; Boulouis, H.-J.; Biville, F. Ctenocephalides felis an in vitro potential vector for five Bartonella species. Comp. Immunol. Microbiol. Infect. Dis. 2013, 36, 105–111. [Google Scholar] [CrossRef]
- Cotté, V.; Bonnet, S.; Le Rhun, D.; Le Naour, E.; Chauvin, A.; Boulouis, H.-J.; Lecuelle, B.; Lilin, T.; Vayssier-Taussat, M. Transmission of Bartonella henselae by Ixodes ricinus. Emerg. Infect. Dis. 2008, 14, 1074–1080. [Google Scholar] [CrossRef]
- Lloret, A.; Addie, D.D.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; Hartmann, K.; Horzinek, M.C.; Hosie, M.J.; Lutz, H.; et al. Cytauxzoonosis in cats: ABCD guidelines on prevention and management. J. Feline Med. Surg. 2015, 17, 637–641. [Google Scholar] [CrossRef]
- Baneth, G.; Sheiner, A.; Eyal, O.; Hahn, S.; Beaufils, J.-P.; Anug, Y.; Talmi-Frank, D. Redescription of Hepatozoon felis (Apicomplexa: Hepatozoidae) based on phylogenetic analysis, tissue and blood form morphology, and possible transplacental transmission. Parasites Vectors 2013, 6, 102. [Google Scholar] [CrossRef]
- Criado-Fornelio, A.; Buling, A.; Cunha-Filho, N.; Ruas, J.; Farias, N.; Rey-Valeiron, C.; Pingret, J.; Etievant, M.; Barba-Carretero, J. Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp. Vet. Parasitol. 2007, 150, 352–356. [Google Scholar] [CrossRef]
- Jittapalapong, S.; Rungphisutthipongse, O.; Maruyama, S.; Schaefer, J.J.; Stich, R.W. Detection of Hepatozoon canis in Stray Dogs and Cats in Bangkok, Thailand. Ann. N. Y. Acad. Sci. 2006, 1081, 479–488. [Google Scholar] [CrossRef]
- Giannelli, A.; Latrofa, M.S.; Nachum-Biala, Y.; Hodžić, A.; Greco, G.; Attanasi, A.; Annoscia, G.; Otranto, D.; Baneth, G. Three different Hepatozoon species in domestic cats from southern Italy. Ticks Tick Borne Dis. 2017, 8, 721–724. [Google Scholar] [CrossRef] [PubMed]
- Kegler, K.; Nufer, U.; Alic, A.; Posthaus, H.; Olias, P.; Basso, W. Fatal infection with emerging apicomplexan parasite Hepatozoon silvestris in a domestic cat. Parasites Vectors 2018, 11, 428. [Google Scholar] [CrossRef]
- Tabar, M.-D.; Altet, L.; Francino, O.; Sánchez, A.; Ferrer, L.; Roura, X. Vector-borne infections in cats: Molecular study in Barcelona area (Spain). Vet. Parasitol. 2008, 151, 332–336. [Google Scholar] [CrossRef] [PubMed]
- Criado-Fornelio, A.; Ruas, J.L.; Casado, N.; Farias, N.A.R.; Soares, M.P.; Müller, G.; Brum, J.G.W.; Berne, M.E.A.; Buling-Saraña, A.; Barba-Carretero, J.C. New Molecular Data on Mammalian Hepatozoon Species (Apicomplexa: Adeleorina) from Brazil and Spain. J. Parasitol. 2006, 92, 93–99. [Google Scholar] [CrossRef]
- Schäfer, I.; Müller, E.; Nijhof, A.M.; Aupperle-Lellbach, H.; Loesenbeck, G.; Cramer, S.; Naucke, T.J. First evidence of vertical Hepatozoon canis transmission in dogs in Europe. Parasites Vectors 2022, 15, 296. [Google Scholar] [CrossRef] [PubMed]
- Lappin, M.R. Feline Haemoplasmas Are Not Transmitted by Ctenocephalides Feli. In Proceedings of the 9th Symposium of the CVBD World Forum, Lisbon, Portugal, 22–25 March 2014; pp. 44–46. [Google Scholar]
- Museux, K.; Boretti, F.S.; Willi, B.; Riond, B.; Hoelzle, K.; Hoelzle, L.E.; Wittenbrink, M.M.; Tasker, S.; Wengi, N.; Reusch, C.E.; et al. In vivo transmission studies of ‘Candidatus Mycoplasma turicensis’ in the domestic cat. Vet. Res. 2009, 40, 45. [Google Scholar] [CrossRef] [PubMed]
