Next Article in Journal
Predictive Value of Acute Phase Proteins for the Short-Term Outcome of Meningoencephalitis of Unknown Origin in Dogs
Next Article in Special Issue
Study of Canine Distemper Virus Presence in Catalonia’s Wild Carnivores through H Gene Amplification and Sequencing
Previous Article in Journal
The Chicken cGAS–STING Pathway Exerts Interferon-Independent Antiviral Function via Cell Apoptosis
Previous Article in Special Issue
Unintentional Recovery of Parasitic Diversity Following Restoration of Red Deer (Cervus elaphus) in North-Western Italy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 16
10.3390/ani13162574
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia)

by
Ingo Schäfer
1,*,
Axel Peukert
2,
Katharina Kerner
1 and
Elisabeth Müller
1
1
LABOKLIN GmbH and Co. KG, Steubenstraße 4, 97688 Bad Kissingen, Germany
2
Small Animal Practice Oberweimar, Taubacher Straße 13, 99425 Weimar, Germany
*
Author to whom correspondence should be addressed.
Animals 2023, 13(16), 2574; https://doi.org/10.3390/ani13162574
Submission received: 1 July 2023 / Revised: 1 August 2023 / Accepted: 8 August 2023 / Published: 10 August 2023
(This article belongs to the Collection Wildlife Disease Ecology and Management)
Review Reports Versions Notes

Abstract

:

Simple Summary

There is currently no available data on the prevalence of vector-borne pathogens (VBPs) in stray cats in Germany. In this study, clinically healthy stray cats were investigated for selected VBPs. Of the 50 stray cats included, 22% tested positive for at least one VBP by direct and 64% by indirect detection methods. Stray cats may therefore represent important pathogen reservoirs and contribute to the spread of VBPs, many of which have zoonotic potential, for example, Bartonella spp., Rickettsia spp., and Anaplasma phagocytophilum.

Abstract

Bacterial, protozoal, and viral vector-borne pathogens (VBPs) can cause infections in cats. There is little information on feline VBP prevalence in Germany. Stray cats are frequently exposed to vectors but receive no veterinary care. The aim of this study was to determine the prevalence of selected VBPs in stray cats. EDTA blood and serum samples were taken from apparently healthy stray cats during a spay/neuter campaign in the federal state of Thuringia. Overall, 11/50 (22%) and 32/50 (64%) cats tested positive for at least one VBP by direct and indirect detection methods, respectively. PCR testing of EDTA blood detected hemotropic Mycoplasma spp. in 12% of cats, Hepatozoon spp. in 10%, and Anaplasma phagocytophilum in 4%. PCR testing for Rickettsia spp. and piroplasms was negative. IFAT on serum samples showed 46% of cats had detectable antibodies for Bartonella spp., 30% for Rickettsia spp., and 16% for A. phagocytophilum. The cats were additionally tested for feline coronavirus, FIV, and FeLV to identify potential risk factors for pathogen contact and/or infections. No correlation between FIV and FeLV status and VBP positivity was detected. Anaplasma phagocytophilum, Rickettsia spp., and Bartonella spp. have zoonotic potential, and surveillance is recommended in the context of the One Health approach.

1. Introduction

Vector-borne pathogens (VBPs) have become increasingly important to veterinary medicine due to changes in climate and a surge in pet travel and import. Additionally, domestic and international travel and trade carry the risk of vector introduction into currently non-endemic areas in Europe. Several bacterial, protozoan, helminthic, and viral VBPs are known to infect cats in Central Europe, all of which are mainly transmitted by blood-sucking arthropods. Anaplasma (A.) phagocytophilum is primarily transmitted by Ixodes (I.) ricinus ticks [1]. Fleas and other blood-sucking arthropods may be potential vectors for hemotropic Mycoplasma spp. [2,3]. Rickettsia (R.) felis is the most important Rickettsia sp. in cats in Germany and is transmitted by Ctenocephalides felis and Archaeopsylla erinacei [4]. The most important vector for Bartonella spp. is Ctenocephalides felis [5], though Bartonella henselae has been detected in I. ricinus ticks [6]. Cytauxzoon sp. is transmitted by ticks, likely Dermacentor spp. and/or I. ricinus [7]. Fleas, lice, and ticks are suspected vectors for Hepatozoon (H.) spp., of which, H. felis, H. canis, and H. silvestris are causing infections in cats [8,9,10,11,12,13,14]. Additionally, transplacental infections of H. felis may also be possible in cats [8] as such cases regarding H. canis have been confirmed in dogs [15]. It is suspected that Candidatus Mycoplasma haemominutum may be transmitted horizontally [16], and Candidatus Mycoplasma turicensis could be transmitted via bites and cat fights [17].
Stray cats usually do not have any veterinary care or ectoparasite prophylaxis, also vector exposure may be much more frequent than in their domestic counterparts. Previous studies on feline VBPs predominantly focused on domestic cats and may therefore not be representative of the stray population, as VBP prevalence could differ significantly. Infections with the following bacterial pathogens diagnosed by PCR have been reported in domestic cats: A. phagocytophilum in 0.3–4% of tested cats and as individual case reports [18,19,20,21,22], hemotropic Mycoplasma spp. with predominantly Candidatus Mycoplasma haemominutum in 7.2–22.5% of tested cats [21,23,24,25], and Bartonella spp. in 0–16% of tested cats [21,26,27,28]. There are no reports on the prevalence of R. felis in domestic cats in Germany. Regarding protozoal pathogens, a single report of an infection with Cytauxzoon sp. in a cat without a travel history in the federal state of Saarland in southern Germany has been published, which is the first autochthonous infection described in Germany [29]. There are individual case reports of feline autochthonous infections with Hepatozoon spp. in Central Europe, namely of H. felis in a cat from Austria [30] and of H. silvestris in a cat from Switzerland [12]. One study detected H. felis in sixteen cats living in Germany, all of which had a travel history [31].
There are limited data on wildcats: one study examined blood and splenic tissue of 96 European wildcats (Felis silvestris silvestris) between 1998 and 2020 and reported infections with Cytauxzoon europaeus (45/96 cats, 46.9%), H. silvestris (34/96 cats, 35.4%), Candidatus Mycoplasma haemominutum (7/96 cats, 7.3%), H. felis (6/96 cats, 6.3%), Bartonella spp. (3/96 cats, 3.1%), and Mycoplasma ovis (1/96, 1%) [32].
Immunosuppression, especially caused by feline leukemia virus (FeLV) and feline immunodeficiency virus (FIV), not only predisposes cats to infections with VBPs but also increases the rate of clinical manifestations in infected cats, as has been described in leishmaniosis [33], hepatozoonosis [34,35,36], and hemotropic mycoplasma [37,38,39,40,41].
There is currently no information on VBPs in stray cats in Germany. The aim of this study was to investigate stray cats caught as part of a spay/neuter campaign in the federal state of Thuringia in eastern Germany for several VBPs in order to determine VBP prevalence in this population.