- Schäfer, I.; Kohn, B.; Müller, E. Anaplasma phagocytophilum in domestic cats from Germany, Austria and Switzerland and clinical/laboratory findings in 18 PCR-positive cats (2008–2020). J. Feline Med. Surg. 2022, 24, 290–297. [Google Scholar] [CrossRef]
- Bergmann, M.; Englert, T.; Stuetzer, B.; Hawley, J.R.; Lappin, M.R.; Hartmann, K. Prevalence of selected rickettsial infections in cats in Southern Germany. Comp. Immunol. Microbiol. Infect. Dis. 2015, 42, 33–36. [Google Scholar] [CrossRef]
- Hamel, D.; Bondarenko, A.; Silaghi, C.; Nolte, I.; Pfister, K. Seroprevalence and bacteremia [corrected] of Anaplasma phagocytophilum in cats from Bavaria and Lower Saxony (Germany). Berl. Munch. Tierarztl. Wochenschr. 2012, 125, 163–167. (In German) [Google Scholar]
- Morgenthal, D.; Hamel, D.; Arndt, G.; Silaghi, C.; Pfister, K.; Kempf, V.A.J.; Kohn, B. Prevalence of haemotropic Mycoplasma spp., Bartonella spp. and Anaplasma phagocytophilum in cats in Berlin/Brandenburg (Northeast Germany). Berl. Munch. Tierarztl. Wochenschr. 2012, 125, 418–427. (In German) [Google Scholar]
- Schäfer, I.; Weingart, C.; Kohn, B. Infection with Anaplasma phagocytophilum in a cat. Kleintierprax 2019, 64, 205–215. [Google Scholar]
- Bauer, N.; Balzer, H.-J.; Thüre, S.; Moritz, A. Prevalence of feline haemotropic mycoplasmas in convenience samples of cats in Germany. J. Feline Med. Surg. 2008, 10, 252–258. [Google Scholar] [CrossRef] [PubMed]
- Laberke, S.; Just, F.; Pfister, K.; Hartmann, K. Prevalence of feline haemoplasma infection in cats in Southern Bavaria, Germany, and infection risk factor analysis. Berl. Munch. Tierarztl. Wochenschr. 2010, 123, 42–48. [Google Scholar] [CrossRef]
- Bergmann, M.; Englert, T.; Stuetzer, B.; Hawley, J.R.; Lappin, M.R.; Hartmann, K. Risk factors of different hemoplasma species infections in cats. BMC Vet. Res. 2017, 13, 52. [Google Scholar] [CrossRef] [PubMed]
- Bergmann, M.; Englert, T.; Stuetzer, B.; Hawley, J.R.; Lappin, M.R.; Hartmann, K. Prevalence of Bartonella species infections in cats in Southern Germany. Vet. Rec. 2017, 180, 325. [Google Scholar] [CrossRef] [PubMed]
- Buchmann, A.U.; Kershaw, O.; Kempf, V.A.J.; Gruber, A.D. Does a Feline Leukemia Virus Infection Pave the Way for Bartonella henselae Infection in Cats? J. Clin. Microbiol. 2010, 48, 3295–3300. [Google Scholar] [CrossRef][Green Version]
- Mietze, A.; Morick, D.; Köhler, H.; Harrus, S.; Dehio, C.; Nolte, I.; Goethe, R. Combined MLST and AFLP typing of Bartonella henselae isolated from cats reveals new sequence types and suggests clonal evolution. Vet. Microbiol. 2011, 148, 238–245. [Google Scholar] [CrossRef]
- Panait, L.C.; Stock, G.; Globokar, M.; Balzer, J.; Groth, B.; Mihalca, A.D.; Pantchev, N. First report of Cytauxzoon sp. infection in Germany: Organism description and molecular confirmation in a domestic cat. Parasitol. Res. 2020, 119, 3005–3011. [Google Scholar] [CrossRef]
- Basso, W.; Görner, D.; Globokar, M.; Keidel, A.; Pantchev, N. First autochthonous case of clinical Hepatozoon felis infection in a domestic cat in Central Europe. Parasitol. Int. 2019, 72, 101945. [Google Scholar] [CrossRef]
- Schäfer, I.; Kohn, B.; Nijhof, A.M.; Müller, E. Molecular detection of Hepatozoon species infections in domestic cats living in Germany. J. Feline Med. Surg. 2021, 24, 994–1000. [Google Scholar] [CrossRef]
- Unterköfler, M.S.; Harl, J.; Barogh, B.S.; Spergser, J.; Hrazdilová, K.; Müller, F.; Jeschke, D.; Anders, O.; Steinbach, P.; Ansorge, H.; et al. Molecular analysis of blood-associated pathogens in European wildcats (Felis silvestris silvestris) from Germany. Int. J. Parasitol. Parasites Wildl. 2022, 19, 128–137. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Gallego, A.; Bernabe, L.F.; Dalmau, A.; Esteban-Saltiveri, D.; Font, A.; Leiva, M.; Ortuñez-Navarro, A.; Peña, M.-T.; Tabar, M.-D.; Real-Sampietro, L.; et al. Feline leishmaniosis: Diagnosis, treatment and outcome in 16 cats. J. Feline Med. Surg. 2020, 22, 993–1007. [Google Scholar] [CrossRef] [PubMed]
- Ortuño, A.; Castellà, J.; Criado-Fornelio, A.; Buling, A.; Barba-Carretero, J. Molecular detection of a Hepatozoon species in stray cats from a feline colony in North-eastern Spain. Vet. J. 2008, 177, 134–135. [Google Scholar] [CrossRef]
- Baneth, G.; Aroch, I.; Tal, N.; Harrus, S. Hepatozoon species infection in domestic cats: A retrospective study. Vet. Parasitol. 1998, 79, 123–133. [Google Scholar] [CrossRef]
- Beaufils, J.P.; Martin-Granel, J.; Jumelle, P. Hepatozoon spp. parasitemia and feline leukemia virus infection in two cats. Feline Pract. 1998, 26, 10–13. [Google Scholar]
- Macieira, D.B.; Menezes, R.d.C.A.d.; Damico, C.B.; Almosny, N.R.; McLane, H.L.; Daggy, J.K.; Messick, J.B. Prevalence and risk factors for hemoplasmas in domestic cats naturally infected with feline immunodeficiency virus and/or feline leukemia virus in Rio de Janeiro—Brazil. J. Feline Med. Surg. 2008, 10, 120–129. [Google Scholar] [CrossRef]
- Persichetti, M.F.; Pennisi, M.G.; Vullo, A.; Masucci, M.; Migliazzo, A.; Solano-Gallego, L. Clinical evaluation of outdoor cats exposed to ectoparasites and associated risk for vector-borne infections in southern Italy. Parasites Vectors 2018, 11, 136. [Google Scholar] [CrossRef] [PubMed]
- Gentilini, F.; Novacco, M.; Turba, M.E.; Willi, B.; Bacci, M.L.; Hofmann-Lehmann, R. Use of combined conventional and real-time PCR to determine the epidemiology of feline haemoplasma infections in northern Italy. J. Feline Med. Surg. 2009, 11, 277–285. [Google Scholar] [CrossRef]
- Sarvani, E.; Tasker, S.; Filipović, M.K.; Andrić, J.F.; Andrić, N.; Aquino, L.; English, S.; Attipa, C.; Leutenegger, C.M.; Helps, C.R.; et al. Prevalence and risk factor analysis for feline haemoplasmas in cats from Northern Serbia, with molecular subtyping of feline immunodeficiency virus. J. Feline Med. Surg. Open Rep. 2018, 4, 2055116918770037. [Google Scholar] [CrossRef]
- Vergara, R.W.; Galleguillos, F.M.; Jaramillo, M.G.; Almosny, N.R.P.; Martínez, P.A.; Behne, P.G.; Acosta-Jamett, G.; Müller, A. Prevalence, risk factor analysis, and hematological findings of hemoplasma infection in domestic cats from Valdivia, Southern Chile. Comp. Immunol. Microbiol. Infect. Dis. 2016, 46, 20–26. [Google Scholar] [CrossRef]
- Mackenstedt, U.; Jenkins, D.; Romig, T. The role of wildlife in the transmission of parasitic zoonoses in peri-urban and urban areas. Int. J. Parasitol. Parasites Wildl. 2015, 4, 71–79. [Google Scholar] [CrossRef]
- Panait, L.C.; Mihalca, A.D.; Modrý, D.; Juránková, J.; Ionică, A.M.; Deak, G.; Gherman, C.M.; Heddergott, M.; Hodžić, A.; Veronesi, F.; et al. Three new species of Cytauxzoon in European wild felids. Vet. Parasitol. 2021, 290, 109344. [Google Scholar] [CrossRef] [PubMed]