2. Materials and Methods

Stray cats were caught in 14 different locations in the German federal state Thuringia and transported to the small animal practice Oberweimar (Weimar, Germany) as part of a spay/neuter program authorized by the local government (F-TIER220034). Ethylenediaminetetra-acetic acid (EDTA) blood and serum samples were taken prior to anesthesia to timely detect life-threatening hematological and biochemistry abnormalities. The samples were submitted by the practice to the commercial laboratory LABOKLIN (Bad Kissingen, Germany) between April and September 2022. Hematological analysis was performed on the Sysmex XN-V (Sysmex Deutschland GmbH, Norderstedt, Germany) and a routine biochemistry analysis on the Cobas 8000 (Roche Diagnostics Deutschland GmbH, Mannheim, Germany).
Wildcats were excluded from this study, as they were identified by their unique signalment and were not captured during the initial spay/neuter campaign. This study included only previously intact cats with unremarkable clinical examination.
Direct detection methods for selected VBPs included PCR or antigen testing on surplus sample material following hematology and biochemistry testing. TaqMan® real-time PCR testing was performed on deoxyribonucleic acid isolated from EDTA blood samples for A. phagocytophilum, Rickettsia spp., hemotropic Mycoplasma spp., piroplasms, and Hepatozoon spp. (Table 1). PCR results were evaluated on a qualitative basis (negative/positive only) with a cut-off Ct value of 35. Each PCR run included a negative and a positive control as well as an extraction control for each sample to confirm nucleic acid extraction and exclude PCR inhibition (DNA Process Control Detection Kit, Roche Diagnostics Deutschland GmbH, Mannheim, Germany). EDTA blood was also used for antigen testing for FeLV (NovaTec VetLine Feline Leukemia Virus Antigen ELISA, NovaTec Immundiagnostica, Dietzenbach, Germany).
Sera were used for antibody testing. As an indirect detection method, immunofluorescence antibody testing (IFAT) was performed for A. phagocytophilum (MegaFLUO ANAPLASMA; MegaCor Diagnostik GmbH, Lindau, Germany), Rickettsia spp. (RICKETTSIA CONORII IFA SLIDE, Viracell, Granada, Spain), and Bartonella spp. (MegaFLUO BARTONELLA henselae; MegaCor Diagnostik GmbH, Lindau, Germany) in accordance with manufacturer guidelines. Antibody ELISA was used to test for FIV (NovaTec VetLine Feline Immunodeficiency Virus ELISA, NovaTec Immundiagnostica, Dietzenbach, Germany) and feline coronavirus (NovaTec VetLine Feline Corona Virus (FCoV/FIP) ELISA, NovaTec Immundiagnostica, Dietzenbach, Germany).
According to the terms and conditions of the laboratory LABOKLIN as well as the decision of the government of Lower Franconia RUF-55.2.2.2532-1-86-5, neither permission from animal owners nor approval by the animal welfare commission is necessary for additional testing on residual sample material once diagnostics are completed.
Descriptive statistical analysis was performed using SPSS for Windows (version 28.0; IBM). p < 0.05 was considered statistically significant. Shapiro–Wilk test was used for assessment of normal distribution. Kruskal–Wallis test was used to calculate statistical significance between the study groups. Bonferroni correction was applied where necessary. Binary logistic regression analyses (bivariate) were performed to determine the effect of sex, age, and FIV antibody presence on PCR results.

3. Results

Of the 50 stray cats included in this study, 18 (36.0%) were male and 32 (64.0%) were female. An approximate age was documented in 48/50 cats, estimated by the veterinarian based on general and dental examination findings (96.0%, median 3.0 years, standard deviation 2.1 years, minimum 0.3 years, maximum 8 years). Rectal temperature (median 38.5 °C, standard deviation 0.5 °C, minimum 37.3 °C, maximum 39.4 °C) and bodyweight (median 3.0 kg, standard deviation 1.0 kg, minimum 1.3 kg, maximum 5.6 kg) were documented for all cats. The stray cats were caught in 15 different locations surrounding the Weimarer Land region in Germany (Ettersburg n = 10, Niederreißen n = 10, Großobringen n = 5, Hohenfelden n = 4, Tonndorf n = 4, Lehnstedt n = 3, Niedergrundstedt n = 3, Weimar-Schöndorf n = 3, Meckfeld n = 2, Bucha n = 1, Daasdorf n = 1, Guthmannshausen n = 1, Heichelheim n = 1, Holzdorf n = 1, Lengefeld n = 1).
The results of direct and indirect detection methods for the selected VBPs can be seen in Table 2. PCR testing was positive for at least one VBP in 11/50 cats (22.0%), most notably for hemotropic Mycoplasma spp. (6/50 cats, 12.0%, all Candidatus Mycoplasma haemominutum), Hepatozoon spp. (5/50 cats, 10.0%), and A. phagocytophilum (2/50 cats, 4.0%). More than half of the cats in this study had antibody titers for at least one pathogen (33/50 cats, 66%) (Table 2).
The multiple logistic regression model was statistically significant in cats with A. phagocytophilum antibodies detected by IFAT (constant: B = −4.397, SE = 1.491, Wald = 8.692, p = 0.003). Cats older than 3 years had 10.908 times greater odds of antibody titers than their younger counterparts (95% confidence interval 1.607; 74.506) (Table 3).
Biochemistry results were available for all cats in this study, while hematology results were available for all save one cat (2%). The most common hematological abnormality was leukocytosis (24/49 cats, 49.0%), most often in combination with eosinophilia (24/49 cats, 49.0%) and neutrophilia (14/49 cats, 28.6%). The most frequent biochemical abnormalities were elevated creatine kinase (36/50 cats, 72.0%), hyperglycemia (28/50 cats, 56.0%), and hyperphosphatemia (25/50 cats, 50.0%) (Supplementary Table S1).
PCR results did not have any statistically significant impact on hematocrit, white blood cell count, or platelet count (all p > 0.05). Regarding biochemistry, there was a statistically significant difference in alanine transaminase (ALT) levels in cats with Hepatozoon spp. infection and those with negative PCR (p = 0.036, Supplementary Table S1).
There was one case of mild anemia (hematocrit 29%) in a cat with a coinfection of A. phagocytophilum and Hepatozoon spp. Furthermore, mild leukocytosis was detected in three cats with Candidatus Mycoplasma haemominutum infections (11.1–16.8 × 109/L) and one cat infected with Hepatozoon spp. (17.3 × 109/L). There were no cases of thrombocytopenia in cats with positive PCR of any VBP (Supplementary Figure S1, Supplementary Table S1).
A. phagocytophilum was detected by PCR in two cats, both of which also showed positive antibody titers for the pathogen (1:40, 1:320). The first cat was caught in Ettersberg. In addition to A. phagocytophilum, this cat also tested positive for Hepatozoon spp. by PCR and had antibodies to R. felis (1:128) and mild non-regenerative anemia (hematocrit 29%). The second cat was caught in Nierderreißen. It additionally tested positive for Candidatus Mycoplasma haemominutum and showed mild lymphopenia. Both cats were hyperglycemic and had mildly elevated creatine kinase levels.
Five cats had positive PCR results for Hepatozoon spp, all of which had been caught in Ettersburg. One additionally tested positive for A. phagocytophilum, as mentioned above. Three cats (60.0%) had FIV antibody titers. Serology showed antibodies to R. felis in 3/5 cats (60.0%; 1:128 n = 2, 1:256 n = 1) and to A. phagocytophilum also in 3/5 cats (1:40 n = 1, 1:320 n = 2). One cat (20.0%) was mildly anemic, and another (20.0%) had mild leukocytosis with neutrophilia. Two cats (40%) had mildly elevated creatine kinase levels (201 and 171 mmol/L).
Six cats had positive PCR results for Candidatus Mycoplasma haemominutum. Among them, serology revealed FIV antibodies in two cats (33.3%), Bartonella spp. antibodies in two cats (33.3%, 1:40, and 1:320), A. phagocytophilum antibodies in two cats (33.3%, 1:40 and 1:320), and R. felis antibodies in one cat (16.7%, 1:128). Three cats (50.0%) had mild leukocytosis, one of which also had mild lymphocytosis and eosinophilia. One cat (16.7%) had mild thrombocytosis. None of these cats were anemic. All six cats were caught in different locations.
FIV antibodies were detected in 12/50 cats (24.0%; Table 1). Among them, five (41.7%) tested positive for at least one VBP by PCR (Hepatozoon spp. n = 3; Candidatus Mycoplasma haemominutum n = 2). Serology showed 9/12 cats (75.0%) had antibodies to feline coronavirus, six (50.0%) to Bartonella spp., four (33.3%) to A. phagocytophilum, and three (25.0%) for Rickettsia felis. None of the twelve cats were anemic, but six (50.0%) had eosinophilia, five (41.7%) had mild leukocytosis, and one cat (8.3%) was mildly thrombocytopenic.
Two cats presented with mild anemia, one of which has been described above. The second cat had a hematocrit of 24%, as well as moderate leukocytosis with neutrophilia, lymphocytosis, monocytosis, and no signs of regeneration. No VBPs were detected in this cat.