- Lesiczka, P.M.; Rudenko, N.; Golovchenko, M.; Juránková, J.; Daněk, O.; Modrý, D.; Hrazdilová, K. Red fox (Vulpes vulpes) play an important role in the propagation of tick-borne pathogens. Ticks Tick Borne Dis. 2023, 14, 102076. [Google Scholar] [CrossRef] [PubMed]
- Najm, N.-A.; Meyer-Kayser, E.; Hoffmann, L.; Pfister, K.; Silaghi, C. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: Molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitol. Res. 2014, 113, 2679–2685. [Google Scholar] [CrossRef]
- Ferrara, G.; Brocherel, G.; Falorni, B.; Gori, R.; Pagnini, U.; Montagnaro, S. A retrospective serosurvey of selected pathogens in red foxes (Vulpes vulpes) in the Tuscany region, Italy. Acta Vet. Scand. 2023, 65, 35. [Google Scholar] [CrossRef] [PubMed]
- Petruccelli, A.; Ferrara, G.; Iovane, G.; Schettini, R.; Ciarcia, R.; Caputo, V.; Pompameo, M.; Pagnini, U.; Montagnaro, S. Seroprevalence of Ehrlichia spp., Anaplasma spp., Borrelia burgdorferi sensu lato, and Dirofilaria immitis in Stray Dogs, from 2016 to 2019, in Southern Italy. Animals 2020, 11, 9. [Google Scholar] [CrossRef]
- Schäfer, I.; Kohn, B.; Silaghi, C.; Fischer, S.; Marsboom, C.; Hendrickx, G.; Müller, E. Molecular and Serological Detection of Anaplasma phagocytophilum in Dogs from Germany (2008–2020). Animals 2023, 13, 720. [Google Scholar] [CrossRef]
- Schäfer, I.; Kohn, B.; Volkmann, M.; Müller, E. Retrospective evaluation of vector-borne pathogens in cats living in Germany (2012–2020). Parasites Vectors 2021, 14, 123. [Google Scholar] [CrossRef]
- Pennisi, M.G.; Marsilio, F.; Hartmann, K.; Lloret, A.; Addie, D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; et al. Bartonella Species Infection in Cats: ABCD guidelines on prevention and management. J. Feline Med. Surg. 2013, 15, 563–569. [Google Scholar] [CrossRef]
- Álvarez-Fernández, A.; Maggi, R.; Martín-Valls, G.E.; Baxarias, M.; Breitschwerdt, E.B.; Solano-Gallego, L. Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia (Spain). Parasites Vectors 2022, 15, 6. [Google Scholar] [CrossRef]
- Probst, J.; Springer, A.; Strube, C. Year-round tick exposure of dogs and cats in Germany and Austria: Results from a tick collection study. Parasites Vectors 2023, 16, 70. [Google Scholar] [CrossRef] [PubMed]
- Schäfer, I.; Kohn, B. Anaplasma phagocytophilum infection in cats: A literature review to raise clinical awareness. J. Feline Med. Surg. 2020, 22, 428–441. [Google Scholar] [CrossRef] [PubMed]
- Gentil, M.; Zapf, F.; Heusinger, A.; Kohn, B.; Müller, E. Vorkommen von Babesia spp. and Cytauxzoon spp. bei Katzen in Europa. In Proceedings of the DVG-Kongress, DVG-Kongress 2021, Berlin, Germany, 18–20 November 2021. [Google Scholar]
- Lappin, M.R.; Hawley, J. Presence of Bartonella species and Rickettsia species DNA in the blood, oral cavity, skin and claw beds of cats in the United States. Vet. Dermatol. 2009, 20, 509–514. [Google Scholar] [CrossRef] [PubMed]
- Tasker, S.; Hofmann-Lehmann, R.; Belák, S.; Frymus, T.; Addie, D.D.; Pennisi, M.G.; Boucraut-Baralon, C.; Egberink, H.; Hartmann, K.; Hosie, M.J.; et al. Haemoplasmosis in cats: European guidelines from the ABCD on prevention and management. J. Feline Med. Surg. 2018, 20, 256–261. [Google Scholar] [CrossRef]
Pathogen | Gene Target | Primer Sequence (5′-3′) |
---|---|---|
Anaplasma phagocytophilum | 60 kDa heat shock protein | F: CTCTGAGCACGCTTGTACT R: GCCTTTACAGCAGCAACTTGAAG |