4. Discussion

This is the first study to evaluate clinically healthy stray cats affected by selected VBPs in Germany. Sharing environment may prove to be an important link between the domestic cats and local wildlife. Such comparisons between these two groups are therefore of great interest not only to veterinary clinical practice but also to public health in both short and long term. The importance of wildlife, dogs, and horses as pathogen reservoirs has been well documented, but the significance of cats in the epidemiology of several VBPs is still largely unknown [42].
Wildcats have similar living conditions compared to stray cats and under normal circumstances do not receive any veterinary care or ectoparasite prophylaxis. A study with 96 wildcats in Germany reported VBPs in 67/96 cats (70%) tested by PCR on spleen aspirates and whole blood [32] with a spectrum of pathogens analyzed that was comparable to our study. The pathogens detected included Cytauxzoon europaeus (n = 45), Hepatozoon spp. (n = 40), Candidatus Mycoplasma haemominutum (n = 7), and Bartonella spp. (n = 3), while PCR testing for Anaplasmataceae and Rickettsiales was negative in all wildcats [32]. The higher overall rate of positive PCR results compared to our study (22%) might be explained by the fact that the study on wildcats did not include a health screening and therefore would have included cats with clinical manifestations, which were excluded in our study accordingly, as only cats classified as clinically healthy underwent surgery. It should be noted that the infection rate with Hepatozoon spp. (42%, predominantly H. silvestris (n = 34) and H. felis (n = 6)) was much higher in this study from 2022 [32] than in our study of stray cats (10%, no sequencing performed). Species differentiation was not available due to the small volumes obtained and might have revealed an explanation for the different rates of positivity. All affected stray cats in this study were caught in the same location, which may indicate a pronounced regionality of pathogen distribution. While piroplasms were not detected in any cats of this study, two previous studies in wildcats from Germany reported Cytauxzoon europaeus infection rates of 4% [32] and 65% [43], respectively. In this case, the difference in infection rates may be due to absence of competent vectors and/or the pathogen itself in the geographical area of our study or due to potential differences in susceptibility for this VBP in wildcats, domestic cats, and stray cats.
Foxes have been established as a crucial contributor to VBP transmission in Central Europe in recent years. In a study of red foxes (Vulpes vulpes) from the Czech Republic, 94% tested positive by PCR for at least one of seven tick-borne pathogens, including H. canis (81%) and A. phagocytophilum (3%) [44]. In a German study examining splenic tissue from red foxes for Hepatozoon spp., 45% tested positive [45]. In Italy, 5.2% of red foxes tested had detectable antibodies to A. phagocytophilum [46]. These studies did not discriminate between healthy animals and those with clinical manifestations, which may explain the higher rate of positive PCR results. Serology results, however, were more comparable.
In stray dogs from Southern Italy, Anaplasma spp. seroprevalence was reported to be 7.8% [47], a rate much lower than in the cats of this study (16%). It should be noted that I. ricinus ticks, a crucial vector for A. phagocytophilum, are more prevalent in Northern Italy and that the study in question used different diagnostic assays. Both factors directly impair the comparison of data and may explain the discrepancy of only 5% of dogs in Germany testing positive by PCR while 27% tested positive by serological testing [48] the same was observed for domestic cats in Germany where 4% tested positive by PCR and 23% by IFAT respectively [18]. These numbers are consistent to the findings of this study where 4% of stray cats tested positive by PCR and 23% showed increased antibody titers for A. phagocytophilum.
One previous study in domestic cats in Germany reported infection rates of 9% for Hepatozoon spp. (PCR) and 11% for Rickettsia spp. (IFAT) [49], both linked to travel history. In a further study of domestic cats from Germany, Heptozoon spp was detected in 7% by PCR [31]. While it is impossible to ascertain any travel history in strays, both studies had comparable prevalence rates to our study regarding stray cats (10%). The seroprevalence of Bartonella spp. in Europe varies greatly in the literature (8–81%), likely depending on chosen area and corresponding to flea prevalence [50]. Regarding domestic cats in Germany, the antibody prevalence is overall lower, ranging from 0% to 16% respectively [21,26,27,28]. The stray cat seroprevalence our study is remarkably higher, reaching 46%, most likely due to higher exposure to the main vector Ctenocephalides felis [5]. Even higher seropositivity was seen in a colony of stray cats from Spain (81%) and cats having an owner [51]. Cats are often subclinical carriers of Bartonella spp. and represent their principal reservoir [50]. Feral cats may therefore represent an important zoonotic pathogen reservoir, as Bartonella henselae may cause cat scratch disease in humans. There is limited knowledge about the prevalence of A. phagocytophilum in domestic cats in Germany, though it has been reported that the vector most frequently found on domestic cats is the I. ricinus tick (91%) [52], a well-established vector for A. phagocytophilum. A total of one study demonstrated an infection rate of 3% (18/619 cats) and antibody presence in 23% (191/847) of domestic cats [18], which corresponds to our findings (positive PCR in 4%, positive IFAT in 16%). Both cats with positive PCR results also had detectable antibody titers, which is consistent with the literature [18,53]. Fever is one of the most common clinical signs in A. phagocytophilum infections [53], while only clinically healthy cats based on a general examination were included, therefore acute infections were probably underrepresented in this cohort. In domestic cats in Germany, infections with Hepatozoon spp. are usually associated with a travel history to endemic countries [49]. However, individual autochthonous infections have been reported in Austria (H. felis) [30] and Switzerland (H. silvestris) [12]. Transplacental infections may occur in dogs with H. canis [15], though this transmission route has not been documented in cats [8]. It is very likely that the stray cats in this study were infected in Germany. Hepatozoonosis in domestic cats is strongly associated with outdoor access [8], which may explain the higher prevalence in wildcats and stray cats. Regarding piroplasms, a study of 552 cats, 65% of which were from Germany, did not report any Cytauxzoon sp. Infections [54], while another study reported a single autochthonous infection with Cytauxzoon sp. In the southern German federal state of Saarland [29]. The results of our study in stray cats are therefore most consistent with what has been documented in domestic cats, as piroplasm infections in cats are overall rare occurrence in Europe.
Rickettsia felis is the most important rickettsial species in cats in Germany where it is transmitted by Ctenocephalides felis and Archaeopsylla rinaceid [4]. Knowledge of rickettsial infections in cats is limited. DNA of Rickettsia felis has so far been detected in feline samples of skin and gingiva but never in peripheral blood [55]. As EDTA blood is considered suboptimal for direct detection of Rickettsia felis, the true infection rate in the stray cats examined may be underrepresented.
As many of the relevant vectors show pronounced seasonality, the time of the year chosen for sampling may influence PCR detection rates. Nevertheless, it is remarkable that 22% of stray cats tested positive by PCR and 66% had positive serology for at least one VBP. Positive PCR results are largely indicative of an acute infection, while antibody detection could also show past contact with the pathogen.
VBP occurrence is generally associated with the distribution of vectors, which can be influenced by changes in climate, land use, human density, and pathogen reservoirs. In general, immunosuppression, especially caused by the feline leukemia virus (FeLV) and feline immunodeficiency virus (FIV), not only predisposes cats to infections with VBPs but also increases the rate of clinical manifestations in already infected cats. This has been described for cats with leishmaniosis [33], hepatozoonosis [34,35,36], and infections of hemotropic Mycoplasma spp. [37,38,39,40,41]. Multiple logistic regression analysis did not show any statistically significant impact of FIV status on positive PCR results in this study. However, the selection criteria may have influenced the statistical analysis, as our cohort only included clinically healthy cats. No FeLV-positive cats were included in this study, therefore no effect of FeLV status on diagnostic test results could be investigated.
Stray cats older than three years had more than ten times higher odds of testing positive for A. phagocytophilum than their younger counterparts (OR 10.908, 95% CI [1.607; 74.056]), which can be explained by the cumulative exposure risk that comes with older age. While not statistically significant, a similar trend was seen for Rickettsia spp. (OR 2.304, 95% CI [0.566; 9.389]) and Bartonella spp. (OR 1.116, 95% CI [0.299; 4.170]).
All six stray cats testing positive for hemotropic Mycoplasma spp. in this study were infected with Candidatus Mycoplasma haemominutum. None of these animals were anemic, while three cats showed mild leukocytosis. This is consistent with the literature reporting no significant hematological abnormalities in majority of cats infected with Candidatus Mycoplasma haemominutum [56]. Two out of six infected stray cats in this study (33%) additionally tested positive for FIV antibodies. Previous studies are divided on the role of FIV in hemotropic mycoplasma infections in cats [37,38,39,40,41].
There appears to be no association between Hepatozoon spp. infections and either gender or age of the cats [8], however, studies are divided on the impact of FIV and FeLV infection [34,35,36]. Three out of five stray cats (60%) with Hepatozoon spp. infections also tested positive for FIV, and one more cat showed an inconclusive result. This indicates that immunosuppression may be a predisposing factor to Hepatozoon spp. infection, though there was no statistically significant impact on diagnostic test results in this study. However, this could be explained through the low numbers of feral cats included in this study. Further research may be of interest.
The small cohort of this study limits the value of the correlation between hematology or biochemistry findings and VBPs, especially for Hepatozoon spp., hemotropic Mycoplasma spp., and coinfections. However, there was a statistically significant difference in the alanine transaminase (ALT) levels between cats with positive and negative PCR results for Hepatozoon spp. An underlying cause for ALT elevations in Hepatozoon spp. infections is not known, but this finding could also be related to pathological changes not evident during general examination.
Thrombocytopenia is the most diagnostically relevant hematological finding in cats with A. phagocytophilum infections, followed by anemia and leukopenia [53]. Neither of the two stray cats infected with A. phagocytophilum in this study was thrombocytopenic. One cat coinfected with Hepatozoon spp. and A. phagocytophilum did show mild anemia, which is consistent with the literature [53]. In fact, domestic cats infected with Hepatozoon spp. often demonstrate no hematological abnormalities, as shown in a previous study where 50% of cats (6/12) with positive PCR results showed unremarkable hematology results [31]. In our study two of five stray cats (40%) with positive Hepatozoon PCR showed mild hematological abnormalities, while the remainder was unremarkable.
The most remarkable biochemical abnormalities noted were hyperglycemia and elevations in creatine kinase. The hyperglycemia was probably observed due to the stress of handling the feral cats in the practice. Elevations in creatine kinase often indicate muscular trauma, which in this case, was likely related to catching and handling the animals. It is therefore quite unlikely that any VBP infections were the cause of these biochemical anomalies. Still, it should be noted that elevations in creatine kinase may be a manifestation of feline heaptozoonosis [35]. The tropism of Hepatozoon spp. for muscle tissues was confirmed for H. felis [8] and H. silvestris infections [12] but is currently unknown for H. canis infections in cats. In the feral cats, muscular damage due to handling and/or due to the infection with Hepatozoon spp. was possible.
This study indicates that stray cats in Germany are quite commonly exposed to various VBPs. These stray cats share environment with wildcats and domestic cats with outdoor access, causing a risk of infection across all three groups. Additional studies are necessary to clarify potential routes of transmission, the role of cats in these transmission cycles, and the clinical impact of VBPs on cats in general. All cats in this study were asymptomatic, and even in the infected cats, hematological anomalies were rare. Considering the zoonotic potential of A. phagocytophilum, Rickettsia spp., and Bartonella spp. and their importance in the One Health approach, the possibility of subclinical infections with these pathogens in stray cats is of concern. We could not demonstrate a link between immunosuppression caused, e.g., by FeLV or FIV, and VBPs in this study. The high exposure rates to at least one of the seven VBPs reveal a high frequency of occurrence and thus is of potentially high significance within the One Health concept.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13162574/s1, Figure S1: Results of selected hematological analysis in 49 stray cats in Germany sorted by negative PCR results and positive results for coinfections (Anaplasma phagocytophilum and Hepatozoon spp., Anaplasma phagocytophilum and hemotropic Mycoplasma spp.), Hepatozoon spp., and hemotrophic Mycoplasma spp.; Table S1: Hematological and biochemical parameters in 50 apparently healthy stray cats in Thurinigia (Germany) presenting numbers of cats with elevated and decreased parameters according to the reference interval (RI) by the laboratory in cats tested negative, in cats with coinfections, and in cats tested positive for Hepatozoon spp. and hemotropic Mycoplasma spp. by polymerase chain reaction (PCR).