Rickettsia spp. | 23S rRNA | F: AGCTTGCTTTTGGATCATTTGG R: TTCCTTGCCTTTTCATACATCTAGT |
Mycoplasma haemofelis | 16S rDNA | F: GTGCTACAATGGCGAACACA R: TCCTATCCGAACTGAGACGAA |
Candidatus Mycoplasma hemominutum | 16S rDNA | F: TGATCTATTGTKAAAGGCACTTGCT R: TTAGCCTCYGGTGTTCCTCAA |
Candidatus Mycoplasma turicensis | 16S rDNA | F: AGAGGCGAAGGCGAAAACT R: CTACAACGCCGAAACACAAA |
Piroplasms (Babesia spp./Cytauxzoon sp.) | small subunit ribosomal DNA | F: AATACCCAATCCTGACACAGGG R: TTAAATACGAATGCCCCCAAC |
Hepatozoon spp. | 18S rRNA | F: AACACGGGAAAACTCACCAG R: CCTCAAACTTCCTCGCGTTA |
Pathogen | Direct Detection Methods (PCR) | Indirect Detection Methods (IFAT) |
---|---|---|
Anaplasma phagocytophilum | 2/50 (4) | 8/50 (16) |
Rickettsia spp. | 0/50 (0) | 15/50 (30) |
Hemotropic Mycoplasma spp. | 6/50 (12) | -/- |
Bartonella spp. | -/- | 23/50 (46) |
Piroplasms (Babesia spp./Cytauxzoon sp.) | 0/50 (0) | -/- |
Hepatozoon spp. | 5/50 (10) | -/- |
Total (including coinfections) | 11/50 (22) | 33/50 (66) |
Pathogen | Variables | B | SE | Wald | p | Odds Ratio | 95% CI for Odds Ratio (Lower/Upper Bound) |
---|---|---|---|---|---|---|---|
Anaplasma phagocytophilum PCR | Sex (male) | −0.930 | 1.510 | 0.379 | 0.538 | 0.395 | 0.020/7.618 |
Age (>3 years) | 1.482 | 1.512 | 0.961 | 0.327 | 4.402 | 0.227/85.233 | |
FIV (positive) | 18.806 | 10990.485 | 0.000 | 0.999 | - | - | |
Anaplasma phagocytophilum IFAT | Sex (male) | 0.1685 | 1.185 | 2.022 | 0.155 | 5.493 | 0.528/55.028 |
Age (>3 years) | 2.390 | 0.977 | 5.978 | 0.014 | 10.908 | 1.607/74.065 | |
FIV (positive) | 1.894 | 1.022 | 3.436 | 0.064 | 6.643 | 0.897/49.162 | |
Rickettsia spp. IFAT | Sex (male) | 0.573 | 0.708 | 0.655 | 0.418 | 1.774 | 0.443/7.106 |
Age (>3 years) | 0.835 | 0.717 | 1.357 | 0.244 | 2.304 | 0.566/9.389 | |
FIV (positive) | −0.275 | 0.787 | 0.122 | 0.727 | 0.759 | 0.162/3.552 | |
Bartonella spp. IFAT | Sex (male) | 0.247 | 0.607 | 0.166 | 0.684 | 1.281 | 0.390/4.206 |
Age (>3 years) | 0.110 | 0.673 | 0.027 | 0.870 | 1.116 | 0.299/4.170 | |
FIV (positive) | 0.141 | 0.680 | 0.043 | 0.836 | 1.151 | 0.304/4.206 | |
Candidatus Mycoplasma haemominutum PCR | Sex (male) | −1.345 | 0.939 | 2.051 | 0.152 | 0.260 | 0.041/1.642 |
Age (>3 years) | 0.378 | 0.991 | 0.145 | 0.703 | 1.459 | 0.209/10.171 | |
FIV (positive) | 0.183 | 1.002 | 0.033 | 0.855 | 1.201 | 0.168/8.558 | |
Hepatozoon spp. PCR | Sex (male) | −0.767 | 1.021 | 0.564 | 0.453 | 0.465 | 0.063/3.437 |
Age (>3 years) | 0.513 | 1.058 | 0.235 | 0.628 | 1.670 | 0.210/13.286 | |
FIV (positive) | −1.558 | 1.017 | 2.347 | 0.125 | 0.211 | 0.029/1.545 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schäfer, I.; Peukert, A.; Kerner, K.; Müller, E. Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia). Animals 2023, 13, 2574. https://doi.org/10.3390/ani13162574
Schäfer I, Peukert A, Kerner K, Müller E. Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia). Animals. 2023; 13(16):2574. https://doi.org/10.3390/ani13162574
Chicago/Turabian StyleSchäfer, Ingo, Axel Peukert, Katharina Kerner, and Elisabeth Müller. 2023. "Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia)" Animals 13, no. 16: 2574. https://doi.org/10.3390/ani13162574
APA StyleSchäfer, I., Peukert, A., Kerner, K., & Müller, E. (2023). Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia). Animals, 13(16), 2574. https://doi.org/10.3390/ani13162574