Author Contributions

Conceptualization, I.S. and E.M.; Data curation, I.S.; Formal analysis, I.S.; Investigation, I.S. and K.K.; Methodology, I.S., A.P., K.K. and E.M.; Project administration, I.S., A.P., K.K. and E.M.; Resources, A.P.; Software, I.S.; Supervision, E.M.; Validation, I.S. and E.M.; Visualization, I.S.; Writing—original draft, I.S.; Writing—review and editing, A.P., K.K. and E.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Ethical review and approval were waived for this study due to authorization by the local government (F-TIER220034).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would like to thank Anna Sophia Müller MB, BCh, BAO, for revision of the manuscript and language editing.

Conflicts of Interest

E.M. is the CEO of the commercial laboratory LABOKLIN (Bad Kissingen, Germany). I.S. and K.K. are employees of the laboratory. This has not influenced the results of this study in any way. There are no relevant financial and non-financial competing interests to report.

References

  1. Katavolos, P.; Armstrong, P.M.; Dawson, J.E.; Iii, S.R.T. Duration of Tick Attachment Required for Transmission of Granulocytic Ehrlichiosis. J. Infect. Dis. 1998, 177, 1422–1425. [Google Scholar] [CrossRef]
  2. Lappin, M.R.; Griffin, B.; Brunt, J.; Riley, A.; Burney, D.; Hawley, J.; Brewer, M.M.; Jensen, W.A. Prevalence of Bartonella species, haemoplasma species, Ehrlichia species, Anaplasma phagocytophilum, and Neorickettsia risticii DNA in the blood of cats and their fleas in the United States. J. Feline Med. Surg. 2006, 8, 85–90. [Google Scholar] [CrossRef] [PubMed]
  3. Pennisi, M.-G.; Persichetti, M.-F.; Serrano, L.; Altet, L.; Reale, S.; Gulotta, L.; Solano-Gallego, L. Ticks and associated pathogens collected from cats in Sicily and Calabria (Italy). Parasites Vectors 2015, 8, 512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Gilles, J.; Just, F.T.; Silaghi, C.; Pradel, I.; Passos, L.M.F.; Lengauer, H.; Hellmann, K.; Pfister, K. Rickettsia felis in Fleas, Germany. Emerg. Infect. Dis. 2008, 14, 1294–1296. [Google Scholar] [CrossRef] [PubMed]
  5. Bouhsira, E.; Ferrandez, Y.; Liu, M.; Franc, M.; Boulouis, H.-J.; Biville, F. Ctenocephalides felis an in vitro potential vector for five Bartonella species. Comp. Immunol. Microbiol. Infect. Dis. 2013, 36, 105–111. [Google Scholar] [CrossRef]
  6. Cotté, V.; Bonnet, S.; Le Rhun, D.; Le Naour, E.; Chauvin, A.; Boulouis, H.-J.; Lecuelle, B.; Lilin, T.; Vayssier-Taussat, M. Transmission of Bartonella henselae by Ixodes ricinus. Emerg. Infect. Dis. 2008, 14, 1074–1080. [Google Scholar] [CrossRef]
  7. Lloret, A.; Addie, D.D.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; Hartmann, K.; Horzinek, M.C.; Hosie, M.J.; Lutz, H.; et al. Cytauxzoonosis in cats: ABCD guidelines on prevention and management. J. Feline Med. Surg. 2015, 17, 637–641. [Google Scholar] [CrossRef]
  8. Baneth, G.; Sheiner, A.; Eyal, O.; Hahn, S.; Beaufils, J.-P.; Anug, Y.; Talmi-Frank, D. Redescription of Hepatozoon felis (Apicomplexa: Hepatozoidae) based on phylogenetic analysis, tissue and blood form morphology, and possible transplacental transmission. Parasites Vectors 2013, 6, 102. [Google Scholar] [CrossRef] [Green Version]
  9. Criado-Fornelio, A.; Buling, A.; Cunha-Filho, N.; Ruas, J.; Farias, N.; Rey-Valeiron, C.; Pingret, J.; Etievant, M.; Barba-Carretero, J. Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp. Vet. Parasitol. 2007, 150, 352–356. [Google Scholar] [CrossRef]
  10. Jittapalapong, S.; Rungphisutthipongse, O.; Maruyama, S.; Schaefer, J.J.; Stich, R.W. Detection of Hepatozoon canis in Stray Dogs and Cats in Bangkok, Thailand. Ann. N. Y. Acad. Sci. 2006, 1081, 479–488. [Google Scholar] [CrossRef]
  11. Giannelli, A.; Latrofa, M.S.; Nachum-Biala, Y.; Hodžić, A.; Greco, G.; Attanasi, A.; Annoscia, G.; Otranto, D.; Baneth, G. Three different Hepatozoon species in domestic cats from southern Italy. Ticks Tick Borne Dis. 2017, 8, 721–724. [Google Scholar] [CrossRef] [PubMed]
  12. Kegler, K.; Nufer, U.; Alic, A.; Posthaus, H.; Olias, P.; Basso, W. Fatal infection with emerging apicomplexan parasite Hepatozoon silvestris in a domestic cat. Parasites Vectors 2018, 11, 428. [Google Scholar] [CrossRef] [Green Version]
  13. Tabar, M.-D.; Altet, L.; Francino, O.; Sánchez, A.; Ferrer, L.; Roura, X. Vector-borne infections in cats: Molecular study in Barcelona area (Spain). Vet. Parasitol. 2008, 151, 332–336. [Google Scholar] [CrossRef] [PubMed]
  14. Criado-Fornelio, A.; Ruas, J.L.; Casado, N.; Farias, N.A.R.; Soares, M.P.; Müller, G.; Brum, J.G.W.; Berne, M.E.A.; Buling-Saraña, A.; Barba-Carretero, J.C. New Molecular Data on Mammalian Hepatozoon Species (Apicomplexa: Adeleorina) from Brazil and Spain. J. Parasitol. 2006, 92, 93–99. [Google Scholar] [CrossRef]
  15. Schäfer, I.; Müller, E.; Nijhof, A.M.; Aupperle-Lellbach, H.; Loesenbeck, G.; Cramer, S.; Naucke, T.J. First evidence of vertical Hepatozoon canis transmission in dogs in Europe. Parasites Vectors 2022, 15, 296. [Google Scholar] [CrossRef] [PubMed]
  16. Lappin, M.R. Feline Haemoplasmas Are Not Transmitted by Ctenocephalides Feli. In Proceedings of the 9th Symposium of the CVBD World Forum, Lisbon, Portugal, 22–25 March 2014; pp. 44–46. [Google Scholar]
  17. Museux, K.; Boretti, F.S.; Willi, B.; Riond, B.; Hoelzle, K.; Hoelzle, L.E.; Wittenbrink, M.M.; Tasker, S.; Wengi, N.; Reusch, C.E.; et al. In vivo transmission studies of ‘Candidatus Mycoplasma turicensis’ in the domestic cat. Vet. Res. 2009, 40, 45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Schäfer, I.; Kohn, B.; Müller, E. Anaplasma phagocytophilum in domestic cats from Germany, Austria and Switzerland and clinical/laboratory findings in 18 PCR-positive cats (2008–2020). J. Feline Med. Surg. 2022, 24, 290–297. [Google Scholar] [CrossRef]
  19. Bergmann, M.; Englert, T.; Stuetzer, B.; Hawley, J.R.; Lappin, M.R.; Hartmann, K. Prevalence of selected rickettsial infections in cats in Southern Germany. Comp. Immunol. Microbiol. Infect. Dis. 2015, 42, 33–36. [Google Scholar] [CrossRef]
  20. Hamel, D.; Bondarenko, A.; Silaghi, C.; Nolte, I.; Pfister, K. Seroprevalence and bacteremia [corrected] of Anaplasma phagocytophilum in cats from Bavaria and Lower Saxony (Germany). Berl. Munch. Tierarztl. Wochenschr. 2012, 125, 163–167. (In German) [Google Scholar]
  21. Morgenthal, D.; Hamel, D.; Arndt, G.; Silaghi, C.; Pfister, K.; Kempf, V.A.J.; Kohn, B. Prevalence of haemotropic Mycoplasma spp., Bartonella spp. and Anaplasma phagocytophilum in cats in Berlin/Brandenburg (Northeast Germany). Berl. Munch. Tierarztl. Wochenschr. 2012, 125, 418–427. (In German) [Google Scholar]
  22. Schäfer, I.; Weingart, C.; Kohn, B. Infection with Anaplasma phagocytophilum in a cat. Kleintierprax 2019, 64, 205–215. [Google Scholar]
  23. Bauer, N.; Balzer, H.-J.; Thüre, S.; Moritz, A. Prevalence of feline haemotropic mycoplasmas in convenience samples of cats in Germany. J. Feline Med. Surg. 2008, 10, 252–258. [Google Scholar] [CrossRef] [PubMed]
  24. Laberke, S.; Just, F.; Pfister, K.; Hartmann, K. Prevalence of feline haemoplasma infection in cats in Southern Bavaria, Germany, and infection risk factor analysis. Berl. Munch. Tierarztl. Wochenschr. 2010, 123, 42–48. [Google Scholar] [CrossRef]
  25. Bergmann, M.; Englert, T.; Stuetzer, B.; Hawley, J.R.; Lappin, M.R.; Hartmann, K. Risk factors of different hemoplasma species infections in cats. BMC Vet. Res. 2017, 13, 52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Bergmann, M.; Englert, T.; Stuetzer, B.; Hawley, J.R.; Lappin, M.R.; Hartmann, K. Prevalence of Bartonella species infections in cats in Southern Germany. Vet. Rec. 2017, 180, 325. [Google Scholar] [CrossRef] [PubMed]
  27. Buchmann, A.U.; Kershaw, O.; Kempf, V.A.J.; Gruber, A.D. Does a Feline Leukemia Virus Infection Pave the Way for Bartonella henselae Infection in Cats? J. Clin. Microbiol. 2010, 48, 3295–3300. [Google Scholar] [CrossRef] [Green Version]
  28. Mietze, A.; Morick, D.; Köhler, H.; Harrus, S.; Dehio, C.; Nolte, I.; Goethe, R. Combined MLST and AFLP typing of Bartonella henselae isolated from cats reveals new sequence types and suggests clonal evolution. Vet. Microbiol. 2011, 148, 238–245. [Google Scholar] [CrossRef]
  29. Panait, L.C.; Stock, G.; Globokar, M.; Balzer, J.; Groth, B.; Mihalca, A.D.; Pantchev, N. First report of Cytauxzoon sp. infection in Germany: Organism description and molecular confirmation in a domestic cat. Parasitol. Res. 2020, 119, 3005–3011. [Google Scholar] [CrossRef]
  30. Basso, W.; Görner, D.; Globokar, M.; Keidel, A.; Pantchev, N. First autochthonous case of clinical Hepatozoon felis infection in a domestic cat in Central Europe. Parasitol. Int. 2019, 72, 101945. [Google Scholar] [CrossRef]
  31. Schäfer, I.; Kohn, B.; Nijhof, A.M.; Müller, E. Molecular detection of Hepatozoon species infections in domestic cats living in Germany. J. Feline Med. Surg. 2021, 24, 994–1000. [Google Scholar] [CrossRef]
  32. Unterköfler, M.S.; Harl, J.; Barogh, B.S.; Spergser, J.; Hrazdilová, K.; Müller, F.; Jeschke, D.; Anders, O.; Steinbach, P.; Ansorge, H.; et al. Molecular analysis of blood-associated pathogens in European wildcats (Felis silvestris silvestris) from Germany. Int. J. Parasitol. Parasites Wildl. 2022, 19, 128–137. [Google Scholar] [CrossRef] [PubMed]
  33. Fernandez-Gallego, A.; Bernabe, L.F.; Dalmau, A.; Esteban-Saltiveri, D.; Font, A.; Leiva, M.; Ortuñez-Navarro, A.; Peña, M.-T.; Tabar, M.-D.; Real-Sampietro, L.; et al. Feline leishmaniosis: Diagnosis, treatment and outcome in 16 cats. J. Feline Med. Surg. 2020, 22, 993–1007. [Google Scholar] [CrossRef] [PubMed]
  34. Ortuño, A.; Castellà, J.; Criado-Fornelio, A.; Buling, A.; Barba-Carretero, J. Molecular detection of a Hepatozoon species in stray cats from a feline colony in North-eastern Spain. Vet. J. 2008, 177, 134–135. [Google Scholar] [CrossRef]
  35. Baneth, G.; Aroch, I.; Tal, N.; Harrus, S. Hepatozoon species infection in domestic cats: A retrospective study. Vet. Parasitol. 1998, 79, 123–133. [Google Scholar] [CrossRef]
  36. Beaufils, J.P.; Martin-Granel, J.; Jumelle, P. Hepatozoon spp. parasitemia and feline leukemia virus infection in two cats. Feline Pract. 1998, 26, 10–13. [Google Scholar]
  37. Macieira, D.B.; Menezes, R.d.C.A.d.; Damico, C.B.; Almosny, N.R.; McLane, H.L.; Daggy, J.K.; Messick, J.B. Prevalence and risk factors for hemoplasmas in domestic cats naturally infected with feline immunodeficiency virus and/or feline leukemia virus in Rio de Janeiro—Brazil. J. Feline Med. Surg. 2008, 10, 120–129. [Google Scholar] [CrossRef]
  38. Persichetti, M.F.; Pennisi, M.G.; Vullo, A.; Masucci, M.; Migliazzo, A.; Solano-Gallego, L. Clinical evaluation of outdoor cats exposed to ectoparasites and associated risk for vector-borne infections in southern Italy. Parasites Vectors 2018, 11, 136. [Google Scholar] [CrossRef] [PubMed]
  39. Gentilini, F.; Novacco, M.; Turba, M.E.; Willi, B.; Bacci, M.L.; Hofmann-Lehmann, R. Use of combined conventional and real-time PCR to determine the epidemiology of feline haemoplasma infections in northern Italy. J. Feline Med. Surg. 2009, 11, 277–285. [Google Scholar] [CrossRef]
  40. Sarvani, E.; Tasker, S.; Filipović, M.K.; Andrić, J.F.; Andrić, N.; Aquino, L.; English, S.; Attipa, C.; Leutenegger, C.M.; Helps, C.R.; et al. Prevalence and risk factor analysis for feline haemoplasmas in cats from Northern Serbia, with molecular subtyping of feline immunodeficiency virus. J. Feline Med. Surg. Open Rep. 2018, 4, 2055116918770037. [Google Scholar] [CrossRef]
  41. Vergara, R.W.; Galleguillos, F.M.; Jaramillo, M.G.; Almosny, N.R.P.; Martínez, P.A.; Behne, P.G.; Acosta-Jamett, G.; Müller, A. Prevalence, risk factor analysis, and hematological findings of hemoplasma infection in domestic cats from Valdivia, Southern Chile. Comp. Immunol. Microbiol. Infect. Dis. 2016, 46, 20–26. [Google Scholar] [CrossRef]
  42. Mackenstedt, U.; Jenkins, D.; Romig, T. The role of wildlife in the transmission of parasitic zoonoses in peri-urban and urban areas. Int. J. Parasitol. Parasites Wildl. 2015, 4, 71–79. [Google Scholar] [CrossRef] [Green Version]
  43. Panait, L.C.; Mihalca, A.D.; Modrý, D.; Juránková, J.; Ionică, A.M.; Deak, G.; Gherman, C.M.; Heddergott, M.; Hodžić, A.; Veronesi, F.; et al. Three new species of Cytauxzoon in European wild felids. Vet. Parasitol. 2021, 290, 109344. [Google Scholar] [CrossRef] [PubMed]
  44. Lesiczka, P.M.; Rudenko, N.; Golovchenko, M.; Juránková, J.; Daněk, O.; Modrý, D.; Hrazdilová, K. Red fox (Vulpes vulpes) play an important role in the propagation of tick-borne pathogens. Ticks Tick Borne Dis. 2023, 14, 102076. [Google Scholar] [CrossRef] [PubMed]
  45. Najm, N.-A.; Meyer-Kayser, E.; Hoffmann, L.; Pfister, K.; Silaghi, C. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: Molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitol. Res. 2014, 113, 2679–2685. [Google Scholar] [CrossRef]
  46. Ferrara, G.; Brocherel, G.; Falorni, B.; Gori, R.; Pagnini, U.; Montagnaro, S. A retrospective serosurvey of selected pathogens in red foxes (Vulpes vulpes) in the Tuscany region, Italy. Acta Vet. Scand. 2023, 65, 35. [Google Scholar] [CrossRef] [PubMed]
  47. Petruccelli, A.; Ferrara, G.; Iovane, G.; Schettini, R.; Ciarcia, R.; Caputo, V.; Pompameo, M.; Pagnini, U.; Montagnaro, S. Seroprevalence of Ehrlichia spp., Anaplasma spp., Borrelia burgdorferi sensu lato, and Dirofilaria immitis in Stray Dogs, from 2016 to 2019, in Southern Italy. Animals 2020, 11, 9. [Google Scholar] [CrossRef]
  48. Schäfer, I.; Kohn, B.; Silaghi, C.; Fischer, S.; Marsboom, C.; Hendrickx, G.; Müller, E. Molecular and Serological Detection of Anaplasma phagocytophilum in Dogs from Germany (2008–2020). Animals 2023, 13, 720. [Google Scholar] [CrossRef]
  49. Schäfer, I.; Kohn, B.; Volkmann, M.; Müller, E. Retrospective evaluation of vector-borne pathogens in cats living in Germany (2012–2020). Parasites Vectors 2021, 14, 123. [Google Scholar] [CrossRef]
  50. Pennisi, M.G.; Marsilio, F.; Hartmann, K.; Lloret, A.; Addie, D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; et al. Bartonella Species Infection in Cats: ABCD guidelines on prevention and management. J. Feline Med. Surg. 2013, 15, 563–569. [Google Scholar] [CrossRef]
  51. Álvarez-Fernández, A.; Maggi, R.; Martín-Valls, G.E.; Baxarias, M.; Breitschwerdt, E.B.; Solano-Gallego, L. Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia (Spain). Parasites Vectors 2022, 15, 6. [Google Scholar] [CrossRef]
  52. Probst, J.; Springer, A.; Strube, C. Year-round tick exposure of dogs and cats in Germany and Austria: Results from a tick collection study. Parasites Vectors 2023, 16, 70. [Google Scholar] [CrossRef] [PubMed]
  53. Schäfer, I.; Kohn, B. Anaplasma phagocytophilum infection in cats: A literature review to raise clinical awareness. J. Feline Med. Surg. 2020, 22, 428–441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Gentil, M.; Zapf, F.; Heusinger, A.; Kohn, B.; Müller, E. Vorkommen von Babesia spp. and Cytauxzoon spp. bei Katzen in Europa. In Proceedings of the DVG-Kongress, DVG-Kongress 2021, Berlin, Germany, 18–20 November 2021. [Google Scholar]
  55. Lappin, M.R.; Hawley, J. Presence of Bartonella species and Rickettsia species DNA in the blood, oral cavity, skin and claw beds of cats in the United States. Vet. Dermatol. 2009, 20, 509–514. [Google Scholar] [CrossRef] [PubMed]
  56. Tasker, S.; Hofmann-Lehmann, R.; Belák, S.; Frymus, T.; Addie, D.D.; Pennisi, M.G.; Boucraut-Baralon, C.; Egberink, H.; Hartmann, K.; Hosie, M.J.; et al. Haemoplasmosis in cats: European guidelines from the ABCD on prevention and management. J. Feline Med. Surg. 2018, 20, 256–261. [Google Scholar] [CrossRef] [Green Version]
Table 1. TaqMan® real-time PCR testing applied for the detection of vector-borne pathogens performed on stray cats in eastern Germany (Thuringia).
Table 1. TaqMan® real-time PCR testing applied for the detection of vector-borne pathogens performed on stray cats in eastern Germany (Thuringia).
PathogenGene TargetPrimer Sequence (5′-3′)
Anaplasma phagocytophilum60 kDa heat shock proteinF: CTCTGAGCACGCTTGTACT
R: GCCTTTACAGCAGCAACTTGAAG
Rickettsia spp.23S rRNAF: AGCTTGCTTTTGGATCATTTGG
R: TTCCTTGCCTTTTCATACATCTAGT
Mycoplasma haemofelis16S rDNAF: GTGCTACAATGGCGAACACA
R: TCCTATCCGAACTGAGACGAA
Candidatus Mycoplasma hemominutum16S rDNAF: TGATCTATTGTKAAAGGCACTTGCT
R: TTAGCCTCYGGTGTTCCTCAA
Candidatus Mycoplasma turicensis16S rDNAF: AGAGGCGAAGGCGAAAACT
R: CTACAACGCCGAAACACAAA
Piroplasms (Babesia spp./Cytauxzoon sp.)small subunit ribosomal DNAF: AATACCCAATCCTGACACAGGG
R: TTAAATACGAATGCCCCCAAC
Hepatozoon spp.18S rRNAF: AACACGGGAAAACTCACCAG
R: CCTCAAACTTCCTCGCGTTA
Table 2. Percentages of stray cats in Thuringia (Germany) tested for several vector-borne pathogens by direct and/or indirect detection methods (n tested positive/N total (%)).
Table 2. Percentages of stray cats in Thuringia (Germany) tested for several vector-borne pathogens by direct and/or indirect detection methods (n tested positive/N total (%)).
PathogenDirect Detection Methods (PCR)Indirect Detection Methods (IFAT)
Anaplasma phagocytophilum2/50 (4)8/50 (16)
Rickettsia spp.0/50 (0)15/50 (30)
Hemotropic Mycoplasma spp.6/50 (12)-/-
Bartonella spp.-/-23/50 (46)
Piroplasms (Babesia spp./Cytauxzoon sp.)0/50 (0)-/-
Hepatozoon spp.5/50 (10)-/-
Total (including coinfections)11/50 (22)33/50 (66)
IFAT = immunofluorescence antibody testing, PCR = polymerase chain reaction.
Table 3. Multiple logistic regression analysis in 48 stray cats tested positive for several vector-borne pathogens by direct (polymerase chain reaction [PCR]) and/or indirect (immunofluorescence antibody test [IFAT]) detection methods in which data regarding sex, age, and FIV antibody status were available.
Table 3. Multiple logistic regression analysis in 48 stray cats tested positive for several vector-borne pathogens by direct (polymerase chain reaction [PCR]) and/or indirect (immunofluorescence antibody test [IFAT]) detection methods in which data regarding sex, age, and FIV antibody status were available.
PathogenVariablesBSEWaldpOdds Ratio95% CI for Odds Ratio (Lower/Upper Bound)
Anaplasma phagocytophilum
PCR		Sex (male)−0.9301.5100.3790.5380.3950.020/7.618
Age (>3 years)1.4821.5120.9610.3274.4020.227/85.233
FIV (positive)18.80610990.4850.0000.999--
Anaplasma phagocytophilum
IFAT		Sex (male)0.16851.1852.0220.1555.4930.528/55.028
Age (>3 years)2.3900.9775.9780.01410.9081.607/74.065
FIV (positive)1.8941.0223.4360.0646.6430.897/49.162
Rickettsia spp. IFATSex (male)0.5730.7080.6550.4181.7740.443/7.106
Age (>3 years)0.8350.7171.3570.2442.3040.566/9.389
FIV (positive)−0.2750.7870.1220.7270.7590.162/3.552
Bartonella spp. IFATSex (male)0.2470.6070.1660.6841.2810.390/4.206
Age (>3 years)0.1100.6730.0270.8701.1160.299/4.170
FIV (positive)0.1410.6800.0430.8361.1510.304/4.206
Candidatus Mycoplasma haemominutum PCRSex (male)−1.3450.9392.0510.1520.2600.041/1.642
Age (>3 years)0.3780.9910.1450.7031.4590.209/10.171
FIV (positive)0.1831.0020.0330.8551.2010.168/8.558
Hepatozoon spp. PCRSex (male)−0.7671.0210.5640.4530.4650.063/3.437
Age (>3 years)0.5131.0580.2350.6281.6700.210/13.286
FIV (positive)−1.5581.0172.3470.1250.2110.029/1.545
B = unstandardized regression weight; CI = confidence interval, SE = standard error of the mean, Wald = test statistic for Wald chi-squared test. Variables entered: regarding age: >3 years, regarding sex: male, regarding FIV status: positive. Degrees of freedom were 1 for all Wald statistics.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Schäfer, I.; Peukert, A.; Kerner, K.; Müller, E. Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia). Animals 2023, 13, 2574. https://doi.org/10.3390/ani13162574

AMA Style

Schäfer I, Peukert A, Kerner K, Müller E. Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia). Animals. 2023; 13(16):2574. https://doi.org/10.3390/ani13162574

Chicago/Turabian Style

Schäfer, Ingo, Axel Peukert, Katharina Kerner, and Elisabeth Müller. 2023. "Vector-Borne Pathogens in Stray Cats in Eastern Germany (Thuringia)" Animals 13, no. 16: 2574. https://doi.org/10.3390/ani13162574

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop